ID: 987558988

View in Genome Browser
Species Human (GRCh38)
Location 5:19494222-19494244
Sequence CTAAAACATAAATAAATCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1288
Summary {0: 1, 1: 0, 2: 2, 3: 123, 4: 1162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987558988 Original CRISPR CTAAAACATAAATAAATCGA TGG (reversed) Intronic
900699769 1:4039095-4039117 CAAAAACAAAGATAAATAGATGG + Intergenic
900723647 1:4199349-4199371 CAAAAACAAAGATAAATAGATGG + Intergenic
901100822 1:6717227-6717249 TTAAAAAATAAATAAATAAAAGG - Intergenic
901614501 1:10527656-10527678 CAAAAAAATAAATAAATAAAAGG - Intronic
902888063 1:19420839-19420861 ATAAAAAATAAATAAATAAAGGG + Intronic
902967866 1:20023346-20023368 CAAAAACAAATATAAATAGATGG - Intergenic
903530600 1:24027450-24027472 CTAATAAATAAATAAATAAATGG - Intergenic
904072810 1:27814864-27814886 GTGAAACCTAAATATATCGAGGG - Intronic
904849940 1:33450831-33450853 CGAAAACAAAGATAAATAGATGG + Intergenic
905100816 1:35520553-35520575 ATAAAACATAAAAAAATAGCTGG - Intronic
906486227 1:46237477-46237499 CAAAAATACAAATAAATTGAAGG + Intergenic
906956111 1:50375909-50375931 CAAAAACAAAGATAAATAGAAGG + Intergenic
907087682 1:51691977-51691999 TTAAAAAATAAATAAATAGAAGG + Intronic
907163818 1:52392289-52392311 CTAAAACATAAAAAATTAGCCGG - Intronic
907986752 1:59539121-59539143 AGAAGTCATAAATAAATCGAGGG + Intronic
908608668 1:65830247-65830269 TTGAAAAATAAATAAATTGAAGG + Intronic
909131361 1:71741429-71741451 CTGAAACATAAATTAAACAAAGG - Intronic
909206162 1:72760426-72760448 CAAAAACAAAAATAAATAAATGG - Intergenic
909212477 1:72842128-72842150 CAAAAACAAAGATAAATAGATGG + Intergenic
909234829 1:73139499-73139521 TAAAAACAAAAATAAATAGATGG - Intergenic
909303984 1:74048574-74048596 CTAAAATATGAATGAATGGATGG - Intronic
909397062 1:75182010-75182032 CAAAAACAAAGATAAATGGATGG - Intergenic
909553739 1:76929375-76929397 ATAAAACATTAAAAAATAGAAGG + Intronic
909614065 1:77587192-77587214 TTAAAACATAAAAAACTAGATGG - Intronic
909860508 1:80599140-80599162 CAAAAACAAAGATAAATAGATGG + Intergenic
910063839 1:83127527-83127549 CAAAAAAATAAATAAATAAAAGG + Intergenic
910154586 1:84200141-84200163 CTAAAAAGTAAAAAAATGGAAGG - Intronic
910166573 1:84334509-84334531 ATAAAAGATGAACAAATCGAGGG - Intronic
910233535 1:85010922-85010944 CAAAAACAAAGATAAATAGATGG + Intronic
910323918 1:85981625-85981647 CAAAAAGAAAAATAAATAGATGG + Intronic
910658023 1:89638236-89638258 CTAAAACAAAAATCCATCCAAGG + Intronic
910664123 1:89705776-89705798 CTCAAAAATAAATAAATAAATGG + Intronic
910782090 1:90950114-90950136 CTAAAATATAAAAAATTCGCAGG + Intronic
910858996 1:91725032-91725054 CTAAAACATAAAAAAATAGATGG - Intronic
911254048 1:95614126-95614148 CTAAATCATCACTAAATCCAAGG - Intergenic
911603784 1:99877092-99877114 TTAAAAAATAAATATATCAATGG - Intronic
911655853 1:100443333-100443355 CTCAAAAATAAATAAATAAAAGG - Intronic
911739592 1:101372668-101372690 CAAAAACAAAGATAAATAGATGG - Intergenic
911903293 1:103531840-103531862 CAAAAACAAAGATAAATAGATGG - Intronic
912025603 1:105167183-105167205 CAAAAACAAAAATAAATAGATGG + Intergenic
912161538 1:106991824-106991846 TAAAAACAAAAATAAATAGATGG + Intergenic
912283387 1:108341486-108341508 CTAAAAGAGAAATAAATAAATGG + Intergenic
913194738 1:116446379-116446401 CAAAAACAAAAATAAATAGATGG - Intergenic
913207017 1:116548310-116548332 CAAAAACAAAGATAAATAGATGG - Intronic
913417776 1:118630776-118630798 CAAAAACAAAGATAAATAGATGG - Intergenic
913428302 1:118759670-118759692 CTATAACAAAAATATATTGATGG + Intergenic
913676155 1:121142651-121142673 CAAAAACAAAAATAAATAAAGGG - Intergenic
913694294 1:121309268-121309290 ATAAAAAATAAATAAATAAATGG - Intronic
913709235 1:121464817-121464839 ATAAAAAATAAATAAATGGATGG - Intergenic
914028048 1:143930595-143930617 CAAAAACAAAAATAAATAAAGGG - Intergenic
915389490 1:155528686-155528708 TTAAAAAATCAATAAATCAATGG - Intronic
915582125 1:156819985-156820007 CAAGAACAAAAATAAATAGATGG - Intronic
915675785 1:157528939-157528961 CAAAAACAATAATAAATAGATGG + Intronic
915750993 1:158210855-158210877 CAAAAACAATAATAAATAGAAGG - Intergenic
915800427 1:158785987-158786009 CAAAAACAAAAATAAATATATGG + Intergenic
915855235 1:159376717-159376739 CAAAAACAAAGATAAATAGATGG - Intergenic
916277631 1:163012484-163012506 CAAAACCAAAAATAAATAGATGG - Intergenic
916382135 1:164223655-164223677 ATAAAACAAAAATAAATAAATGG + Intergenic
916526553 1:165615756-165615778 CTAAAACAAAGATAAATAGATGG - Intergenic
916557595 1:165906668-165906690 CAAAAAAATAAATAAAACAATGG - Intronic
916565946 1:165977602-165977624 CAAAAACAAAGATAAATAGATGG - Intergenic
916855974 1:168750307-168750329 CAAAAACAAAAATAAATAAATGG - Intergenic
917107796 1:171511234-171511256 CTACAACTTAATTAAATTGAAGG + Intronic
917317116 1:173737234-173737256 CAAAAACAAAGATAAATAGATGG - Intronic
917403433 1:174677873-174677895 TTAAAACCTAGATAAATAGATGG + Intronic
917573328 1:176293580-176293602 TAAAAACAAAAATAAATCAATGG + Intergenic
917886713 1:179392983-179393005 CAAAAACAAAAATAAATAGATGG - Intronic
918002517 1:180510930-180510952 CAAAAACAAAAATAAATAAATGG - Intergenic
918172665 1:182012036-182012058 CAAAAACAAAGATAAATAGATGG + Intergenic
918952514 1:191157964-191157986 CTAAACCAAAAATAAGTAGAAGG + Intergenic
919160557 1:193824875-193824897 CAAAAACAAAGATAAATAGATGG + Intergenic
919407671 1:197204785-197204807 CAAAAACAAAGATAAATAGATGG - Intergenic
919439878 1:197619262-197619284 TTGTAACATAAATAAATCCATGG - Intronic
919485278 1:198138553-198138575 CAAAAACAAAGATAAATAGATGG - Intergenic
919532521 1:198741797-198741819 ATGAAACATAAATAAGTGGAAGG - Intronic
919571443 1:199254019-199254041 CAAAAACGAAAATAAATAGATGG - Intergenic
920463523 1:206161489-206161511 CAAAAACAAAAATAAATAAAGGG - Intergenic
920481622 1:206327653-206327675 ATAAAAAATAAATAAATAAATGG - Intronic
920800328 1:209181743-209181765 CAAAAACAAAGATAAATAGATGG + Intergenic
921301633 1:213756470-213756492 TTAAAATATATATAAATTGAAGG + Intergenic
921788231 1:219258749-219258771 CAAAAACAACAATAAATAGATGG + Intergenic
921879953 1:220244949-220244971 CAAAAACAAAAATAAATAAATGG + Intronic
922191899 1:223326475-223326497 CAAAAACAAAAATAAATAAATGG + Intronic
922727532 1:227929803-227929825 ATAAAATATAAATAAATAAAAGG + Intronic
922743178 1:228027785-228027807 CAAAAACAAAAATAAATAAATGG - Intronic
923067338 1:230530660-230530682 CAAAAACAAAGATAAATAGATGG + Intergenic
923122644 1:231007586-231007608 CAAAAACAAAAATAAATAGATGG + Intergenic
923442408 1:234033367-234033389 CAAAAACAAAGATAAATAGATGG - Intronic
923459184 1:234193573-234193595 CAAAAACAAAAATAAATAGGTGG + Intronic
923657177 1:235927452-235927474 CAAAAACAAAAATAAATAAATGG - Intergenic
923919642 1:238548731-238548753 CCAAAACAAAGATAAATAGATGG + Intergenic
924004680 1:239595506-239595528 CAAATACTTAAATAAATCCAAGG - Intronic
924192856 1:241573286-241573308 CTAAAACAGAAATAAATAAATGG - Intronic
924685526 1:246285622-246285644 CAAAAACAAAGATAAATAGATGG + Intronic
924845773 1:247768705-247768727 CAAAAACAGAGATAAATAGATGG + Intergenic
1063246234 10:4221947-4221969 GTAAAACCTAAATAAAAGGAAGG + Intergenic
1063858104 10:10277685-10277707 AGAAAACATAAATAAATGAAAGG - Intergenic
1064116476 10:12581900-12581922 CAAAAACAAAGATAAATAGATGG - Intronic
1064275643 10:13902676-13902698 CTAAAACACAAAAAAATAGCTGG + Intronic
1064317087 10:14268501-14268523 TGAAAAAATAAATAAATCGAGGG - Intronic
1064480298 10:15733943-15733965 TTAAAAAATAAATAAATGGGGGG + Intergenic
1064770171 10:18714771-18714793 GTAAAAGATAAATAAATAAAAGG - Intergenic
1064867417 10:19896610-19896632 CTCAAATATAAAAAAATCAAAGG - Intronic
1065079566 10:22114406-22114428 CAAAAACAAAGATAAATCGGTGG - Intergenic
1065149698 10:22810178-22810200 CGAAAACAAAAATAAATAGATGG - Intergenic
1065162309 10:22935361-22935383 TTAAAAAATAAATAAATAAATGG + Intronic
1065306723 10:24376229-24376251 CTATAGGATAAATAATTCGAAGG + Intronic
1065418151 10:25511549-25511571 CAAAAACAAAGATAAATAGAGGG - Intronic
1065462846 10:25987340-25987362 CAAAAACAAAGATAAATAGATGG + Intronic
1065894177 10:30147348-30147370 CAAAAACAAAGATAAATAGATGG - Intergenic
1066143343 10:32529783-32529805 CAAAAACAAAGATAAATAGATGG - Intronic
1066170754 10:32842079-32842101 CAAAAACAAAGATAAATAGATGG + Intronic
1066600448 10:37100301-37100323 CAAAAACAAAGATAAATAGATGG + Intergenic
1066753293 10:38682489-38682511 CAAAAACAAAGATAAATAGATGG + Intergenic
1067303817 10:45039562-45039584 CAAAAACAAAAGTAAATAGATGG + Intergenic
1067488297 10:46673430-46673452 ATAAAAAATAAATAAATAAAAGG + Intergenic
1067491874 10:46715638-46715660 TTAAAAAATAAATAATTCAAAGG + Intergenic
1067602785 10:47624737-47624759 TTAAAAAATAAATAATTCAAAGG - Intergenic
1067606506 10:47668598-47668620 ATAAAAAATAAATAAATAAAAGG - Intergenic
1067659084 10:48220567-48220589 CAAAAACAAAGATAAATAGATGG + Intronic
1067695296 10:48530397-48530419 CAAAAACAAAGATAAATAGATGG + Intronic
1068011470 10:51456574-51456596 CAAAACCAAAAATAAATAGATGG + Intronic
1068114900 10:52726092-52726114 CAAAAACAAAAATAAATAGATGG + Intergenic
1068122394 10:52796250-52796272 CAAAAACAAAGATAAATAGATGG - Intergenic
1068172646 10:53416040-53416062 CAAAAACAAAGATAAATAGATGG - Intergenic
1068670858 10:59722058-59722080 CAAAAACAAAGATAAATAGATGG - Intronic
1068838583 10:61584386-61584408 CAAAAAAATAAATAAATAAAAGG + Intergenic
1068918482 10:62459131-62459153 CTAAAACACACATAGATGGAGGG + Intronic
1069947503 10:71998140-71998162 CCCAAAAATAAATAAATCAAAGG + Intronic
1070103373 10:73410135-73410157 CAAAAACAAAAATAAATAGATGG + Intronic
1070500552 10:77069032-77069054 CAAAAACAAAAACAAATCAATGG + Intronic
1070839533 10:79474069-79474091 CTAAAAAATAAAAAAATAGCAGG + Intergenic
1071015434 10:80991718-80991740 CTAAAACAAAGTTAAATCGATGG - Intergenic
1071054388 10:81492086-81492108 CTAAAACAAAGATAAATAGATGG - Intergenic
1071163035 10:82773597-82773619 CAAAAACAAAAATAAATAAATGG - Intronic
1071279970 10:84092511-84092533 TTAAAAAATAAATAAATAGAGGG - Intergenic
1071332877 10:84577811-84577833 ATAAAACCTAAATCAATGGAAGG + Intergenic
1071373752 10:84981314-84981336 CAAAAACAAAAATAAATAGATGG + Intergenic
1071560281 10:86641073-86641095 TTTAAAAATAAATAAATAGAGGG + Intergenic
1071732707 10:88264847-88264869 CAAAAACAAAGATAAATAGATGG - Intergenic
1071892332 10:90024084-90024106 CTGAACCATAAATAAATAAATGG - Intergenic
1071949889 10:90691001-90691023 CAAAAAAATAAATAAATACACGG + Intergenic
1072112825 10:92339367-92339389 CTCAAAAATAAATAAATAGCTGG + Intronic
1072159121 10:92749946-92749968 CTCAAAAATAAATAAATAAAGGG - Intergenic
1072324003 10:94278183-94278205 TTAAAACATACATAATTCCAGGG + Intronic
1072581821 10:96746413-96746435 CTAATAAATAAATAAATAAATGG + Intergenic
1072868428 10:99089184-99089206 CCAAAACAAAAATAAATGGATGG - Intronic
1073113233 10:101075170-101075192 CAAAAAAATAAATAAATAGCTGG - Intergenic
1073701361 10:105930637-105930659 CAAAAACAAAGATAAATAGAGGG + Intergenic
1074894962 10:117768452-117768474 AGAAGACATAAATAAATGGACGG + Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075341770 10:121652334-121652356 CAAAAACAAAGATAAATAGATGG + Intergenic
1076104314 10:127808523-127808545 CGAAAAAATAAATAAATCTTGGG + Intergenic
1076552955 10:131296747-131296769 ATAAGACATTAATAAATGGAGGG - Intronic
1078109272 11:8379273-8379295 CAAAAACAAAAATAAATAAATGG + Intergenic
1078381650 11:10847739-10847761 CAAAAAAATAAATAAATAAATGG - Intronic
1078588373 11:12615278-12615300 CAAAAACAAAGATAAATAGATGG + Intergenic
1078686902 11:13540740-13540762 CAAAAACAAAAATAAATAGATGG - Intergenic
1078842051 11:15086682-15086704 CAAAAACAAAAATAAATAGATGG - Intergenic
1078988769 11:16623573-16623595 CAAAAACAAAGATAAATAGATGG - Intronic
1078991580 11:16652742-16652764 CAAAAACAAAAATAAATAGATGG + Intronic
1079178508 11:18167172-18167194 CAAAAACAAAAATAAATAGATGG + Intronic
1079270337 11:18978936-18978958 CAAAAACAAAAATAAATAGATGG - Intergenic
1079805638 11:24927270-24927292 CAAAAACAAAGATAAATAGATGG - Intronic
1079871950 11:25808839-25808861 CTAAAACATAGATGAATCTTGGG + Intergenic
1080047586 11:27825739-27825761 CAAAAACAAAAATAAATAAATGG - Intergenic
1080202957 11:29694776-29694798 CAAAAACAAAGATAAATAGATGG - Intergenic
1080670198 11:34369413-34369435 CAAAAACAAAGATAAATAGATGG + Intergenic
1080799480 11:35596898-35596920 CAAAAACAAAAATAAATAGGTGG + Intergenic
1080831657 11:35899174-35899196 AGAAAACCTAAATAAATAGATGG + Intergenic
1081324976 11:41733345-41733367 CTAAAACATAATAAAATACACGG + Intergenic
1081326287 11:41749191-41749213 CAAAAACAAAGATAAATAGATGG - Intergenic
1081530703 11:43957235-43957257 CAAAAACATAAATCAATGCATGG + Intergenic
1081696477 11:45112963-45112985 CAAAAACAAAAATAAATGAATGG - Intronic
1082111461 11:48280520-48280542 CAAAAACAAAAATAAGTAGATGG - Intergenic
1082560117 11:54609035-54609057 TAAATACATAAATAAATGGAGGG - Intergenic
1082620292 11:55412120-55412142 CTTAAACAAAAATAATTCTAAGG - Intergenic
1082680135 11:56157530-56157552 CAAAAACAAAAATAAATAAATGG + Intergenic
1082685865 11:56238682-56238704 CAAAAACAAAAATAAATAAATGG - Intergenic
1082687905 11:56261833-56261855 CAAAAACAAAAATAAATAAATGG + Intergenic
1083576450 11:63795425-63795447 CAAAAAAATAAATAAATAAAAGG - Intergenic
1083832380 11:65241188-65241210 CAAAAATAAAAATAAATGGAAGG + Intergenic
1083942547 11:65904649-65904671 CTCAAAAATAAATAAATAAATGG - Intergenic
1084663868 11:70565243-70565265 CTCAAAAATAAATAAATGGATGG - Intronic
1085138392 11:74116103-74116125 CAAAAACAAAGATAAATAGATGG + Intronic
1085174084 11:74471542-74471564 CTAGAACATAAATTCATTGAGGG + Intergenic
1085894247 11:80618601-80618623 AGAAAACATAAATAAATTGCTGG + Intergenic
1085988599 11:81812691-81812713 GTAAACCAAAAATAAATCTAAGG + Intergenic
1086202160 11:84216973-84216995 CTAAAAAATAAATGAATGGAAGG + Intronic
1086315280 11:85585013-85585035 CAAAAACAAAGATAAATAGATGG - Intronic
1086864588 11:91964745-91964767 CAAAAACAAAGATAAATAGATGG + Intergenic
1086986379 11:93254400-93254422 CAAAAACAAAGATAAATAGATGG + Intergenic
1087030700 11:93701362-93701384 CAAAAAAATAAATAAATGAAAGG + Intronic
1087055297 11:93929678-93929700 CTAAAACAAAAATAAATAAATGG - Intergenic
1087395657 11:97593813-97593835 CCAAAACAAAAATAAAAAGATGG + Intergenic
1087405717 11:97727556-97727578 CAAAAACAAAAATAAATAGATGG + Intergenic
1087495100 11:98881126-98881148 CTAAAACATAAATCAAAAGCTGG - Intergenic
1087602447 11:100333913-100333935 CAAAAACAAAGATAAATAGATGG + Intronic
1088180900 11:107108958-107108980 CAAAAACAAAAATAAATAAATGG + Intergenic
1088217354 11:107526486-107526508 CGTAAACATAAATAAATAGCAGG + Intronic
1088255785 11:107902322-107902344 CAAAAAAATAAATAAATAAAAGG + Intronic
1088346282 11:108829600-108829622 CAAAAACAAAGATAAATAGATGG - Intronic
1088525589 11:110749836-110749858 CAAAAACAAAGATAAATAGATGG - Intergenic
1088825006 11:113486203-113486225 CAAAAACAAAGATAAATAGATGG + Intergenic
1088951561 11:114576330-114576352 CAAAAACAAACATAAATGGATGG + Intronic
1089027156 11:115283265-115283287 CTGAAGTATAATTAAATCGATGG + Intronic
1089336601 11:117728787-117728809 AGAAGACATAAATAAATGGAAGG + Intronic
1089404891 11:118189631-118189653 CAAAAACAAAGATAAATAGATGG - Intergenic
1089851880 11:121504674-121504696 CAAAAAAATAAATAAATAAAAGG - Intronic
1090483602 11:127090648-127090670 CAAAAACAAAGATAAATAGATGG + Intergenic
1090538435 11:127672746-127672768 CTGATACATAAATAGATCAATGG - Intergenic
1091470025 12:718485-718507 CTGAAACCTACATAACTCGAGGG + Intergenic
1092037832 12:5355107-5355129 CAAAAACCAAAATAAATGGAAGG + Intergenic
1092423455 12:8353773-8353795 CAAAAACAAAGATAAATAGATGG - Intergenic
1092647664 12:10594604-10594626 CAAATACATAAATAAATGAAAGG + Intergenic
1092811749 12:12277067-12277089 CTCAAAAATAAATAAATAAATGG + Intergenic
1092872402 12:12817540-12817562 CTGAAACAGACATAAATAGATGG - Intronic
1093034129 12:14317007-14317029 CTCACACATAAAAAAATAGAGGG - Intergenic
1093260034 12:16924544-16924566 GTAAAATATAAATAAATATATGG - Intergenic
1093284538 12:17242289-17242311 CAAAAACAAAAATAAATATATGG - Intergenic
1093287654 12:17284484-17284506 CAAAAACAAAAATAAATAGCTGG + Intergenic
1093489841 12:19692829-19692851 CGAAAACAAAGATAAATAGATGG + Intronic
1093628530 12:21381144-21381166 CAAAAACAAAAATAAATAAATGG + Intronic
1093747948 12:22764357-22764379 CTACAACTTAAATAGATAGATGG + Intergenic
1093770900 12:23017429-23017451 CAAAAACAAAAATAAATAGATGG - Intergenic
1093868255 12:24255062-24255084 CTGAACCATCAATAAATCAAGGG + Intergenic
1093964997 12:25314920-25314942 CAAAAACAAAGATAAATAGATGG + Intergenic
1094068644 12:26388461-26388483 CAAAAAAATAAATAAATAAAAGG - Intronic
1094084591 12:26575584-26575606 CTAAAAAATAATTATATCGAAGG - Intronic
1094165830 12:27442605-27442627 TCAAAAAATAAATAAATCAATGG - Intergenic
1094446892 12:30540793-30540815 CAAAAACAAACATAAATAGATGG - Intergenic
1094591338 12:31824087-31824109 CAAAAACAAAAATAATTAGATGG - Intergenic
1095176710 12:39100884-39100906 CAAAAACAAACATAAATAGATGG + Intergenic
1095554690 12:43486557-43486579 CAAAAACAAAAATAAATAAATGG + Intronic
1096288448 12:50320869-50320891 CAAAAATAAAAATAAATAGATGG - Intergenic
1096344730 12:50835503-50835525 CAAAAACAAAGATAAATAGATGG + Intergenic
1096620788 12:52863722-52863744 AAAAAACATAAATAAGTAGAAGG + Intergenic
1096990565 12:55798495-55798517 CTCAAAAATAAATAAATAAAGGG + Intronic
1097230120 12:57505811-57505833 CTAAAGCATAAAAAAATTAAAGG + Intronic
1097371275 12:58784420-58784442 CAAAAACAAAGATAAATAGATGG + Intronic
1097603593 12:61725295-61725317 CAAAAACAAAGATAAATTGATGG - Intronic
1097661170 12:62433487-62433509 ATAAAATGTAAATAAATCTATGG - Intergenic
1098227003 12:68334538-68334560 CTAAAACACAAATGAAAAGAAGG - Intergenic
1098694098 12:73529346-73529368 TAAAAACAAAAATAAATAGATGG - Intergenic
1098716734 12:73836584-73836606 CAAAAAATTAAATAAATTGAAGG - Intergenic
1098755860 12:74362760-74362782 CAAAAACAAAGATAAATGGATGG - Intergenic
1098786076 12:74757365-74757387 CAAAAACAAACATAAATAGATGG - Intergenic
1098876941 12:75875591-75875613 CAAAAACAAAGATAAATAGATGG + Intergenic
1099275608 12:80571867-80571889 ATAACAGATAAATAAATCAATGG - Intronic
1099548635 12:84014949-84014971 CTAAAACAAAGATAAATAAATGG - Intergenic
1099867015 12:88295440-88295462 CAAAAACAAAGATAAATAGATGG + Intergenic
1100139398 12:91598272-91598294 CAAAAACAAAGATAAATAGATGG - Intergenic
1100483165 12:94999456-94999478 CAAAAACAAAAATAAATAAATGG + Intronic
1100504163 12:95203679-95203701 CTGTGAAATAAATAAATCGAGGG + Intronic
1100918944 12:99460394-99460416 CAAAAACAGAGATAAATAGATGG + Intronic
1102108074 12:110342898-110342920 CTAAAACACAAAAAAATGGCAGG - Intronic
1102332059 12:112042401-112042423 TTAAAAAATAAATAAATAAAAGG + Intronic
1102434973 12:112915130-112915152 CAAAAACAAAGATAAATAGATGG - Intronic
1103558541 12:121780055-121780077 CTCAAAAATAAATAAATAAAAGG - Exonic
1104181156 12:126382520-126382542 CAAAAACAAAGATAAATAGATGG + Intergenic
1105565705 13:21545517-21545539 CTAAAAAATACAAAAATTGATGG + Intronic
1105989977 13:25610126-25610148 CAAAAACAAAGATAAATAGATGG - Intronic
1106065568 13:26344862-26344884 TTAAAAAAAAAATAAGTCGAAGG + Intronic
1106424948 13:29618662-29618684 CAAAAACAAAAATAAATAGATGG + Intergenic
1106433115 13:29701004-29701026 CAAAAACAAAAATAAATACATGG + Intergenic
1106673754 13:31935260-31935282 ATAAAAAATAAATAGATGGATGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107841987 13:44467378-44467400 CAAAAACAAAAATAAATAAATGG + Intronic
1107896703 13:44971901-44971923 TTAAAAAAAAAATAAATCCAGGG - Intronic
1108051367 13:46443338-46443360 CTTGAAAATAAATAAATTGATGG - Intergenic
1108098669 13:46932225-46932247 GTAAAACATATATAAATGAATGG + Intergenic
1108181957 13:47849150-47849172 CAAAAACAAAAATAAATAAATGG - Intergenic
1108391187 13:49949334-49949356 CAAAAACAAAGATAAATAGATGG + Intergenic
1108550992 13:51543898-51543920 TAAAGACATAAATAAATGGAAGG + Intergenic
1108982939 13:56542861-56542883 TTAAAAAATAAATAAATAAAAGG - Intergenic
1109082709 13:57926310-57926332 CTAAAATATAAATAATTCTTAGG - Intergenic
1109150910 13:58846236-58846258 CAAAAACAAAGATAAATAGATGG + Intergenic
1109337886 13:61016086-61016108 ACAAAAAATAAATAAATCTATGG - Intergenic
1109474088 13:62855575-62855597 CAAAAACAAAGATAAATAGATGG + Intergenic
1109543923 13:63816957-63816979 CTTAAAAATAAATAAACTGATGG - Intergenic
1109558111 13:64007876-64007898 CAAATAAATAAATAAATAGACGG + Intergenic
1109567884 13:64142237-64142259 CAAAAACAAAGATAAATAGATGG + Intergenic
1109576758 13:64269490-64269512 CAAAAACAAAAATAAATTAATGG + Intergenic
1109678779 13:65718099-65718121 CAAAAACAAAAATAAATAAATGG - Intergenic
1109824615 13:67701806-67701828 CAAAAACAAAGATAAATAGATGG + Intergenic
1109916292 13:68988848-68988870 ATAAAAAATAAATAATTCAAAGG - Intergenic
1109999593 13:70177662-70177684 CTGAAATTTAAATAAATTGAGGG - Intergenic
1110012703 13:70357797-70357819 CTACAACATGAATGAATCTATGG - Intergenic
1110098675 13:71566536-71566558 CTTAAAGATAAATACATGGAAGG - Intronic
1110340247 13:74382028-74382050 CAAAAACAAAGATAAATAGATGG - Intergenic
1110390162 13:74964231-74964253 CTAAAACATATATAGACCAATGG + Intergenic
1110418908 13:75282633-75282655 CAAAAACAAAGATAAATAGATGG - Intergenic
1110489317 13:76085373-76085395 CAAAAACAAAAATAAATACATGG - Intergenic
1110635127 13:77758437-77758459 CTCAAACAAAAATAAATAAATGG - Intronic
1110685768 13:78372348-78372370 CAAAAACAAAAATAAATAAATGG - Intergenic
1111060433 13:83011915-83011937 CTCAAACATAAATAAATGGCCGG - Intergenic
1111143001 13:84146487-84146509 CTAAAGGATAAATAAATCACTGG - Intergenic
1111226015 13:85271893-85271915 CAAAAACAAAAATAAATAGATGG + Intergenic
1111481687 13:88836229-88836251 CCAAAACATAAATGAATACAAGG - Intergenic
1111647078 13:91044738-91044760 CAAAAGCAGAAATAAAGCGATGG + Intergenic
1111756396 13:92401171-92401193 CTAAAAAAAAAAAAAATAGATGG - Intronic
1112002242 13:95221799-95221821 TTAAAAAATAAATAAATCATTGG + Intronic
1112117777 13:96375935-96375957 CAAAAATGTAAATAAATCCAGGG - Intronic
1112250717 13:97776680-97776702 CAAAAACAGAAATAAATACATGG - Intergenic
1112322212 13:98418034-98418056 TAAAAACATAAATAAATAAAAGG - Intronic
1112709793 13:102114421-102114443 CAAAAACAAAAATAAACCGTGGG - Intronic
1112773113 13:102813404-102813426 CTAGAACTAAAATAAATAGATGG - Intronic
1112986267 13:105454009-105454031 CAAAAACAAAAATAAATAAATGG - Intergenic
1113534508 13:111054103-111054125 CAAAAACAAAGATAAATAGATGG - Intergenic
1114071881 14:19117150-19117172 CTAAAGTATAAATTAATGGAAGG + Intergenic
1114090376 14:19282814-19282836 CTAAAGTATAAATTAATGGAAGG - Intergenic
1114545918 14:23500927-23500949 CAAAAACAAAGATAAATAGATGG - Intronic
1114970495 14:28021085-28021107 CTAAAATATAAAAAAATAGCTGG + Intergenic
1115065302 14:29252753-29252775 CTCAAACAAAAATACATTGAGGG - Intergenic
1115150600 14:30280376-30280398 GAAAAATATAAATAAATCAATGG - Intergenic
1115282543 14:31679529-31679551 CTAATATATAAATAAATTCAGGG - Intronic
1115702248 14:35965270-35965292 AGAAAAGATAAATAAATCAAAGG - Intergenic
1115914316 14:38293819-38293841 CAAAAACAAAAATAAATAGATGG - Intergenic
1115947650 14:38680551-38680573 CAAAAACAAAAATAAATAAATGG - Intergenic
1116042698 14:39704390-39704412 CCAAAACAAAAATAAATAAATGG - Intergenic
1116184955 14:41588015-41588037 CAAAAACAAAAATAAATAAATGG - Intergenic
1116209482 14:41915691-41915713 CAAAAACATAAATATATAAAAGG - Intergenic
1116406505 14:44573082-44573104 CAAAAACAAAGATAAATAGATGG + Intergenic
1116735254 14:48682006-48682028 CTAAAATATAAATAAATGTACGG - Intergenic
1116918979 14:50552990-50553012 CAAAAACAAAAATAAATAAATGG + Intronic
1117271766 14:54151702-54151724 CAAAAACAAAGATAAATAGATGG + Intergenic
1117281924 14:54249316-54249338 CAAAAACAAAAATAAAACCATGG - Intergenic
1117317435 14:54586439-54586461 CAAAAACAAAGATAAATAGATGG - Intronic
1117654985 14:57946136-57946158 CAAAAGCAAAAATAAATAGATGG - Intronic
1117794095 14:59374036-59374058 CTCAAACATAAATAATTCATAGG - Intergenic
1118653621 14:67924240-67924262 CTAAAACAAGGATAAATAGATGG - Intronic
1118914405 14:70090207-70090229 GTAAAACATGCATAAATCAATGG - Intronic
1119698826 14:76735695-76735717 TTAAAATCTAAATAAATTGAGGG - Intergenic
1120038098 14:79721290-79721312 CTAAAGCATAATGATATCGAAGG - Intronic
1120450545 14:84661226-84661248 CAAAAACAAAGATAAATAGATGG - Intergenic
1120574205 14:86160824-86160846 CAAAAACAAAAATAAATACATGG - Intergenic
1120643078 14:87038937-87038959 CAAAAACAAAAATAAATAAATGG + Intergenic
1121393997 14:93602114-93602136 CAAAAACAAAAATAAACAGATGG - Intronic
1121575838 14:94986366-94986388 CAAAAACAAAAATAAATAGATGG + Intergenic
1122074755 14:99228901-99228923 CTAAAGAATGAATAAATGGATGG + Intronic
1122331747 14:100922367-100922389 CAAAAACAAAAATAAATAGATGG - Intergenic
1122541712 14:102501541-102501563 CTCAAAAATAAATAAATAGAAGG + Exonic
1123142866 14:106098022-106098044 AGAAAACACAAATAAATGGAAGG - Intergenic
1123143023 14:106099830-106099852 CAAAAACAAAAATAAATTTATGG - Intergenic
1123190897 14:106568701-106568723 AGAAAACACAAATAAATGGAAGG - Intergenic
1123899391 15:24861108-24861130 CAAAAGCATAAATAAATAAAAGG + Intronic
1124059762 15:26279217-26279239 CAAAAACAAAGATAAATAGATGG - Intergenic
1124082104 15:26509409-26509431 GTAAAAAATAAATAAATAAAAGG + Intergenic
1124408338 15:29412218-29412240 ATAAAACCTAAATAAATGGAGGG - Intronic
1125037161 15:35138536-35138558 GTAAAACATAAATAAATTTAGGG - Intergenic
1125110852 15:36031895-36031917 CCTAAAGATAAATAAATAGATGG - Intergenic
1125367878 15:38938725-38938747 CAAAAACAAAGATAAATAGATGG + Intergenic
1126218516 15:46185021-46185043 GTTAAACCTAAATAAATCAAAGG - Intergenic
1126221102 15:46214484-46214506 CAAAAACAAAGATAAATAGATGG + Intergenic
1126245035 15:46494833-46494855 TAAAAACAAAAATAAATAGATGG + Intergenic
1126288153 15:47040338-47040360 CTTACATATAAATAAATGGAAGG + Intergenic
1127090739 15:55464432-55464454 CAAAAACAAAGATAAATAGATGG + Intronic
1127149419 15:56057982-56058004 CTAAAACAGAAATTAATCTTTGG - Intergenic
1127628978 15:60808054-60808076 CAAAAACAAAGATAAATAGACGG + Intronic
1128011962 15:64305780-64305802 AAAAAACACAAATAAATCAATGG + Intronic
1129133649 15:73525382-73525404 CTAAACCAGAAATAAGTAGAAGG - Intronic
1129316136 15:74745784-74745806 CTCAAAAATAAATAAATAAATGG - Intergenic
1129427953 15:75478404-75478426 CTCAAAAATAAATAAATTAAAGG - Intronic
1129632316 15:77274254-77274276 CAAAAACAAAGATAAATAGATGG + Intronic
1131733267 15:95304479-95304501 CTAGAAAATAAATAAATAAAGGG + Intergenic
1131777003 15:95813833-95813855 ATAAAATATAAATAAATAAATGG - Intergenic
1132137792 15:99360517-99360539 TTAAAAAATAAATGAATCAAGGG + Intronic
1132158619 15:99515454-99515476 CTCAAAAATAAATAAATAAATGG - Intergenic
1132173187 15:99684708-99684730 CAAAGACAAAAATAAATAGATGG - Intronic
1132199343 15:99938446-99938468 CAAAAACAAAAATAAATAAATGG - Intergenic
1132257444 15:100388436-100388458 CTAGAAAATAAAAAAATAGATGG + Intergenic
1132412483 15:101593543-101593565 CAAAAACAAAGATAAATAGATGG - Intergenic
1133573913 16:7069175-7069197 TTAAAAAATAAATAAATTAAAGG - Intronic
1134220537 16:12350421-12350443 CTAAAACATCATTTAATAGAAGG + Intronic
1134386135 16:13774236-13774258 CAAAAAAATAAATAAATAAAGGG + Intergenic
1135347508 16:21701615-21701637 CAAAAAAATAAATAAATAAAAGG - Intronic
1135677627 16:24430516-24430538 CTAAAATATAAATAATTAGCTGG + Intergenic
1136729412 16:32394525-32394547 CAAAAACAAAGATAAATAGATGG - Intergenic
1137470784 16:48755976-48755998 CAAAAACAAAAATAAATAAATGG + Intergenic
1137536579 16:49331595-49331617 ATAAAAAATAAATAAATAAAAGG + Intergenic
1138061546 16:53896638-53896660 ATAAAACATACATAAATGCAAGG + Intronic
1138489559 16:57368443-57368465 CGAAAAGATAAATAAATGGCCGG + Intergenic
1138696678 16:58820209-58820231 CTATAACATGAATAAAAAGAGGG + Intergenic
1138704706 16:58903243-58903265 CTACAACATGAATAAAGCTATGG + Intergenic
1139316812 16:66079230-66079252 CAAAAACAGAAATAAATCAATGG - Intergenic
1140070346 16:71643675-71643697 CAAAAAAATAAATAAATAAATGG + Intronic
1140174769 16:72646635-72646657 CTAAAACATAAAAAAAAATAAGG - Intergenic
1140434229 16:74932252-74932274 CTAAAAAATAAAAAAATAGCTGG - Intronic
1140547900 16:75829128-75829150 CAAAAACAAAGATAAATAGATGG - Intergenic
1140557734 16:75940846-75940868 GAAAAAAATAAATAAAGCGAAGG + Intergenic
1140988495 16:80184400-80184422 ATAAAAAATTAATAAATCCAGGG - Intergenic
1141291756 16:82724295-82724317 CTAAAGAATAAATATATGGATGG - Intronic
1202996981 16_KI270728v1_random:122768-122790 CAAAAACAAAGATAAATAGATGG + Intergenic
1203023668 16_KI270728v1_random:435110-435132 CAAAAACAAAGATAAATAGATGG + Intergenic
1142801193 17:2346925-2346947 CAAAAAAATAAATAACTCGCTGG + Intronic
1142803761 17:2361085-2361107 CTAAACCATGAATGAATGGAGGG + Intronic
1143132597 17:4689314-4689336 CAAAAACAAAGATAAATAGATGG + Intronic
1143278044 17:5729017-5729039 CAAAAACAAAGATAAATAGATGG + Intergenic
1144161306 17:12561779-12561801 CAAAAACAAATATAAATAGATGG - Intergenic
1144254321 17:13451102-13451124 CAAAAACAAAGATAAATAGATGG + Intergenic
1144376062 17:14643085-14643107 CAAAAACAAAGATAAATAGACGG + Intergenic
1145413950 17:22697344-22697366 CAAAAACAAAAATAAATAAATGG - Intergenic
1145866096 17:28242614-28242636 CTACAAAATAAATAAATAAAAGG + Intergenic
1146044513 17:29492799-29492821 ATAAAAAATAAATAAATATAAGG + Intronic
1147053041 17:37811739-37811761 CAAAAACAAAAATAAATAAATGG - Intergenic
1147285022 17:39395421-39395443 CTCAAAAATAAATAAATAAAAGG + Intronic
1148120177 17:45204539-45204561 CAAAAACAAAGATAAATAGACGG - Intergenic
1148143973 17:45348920-45348942 CAAAAACAAAAATAAATAAATGG + Intergenic
1148407842 17:47435018-47435040 CCAAAACAAAAATAAATAGATGG + Intronic
1149237564 17:54610708-54610730 CTAAAACCTAACTACATCTAAGG - Intergenic
1149393022 17:56211114-56211136 CAAAAACAAAGATAAATAGATGG - Intronic
1149961004 17:61109952-61109974 CAAAAACAAAGATAAATAGATGG - Intronic
1151644798 17:75423085-75423107 CTAATAAATAAATAAATAAAAGG + Intergenic
1152477861 17:80529942-80529964 ATAAAAAATAAATAAAGCTAAGG + Intergenic
1152842274 17:82577722-82577744 ATAAAACAAAAATAAATAAAAGG - Intronic
1153425506 18:4958977-4958999 CAAAAACAAAGATAAATAGATGG + Intergenic
1153532595 18:6063868-6063890 CAAAAACAAAAATAAATAAATGG - Intronic
1153556573 18:6321208-6321230 CAAAAACAAAAATAAATAAATGG + Intronic
1153931061 18:9880205-9880227 CAAAAACATAAATAAGTGGTTGG + Intergenic
1154090411 18:11354203-11354225 CAAAAACAAAGATAAATAGATGG + Intergenic
1154477272 18:14774824-14774846 CTAAAAAAAAAAAAAATCTAAGG + Intronic
1155010667 18:21774789-21774811 ATAAAAAATAAATAAATAAATGG - Intronic
1155368463 18:25073009-25073031 CTTAAAGATAAATAAATCTTTGG + Intronic
1155524075 18:26698906-26698928 CAAAAACATCAATAAATCCCTGG - Intergenic
1155610058 18:27656756-27656778 TTAAAACATATATATATGGATGG - Intergenic
1155987729 18:32248046-32248068 CAAAAACAAAAATAAATAAATGG - Intronic
1156018421 18:32572696-32572718 CAAAAACAAAAATAAATAAATGG + Intergenic
1156327110 18:36084932-36084954 CAAAAACAAAGATAAATAGATGG + Intergenic
1156343434 18:36234043-36234065 CTAAAACAAAGATAAATAGATGG - Intronic
1156784725 18:40896660-40896682 CAAAAACAAAGATAAATAGATGG - Intergenic
1156790519 18:40967503-40967525 ATGAAACAAAAATAAATAGATGG - Intergenic
1157204283 18:45685471-45685493 CAAAAAAATAAATAAATAAAAGG + Intergenic
1157507932 18:48244154-48244176 CAAAAACAAGAATAAATAGAAGG + Intronic
1157612893 18:48969403-48969425 ATAAAATATAAATAAAATGAAGG - Intergenic
1158010890 18:52725999-52726021 TTTAAAGATAAATAAATGGAAGG + Intronic
1158377190 18:56884514-56884536 CAAAAACAAAGATAAATAGATGG - Intronic
1158787039 18:60726482-60726504 CAAAAACAAAAATAAATAAATGG - Intergenic
1159207948 18:65278548-65278570 CAAAGACATAAATAAATACATGG + Intergenic
1159706247 18:71692329-71692351 AGAAAAAATAAATAAATTGAAGG + Intergenic
1160484661 18:79278840-79278862 TTAAAGAATAAATAAATCCATGG + Intronic
1161463163 19:4411228-4411250 CTCAAAAATAAATAAATAAATGG - Intronic
1161695417 19:5764615-5764637 CTCAAAAATAAATAAATAAATGG - Intronic
1162023009 19:7876509-7876531 CTCAAAAATAAATAAATAGGAGG - Intergenic
1162889040 19:13718831-13718853 CTCAAAAATAAATAAATAAAAGG + Intergenic
1163316974 19:16547306-16547328 CTAAAAAATAAATAATTAGCCGG + Intronic
1163824728 19:19516547-19516569 GTAAAACGTAAATAACTAGAGGG - Intronic
1163894175 19:20042728-20042750 CTAAAAAATTAATAAAGGGATGG - Intergenic
1164263663 19:23593165-23593187 CAAAAACAAAGATAAATCAATGG + Intronic
1164431407 19:28192251-28192273 CAAAAACATAAATCAATACATGG - Intergenic
1164833349 19:31339951-31339973 TTAAAAAATAAATAAATAAAAGG - Intronic
1164849518 19:31469980-31470002 CAAAAACAAAAATAAATAAATGG + Intergenic
1165429703 19:35765577-35765599 CTCAAAAATAAATAAATAAATGG + Intronic
1165529450 19:36385922-36385944 ATAAAACATAATTAAAAGGAAGG + Intronic
1165745046 19:38225725-38225747 CTAAAAAAAAAATAAATAGCTGG + Intronic
1167224132 19:48225488-48225510 CTCAAAAATAAATAAATAAAGGG + Intronic
1167407428 19:49322106-49322128 CAAAAATATAAATAAATAAAAGG + Intronic
1167529132 19:50004037-50004059 TTAAAAAATAAATAAATAAAGGG + Intronic
1167707795 19:51091903-51091925 CTTAAACAGAAATAAATGGGAGG - Intergenic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
1168017358 19:53584227-53584249 AAAAAACCTAAATAAATGGAAGG + Intergenic
1168251418 19:55144376-55144398 CTAAAACATAAATAAAAATAAGG - Intronic
1168616991 19:57846365-57846387 CTAAAATATCCATAAATGGATGG - Intronic
1168617227 19:57848396-57848418 ATAAAAAATAAATAAATTGCTGG - Intronic
924992496 2:324540-324562 CAAAAACAAAGATAAATAGATGG - Intergenic
925430611 2:3789193-3789215 CTAAAACATAAATGTTTCAAAGG - Intronic
925757732 2:7149814-7149836 CTAAAACATTGATAAATAAAAGG - Intergenic
925795300 2:7535001-7535023 CAAAAACAAAGATAAATAGATGG - Intergenic
926100694 2:10115019-10115041 GGACAACATAAATAAATGGAGGG + Intergenic
926804640 2:16695955-16695977 CAAAAACAAAAATAAATAAATGG - Intergenic
927036304 2:19180476-19180498 CAAAAACAAAGATAAATAGATGG - Intergenic
927267596 2:21170020-21170042 CTAAAACAAAGATAAATAGATGG - Intergenic
927454005 2:23233611-23233633 CTAAAAAATAAATAAATATTTGG + Intergenic
927749774 2:25657173-25657195 CTCAAAAATAAATAAATGAAAGG + Intronic
927793330 2:26027983-26028005 ATAAAAAATAAATAAATAAATGG - Intergenic
928040297 2:27869168-27869190 CTAAAATATAAATAGGTCCAAGG - Intronic
928052925 2:28019505-28019527 CAAAAACAAAGATAAATAGATGG - Intronic
928479741 2:31670117-31670139 CTAAAGCAAAAATAAATAAATGG - Intergenic
928798715 2:35059207-35059229 CAAAAACAAAGATAAATAGATGG + Intergenic
928831370 2:35489236-35489258 CTAAAAAATAAATAAATAACTGG + Intergenic
929072526 2:38048290-38048312 CTAAAACATAAATCAATAACAGG + Intronic
929197501 2:39200949-39200971 CAAAAACAAAGATAAATAGATGG + Intronic
929370300 2:41215400-41215422 CAAAAACAAAGATAAATAGATGG - Intergenic
930459017 2:51645960-51645982 CAAAAACAAAAATAAATAAAAGG + Intergenic
930469941 2:51799823-51799845 CAAAAACAAAGATAAATAGATGG + Intergenic
930528391 2:52560684-52560706 CAAAAACAGAAATAAATAAATGG - Intergenic
930657969 2:54025724-54025746 CAAAAACAAAGATAAATAGATGG + Intronic
930868432 2:56145387-56145409 ATAATAAATAAATAAATAGATGG - Intergenic
931529036 2:63191462-63191484 CTAATTCATAAAAAAATGGAGGG + Intronic
931753208 2:65348791-65348813 CTAAAAAAAAAAAAAATCTATGG + Intronic
931838881 2:66128262-66128284 CAAAAACATTAATAAATCAGAGG + Intergenic
931966198 2:67537659-67537681 CAAAAACAAAAATAAATAAATGG - Intergenic
932523313 2:72437030-72437052 ATAAAAGATAGATAAATCCACGG - Intronic
932653554 2:73586256-73586278 AAAAAACAAAAATAAATAGATGG - Intronic
932661728 2:73660307-73660329 CTAAAACAAAAATAAGTAGAAGG - Intergenic
933040156 2:77454872-77454894 ATAAAAAATAAATAAATAAAAGG - Intronic
933111162 2:78402060-78402082 CAAAAACAAAGATAAATAGATGG + Intergenic
933173142 2:79146228-79146250 CTAAAATATACATAGATCAATGG - Intergenic
933458626 2:82549649-82549671 CAAAAACAAAAATAAATAAATGG - Intergenic
933604161 2:84363676-84363698 CAAAAACAAAAATAAATAAACGG + Intergenic
934185712 2:89672562-89672584 CAAAAACAAAGATAAATAGATGG - Intergenic
934705371 2:96474078-96474100 TTAAAATATAAATAAAACAAGGG - Intergenic
934721919 2:96585117-96585139 CAAGAACAAAAATAAATAGATGG + Intergenic
934996680 2:98968061-98968083 CAAAAACACAATTAAATAGAAGG - Intergenic
935001111 2:99016623-99016645 CAAAAACAAATATAAATAGATGG + Intronic
935110856 2:100092916-100092938 CTAAAATATAAACATATCAAGGG + Intronic
935388691 2:102528005-102528027 CAAAAAAATAAAAAAATCGTTGG - Intronic
935469602 2:103441999-103442021 GAAAAACATAAATAAACCAAAGG - Intergenic
935475070 2:103509487-103509509 CAAAAACAAAGATAAATAGATGG - Intergenic
935851840 2:107230342-107230364 CAAAAACAAAAATAAATCAATGG - Intergenic
935919829 2:108000895-108000917 TTAAAAAATAAATAAATAAATGG - Intronic
935923892 2:108046089-108046111 CAAAGACCTAAATAAATGGAAGG + Intergenic
935965038 2:108464662-108464684 CTAAAACATAAGGAAAGGGAAGG - Intronic
936124119 2:109772246-109772268 CTAAAATATAAACATATCAAGGG - Intergenic
936220570 2:110599218-110599240 CTAAAATATAAACATATCAAGGG + Intergenic
936497405 2:113034482-113034504 ATAATAAATAAATAAATAGATGG - Intronic
936633542 2:114230651-114230673 CAAAAACAAAGATAAATAGATGG - Intergenic
936656354 2:114492452-114492474 CTAAAAAATAAATAAAAGTAAGG + Intronic
937442860 2:121931783-121931805 AAAAAAAATAAATAAATGGATGG - Intergenic
937618917 2:123962672-123962694 CCAAAACAAAAATAAATAAATGG + Intergenic
938166568 2:129033693-129033715 CAAAAACAAAAATAAATAAATGG + Intergenic
938486129 2:131710602-131710624 CTAAAGTATAAATTAATGGAAGG + Intergenic
938563851 2:132499069-132499091 CAAAAACAAAGATAAATAGATGG - Intronic
938661041 2:133487624-133487646 CTGATACATAAATACATGGAGGG - Intronic
938947792 2:136229014-136229036 CAAAAACAAAGATAAATAGATGG + Intergenic
938973634 2:136455276-136455298 CAAATAAATAAATAAATGGAAGG - Intergenic
939219727 2:139286384-139286406 CAAAAACAAAGATAAATAGATGG + Intergenic
939749294 2:146021386-146021408 GTAAAACATCAAAAAATGGAAGG + Intergenic
939806746 2:146783334-146783356 CAAAAACAAATATAAATAGATGG - Intergenic
940010125 2:149044270-149044292 CAAAGACTTAAATAAATGGATGG - Intronic
940131037 2:150382298-150382320 CTAAAACAAAAATAAGTAAATGG - Intergenic
940328211 2:152447401-152447423 CTAAATCAAAAATAAGTTGATGG - Intronic
940345584 2:152624475-152624497 CTTAAAAATAAATAAATAAAAGG - Intronic
940355475 2:152737456-152737478 CTAATACATTAATAAATACATGG - Intronic
940799181 2:158114486-158114508 CAAAAACAAAAATAAATCACTGG + Intronic
940945343 2:159610349-159610371 CTAGGACATAAATAAATCTAAGG - Intronic
940970277 2:159889226-159889248 TTAAAAAATAAATAAATAAAAGG - Intronic
941520735 2:166538862-166538884 CAAAAACAAAGATAAATAGATGG - Intergenic
941878756 2:170460837-170460859 ATAAAATATAAATAAATAAAAGG - Intronic
942001074 2:171647417-171647439 CAGAAAAATAAAAAAATCGAGGG - Intergenic
942216684 2:173727835-173727857 TTAAAAAATAAATAAATAAAAGG + Intergenic
942405783 2:175653061-175653083 CAAAAACAAAGATAAATAGATGG + Intergenic
942478369 2:176353812-176353834 CAAAAACAAAGATAAATAGATGG - Intergenic
942874488 2:180777981-180778003 CTAAAACATAAGAAAGTCGCTGG + Intergenic
942981193 2:182084279-182084301 CAAAAACAAAAATAAATAAACGG - Intronic
943122677 2:183756554-183756576 CAAAAACAAAAATAAATGAATGG + Intergenic
943398101 2:187367728-187367750 ATAAAATTTAAAGAAATCGAAGG - Intronic
943588526 2:189769045-189769067 TTAAAACAGAACTAAATGGAAGG + Intergenic
943607322 2:189991708-189991730 CAAAAACAAAGATAAATAGATGG - Intronic
943654706 2:190495970-190495992 CAAAAACAAAGATAAATAGATGG + Intronic
943714883 2:191140225-191140247 CAAAAACAAAGATAAATAGATGG + Intronic
943935774 2:193914675-193914697 ATAATACCTAAATAAATGGAAGG + Intergenic
943988862 2:194659729-194659751 CTAAAAGATAAAAAAATTAAGGG - Intergenic
944091872 2:195920698-195920720 CAAAAACAAAGATAAATAGATGG + Intronic
944370605 2:198978489-198978511 CAAAAACAAAAATAAATAAATGG + Intergenic
944486544 2:200212761-200212783 TTAAAACACAGATAAATCCAAGG - Intergenic
944889324 2:204100593-204100615 CAAAAAAAAAAAAAAATCGAAGG - Intergenic
945172447 2:207011179-207011201 TTAAAAAATAAATAAATAAAGGG - Intergenic
945300084 2:208207879-208207901 CTAAAAAATAAATAAAAATAGGG + Intergenic
945387407 2:209219345-209219367 CAAAAACAAAGATAAATAGATGG + Intergenic
945442311 2:209894449-209894471 CTTACACATAAATAGATGGAGGG + Intronic
945536121 2:211020121-211020143 CAAAAACAAAAATAAATACATGG - Intergenic
945782895 2:214199114-214199136 CAAAAACAAAAATAAATAAATGG - Intronic
945840187 2:214878746-214878768 ATAAAACATAACTGAATTGAGGG + Intergenic
946150633 2:217765372-217765394 CAAAAACAAAAATAAATAAATGG + Intergenic
946770408 2:223083291-223083313 CTAAAATATAAAAAAATAGACGG - Intronic
946857604 2:223968322-223968344 CTAATAAATAAATAAATTCATGG - Intergenic
946874921 2:224119069-224119091 CTAAAGCAAAAATAAATCCATGG + Intergenic
947085069 2:226441910-226441932 CAAGAACAAAAATAAATAGATGG - Intergenic
947109553 2:226704576-226704598 ATAAAACATGAATAAATGTAAGG - Intergenic
947131446 2:226930620-226930642 CAAAAACAAAAATAAATAAATGG + Intronic
947335008 2:229073022-229073044 CAAAAAAATAAATAAATAAATGG - Intronic
947448947 2:230187503-230187525 CAAAAACAAAAATAAATAAATGG - Intronic
948107732 2:235428515-235428537 CAAGGACATAAATAAAACGACGG + Intergenic
948564570 2:238875782-238875804 CAAAAAAACAAATAAATAGATGG + Intronic
948577158 2:238961572-238961594 CAAAAACAAAGATAAATAGATGG + Intergenic
948993829 2:241568414-241568436 CAAAAAAATAAATAAATGGCTGG - Intronic
1169139618 20:3219878-3219900 CTCAAAAATAAATAAATAGCCGG + Intronic
1169255996 20:4099559-4099581 CAAAAAAATAAATAAATAAAAGG - Intergenic
1169323288 20:4653494-4653516 CAAAAACAAAAATAAATAAATGG - Intergenic
1169397519 20:5246307-5246329 CAAAAATAAAAATAAATAGATGG - Intergenic
1169434972 20:5578886-5578908 AAAAAAAATAAATAAATCTAGGG + Intronic
1169518695 20:6347278-6347300 CTAAAATATAAAAAATTCGCCGG + Intergenic
1169624925 20:7555097-7555119 TAAAAACAAAGATAAATCGATGG - Intergenic
1169969849 20:11258010-11258032 CAAAAACAAAGATAAATAGATGG + Intergenic
1170050262 20:12135300-12135322 CAAAAACAAAAATAAATAAATGG - Intergenic
1170071556 20:12374696-12374718 CTAAGACAAAAATAAAAGGAAGG + Intergenic
1170099534 20:12683528-12683550 TTCAAAAATAAATAAATAGATGG - Intergenic
1170171917 20:13423963-13423985 CTAAAACATAAGCAAATCTTAGG + Intronic
1170206499 20:13804093-13804115 CTAAAACAAAAATAATTGAAAGG + Intronic
1170248998 20:14258723-14258745 CAAAAACAAAAATGAATCGATGG - Intronic
1170468707 20:16646961-16646983 CTAAAATAAAAAGAAATAGAAGG - Intergenic
1170651231 20:18244224-18244246 CAAAAACAAAGATAAATAGATGG + Intergenic
1170674736 20:18468236-18468258 CTAAAACATAAAAAATTAGCTGG - Intronic
1170865770 20:20155397-20155419 CAAAAACAAAGATAAATAGATGG + Intronic
1170927533 20:20739297-20739319 CAAAAACAAAGATAAATAGATGG + Intergenic
1171080186 20:22173509-22173531 CAAAAACAAAAATAAATAGATGG - Intergenic
1171204096 20:23265914-23265936 CTAAAACATACAAAAATAGCCGG - Intergenic
1171241890 20:23576518-23576540 CAGAAACAAAAATAAATAGATGG - Intergenic
1171280794 20:23895691-23895713 CAAAAACAAAGATAAATAGATGG + Intergenic
1171388915 20:24788605-24788627 ATAAAACAAAAATAAATAAATGG + Intergenic
1172161835 20:32874219-32874241 CTAAAAAATAAATAAAATAAAGG - Intronic
1172406896 20:34696481-34696503 CTAAAAAATAAAAAAAGTGAAGG + Intergenic
1172439338 20:34954650-34954672 GCAAAACATAAATAAAGCCAAGG - Intronic
1172686427 20:36758981-36759003 CTCAAAAATAAATAAATAGCTGG - Intronic
1173415186 20:42848824-42848846 CAAAAACAAAGATAAATAGATGG - Intronic
1174787359 20:53445259-53445281 TTAAAGCATAAATAAGTGGAAGG - Intronic
1174927485 20:54776486-54776508 TTAAAATCTAAATAAATCGAGGG + Intergenic
1175232974 20:57486524-57486546 CAAAAACAAAAATAAATAGATGG + Intergenic
1176879477 21:14173636-14173658 ATAAAACAAAGATAAATAGATGG + Intronic
1177125407 21:17187295-17187317 CAAAAACAAAGATAAATAGAAGG + Intergenic
1177343157 21:19831855-19831877 CTAAAATATAATTATATCTAAGG - Intergenic
1177459805 21:21395991-21396013 CAAAAACAAAGATAAATAGATGG + Intronic
1177579231 21:22997846-22997868 CAGAAACAAAAATAAATAGACGG + Intergenic
1177672866 21:24256097-24256119 CAAAAACAAAGATAAATAGATGG + Intergenic
1177716682 21:24847689-24847711 CAAAAACAAAGATAAATAGATGG - Intergenic
1177750064 21:25270168-25270190 CAAAAACAAAGATAAATAGATGG + Intergenic
1177935216 21:27336795-27336817 CAAAAACAAAAATAAATAGATGG + Intergenic
1178482650 21:32993034-32993056 ATAAAACAAAAATAAATAGCTGG - Intergenic
1178733329 21:35125777-35125799 CAAAAACAAAGATAAATAGATGG + Intronic
1179109068 21:38430420-38430442 CAAAAACAAAGATAAATAGATGG - Intronic
1179896884 21:44368118-44368140 CTCAAAAATAAATAGATGGATGG - Intronic
1180490324 22:15839505-15839527 CTAAAGTATAAATTAATGGAAGG + Intergenic
1180543064 22:16470535-16470557 CAAAAACAAAGATAAATAGATGG + Intergenic
1181418834 22:22782525-22782547 CTAATACATAAATTAAGCAAAGG + Intronic
1182456336 22:30453409-30453431 CAAAAAAATAAATAAATGAAAGG - Intronic
1182837103 22:33351005-33351027 TGAAAACATAAAGAAATCTAAGG - Intronic
1182838828 22:33367585-33367607 CCAAAAAATAAATAAATGGGGGG - Intronic
1182970769 22:34574105-34574127 CAAAAACAAAGATAAATAGATGG + Intergenic
1183166820 22:36154523-36154545 CAGGAACATAAATAAATAGAAGG - Intronic
1183178423 22:36241422-36241444 CGAAAACAAAAATAAAGAGATGG - Intergenic
1183952770 22:41360934-41360956 CTCAAAAATAAATAAATAAAAGG + Intergenic
1184386467 22:44178975-44178997 ATAAAAAATAAATAAATTGCAGG - Intronic
1184524812 22:45015700-45015722 ATAAAAAATAAATAAATAAAAGG + Intergenic
1185306449 22:50120058-50120080 ACAAAACAAAAACAAATCGAAGG + Intronic
1185397247 22:50599328-50599350 CTAAGACATAAAGAAATCTTAGG + Intronic
949145526 3:695104-695126 CAAAAGCAAAAATAAATAGATGG - Intergenic
949170426 3:989839-989861 CTAAAACATAAAGTTATTGAGGG + Intergenic
949208949 3:1475114-1475136 CAGAAACAAAAATAAATAGATGG + Intergenic
949570512 3:5287809-5287831 CAAAAACAAAAATAAATAGATGG - Intergenic
949799600 3:7889110-7889132 CAAAAACAAAGATAAATAGATGG + Intergenic
950222943 3:11210393-11210415 CAAAAAAATAAATAAATAAATGG + Intronic
950951200 3:17001372-17001394 CAAAAACAAAAATAAATAAATGG - Intronic
951045460 3:18032917-18032939 ATAAGACATAAATAAATGGCTGG - Intronic
951153321 3:19319176-19319198 CAAAAACAAAGATAAATAGATGG - Intronic
951751938 3:26045731-26045753 CAAAAACAAAAATAAATAAATGG + Intergenic
951821660 3:26820770-26820792 CAAAAACAAAAATAAATAAATGG - Intergenic
951859239 3:27233016-27233038 CGAAAACAAAAATAAATAAATGG + Intronic
951882922 3:27497137-27497159 CAAATAAATAAATAAATAGAAGG - Intergenic
952040908 3:29260807-29260829 CTAAAAAATAAATGAATCACAGG - Intergenic
952074498 3:29679332-29679354 CTCAAAAATAGAAAAATCGACGG - Intronic
952083282 3:29786820-29786842 CAAAAATAAAAATAAATAGATGG + Intronic
952182857 3:30936778-30936800 CAAAAACAAAGATAAATAGATGG - Intergenic
952229848 3:31418530-31418552 CTAATACAGAAATAAATTAAGGG - Intergenic
952390423 3:32874816-32874838 CAAAAACACAAATAAATAAAAGG - Intronic
952493213 3:33892088-33892110 CTAAAACAAAACTAAATAAATGG - Intergenic
952714460 3:36465471-36465493 CAAAAACAAAGATAAATAGATGG - Intronic
952972119 3:38658066-38658088 TTAAAATATAAATAAATAAATGG + Intergenic
952984438 3:38765223-38765245 CAAAAACAAAAATAAATAGATGG - Intronic
953080629 3:39613898-39613920 CAAAAACAAAAATAAATAAATGG + Intergenic
953087159 3:39680633-39680655 CAAAAACAAAGATAAATAGATGG - Intergenic
953090703 3:39723215-39723237 CTAAAACACAAAAAATTAGATGG - Intergenic
953103562 3:39853766-39853788 CAAAAACAAAAATAAATAGACGG - Intronic
953382618 3:42485403-42485425 CAAAAACAAAAACAAATAGATGG + Intergenic
953392692 3:42543033-42543055 TTAAAAAATAAAAAAATAGACGG + Intergenic
953639899 3:44697051-44697073 CAAAAACAAAGATAAATAGATGG + Intergenic
953649709 3:44790981-44791003 CTAAAACATTAAGAAACAGAAGG - Intronic
953822456 3:46219969-46219991 CAAAAACAAAGATAAATAGATGG + Intronic
953826421 3:46255407-46255429 CAAAAACAAAGATAAATAGATGG - Intronic
954126511 3:48533854-48533876 CAAAAAAATAAATAAATAAAGGG + Intronic
954472547 3:50710145-50710167 CAAAAATAAAAATAAATAGATGG + Intronic
954479343 3:50783712-50783734 CAAAAACAAAGATAAATGGATGG - Intronic
954514019 3:51154960-51154982 ATAAAAAATAAATAAATTCAGGG - Intronic
954887098 3:53884644-53884666 CAAAAAAATAAATAAAACCATGG - Exonic
955257525 3:57348957-57348979 CAAAAACAAAGATAAATAGATGG + Intronic
955269650 3:57484668-57484690 CAAAAACAAAAATAAATAAATGG + Intronic
955566486 3:60252567-60252589 GAAAAAAATAAATAAATAGAAGG + Intronic
955602523 3:60662061-60662083 CAAAAACAAAGATAAATAGATGG - Intronic
955771105 3:62385469-62385491 ATAAAAAATAAATAAATAAATGG - Intergenic
955800257 3:62679184-62679206 CTAAAACACAAAGAATTGGAGGG + Intronic
955839706 3:63098640-63098662 CAAAAACAAAAATAAATAGATGG - Intergenic
955898974 3:63731747-63731769 CAAAAACAAAGATAAATAGATGG + Intergenic
956844713 3:73171973-73171995 CAAAAACAAAAATAAATAAATGG - Intergenic
956866646 3:73375766-73375788 CAAAAAAATAAATAAATAAAAGG - Intergenic
957749812 3:84399986-84400008 ATAAAACAAAAAAAAATCAATGG + Intergenic
957773593 3:84726478-84726500 CTAAAACTTAGATAAATAGTTGG - Intergenic
958111350 3:89150449-89150471 CTAAAACAGATATCAATAGAGGG + Intronic
958152511 3:89708754-89708776 ATAAAACAGAGATAAATAGATGG + Intergenic
958606778 3:96368139-96368161 CAAAAACAAAGATAAATAGATGG - Intergenic
958660090 3:97055767-97055789 CTTAAAAATAAAGAAATCAAAGG - Intronic
958883416 3:99698587-99698609 CTAGAACATAAGGAAATTGAGGG - Intronic
959304541 3:104644304-104644326 AGAACAAATAAATAAATCGATGG - Intergenic
959463651 3:106657930-106657952 CAAAAACAAAAATAAATAAATGG + Intergenic
959516935 3:107278285-107278307 CAAATAAATAAATAAATAGAGGG + Intergenic
959867613 3:111289272-111289294 CAAAAACAGAGATAAATAGATGG - Intergenic
960264760 3:115607809-115607831 CAAAAACAAAGATAAATAGATGG - Intergenic
960296483 3:115951252-115951274 CAAAAACAAAAATAAATAGATGG + Intronic
960379655 3:116944442-116944464 CTAAAACAAAAATAAACAAATGG + Intronic
960778636 3:121292033-121292055 CAAAAACAAAGATAAATAGATGG + Intronic
961070774 3:123923793-123923815 AGAAAACACAAATAAATGGAAGG + Intronic
961655090 3:128437000-128437022 CAAAAACAAAGATAAATAGATGG + Intergenic
961703800 3:128767861-128767883 TTAAAAAATAAATAAATAAAAGG - Intronic
961955518 3:130798756-130798778 CAAAAACAAAAATAAATAAATGG + Intergenic
961980177 3:131069125-131069147 ATAAAAAATAAAAAAATCTAGGG - Intronic
961996258 3:131247130-131247152 CAAAAACAAAGATAAATAGATGG - Intronic
962020431 3:131494625-131494647 CTAAACCATAAATAGAACCAAGG + Intronic
962604793 3:137024192-137024214 ATAAAAAATAAATAAAAAGAAGG - Intergenic
962673244 3:137730907-137730929 CAAAAACAAAAATAAATAGGTGG - Intergenic
962717784 3:138142187-138142209 CAAAAACAGAAATAAATAAATGG + Intergenic
962861168 3:139403487-139403509 CAAAAACAAAAATAAATAGATGG - Intergenic
963023188 3:140892285-140892307 CAAAAACAAAGATAAATAGATGG - Intergenic
963410957 3:144926957-144926979 CTAAAAAGTAAATAGATAGAGGG - Intergenic
963444988 3:145393802-145393824 ATTAAACATAATTAAATCTATGG - Intergenic
963688002 3:148462390-148462412 CAAAAACAAAGATAAATAGATGG + Intergenic
963832929 3:150028041-150028063 CAAAAACAAAAATAAATAGATGG + Intronic
963918318 3:150881380-150881402 CTCAAAAATAAATAAATAGAGGG + Intronic
964006073 3:151830718-151830740 CAAAAACAAAAATAAATAGGTGG + Intergenic
964017749 3:151967897-151967919 CAAAAACAAAGATAAATAGATGG + Intergenic
964248498 3:154683084-154683106 CAAAAACAAAGATAAATAGATGG - Intergenic
964456619 3:156875537-156875559 CAAAAACAAAGATAAATAGATGG - Intronic
964540975 3:157779611-157779633 CAAAACCAAAAATAAATAGATGG + Intergenic
965073338 3:163943917-163943939 CTAAAAAGTAAATAATTTGAGGG - Intergenic
965277027 3:166697630-166697652 ATAAAAAATAAATAAATAAAAGG + Intergenic
965423371 3:168490391-168490413 ATAAAAAATAAATAAATAAAAGG - Intergenic
965452420 3:168854607-168854629 CTAAAACATACAAAAATCTATGG - Intergenic
965677577 3:171213957-171213979 CCAAAAAATAAATAAATAAAAGG + Intronic
966271613 3:178114484-178114506 CTAAAATATAATTAAAGCAATGG + Intergenic
966568521 3:181411770-181411792 AAAAAAAATAAATAAATTGATGG + Intergenic
966638022 3:182157166-182157188 ATAAAAAATAAATAAATAGGTGG - Intergenic
966665703 3:182468690-182468712 CAAAAACAAAGATAAATAGATGG - Intergenic
967203709 3:187099989-187100011 CAAAAACAAAAATAAATAAATGG + Intergenic
967485166 3:190022147-190022169 CTATAAGAAAAATAAATCAATGG - Intronic
967746591 3:193062572-193062594 CAAATACATAAATAATTCAAGGG - Intergenic
967774896 3:193376192-193376214 GTAAAAAATAAATAAATCGAGGG - Intronic
967958295 3:194896171-194896193 CAAAAACAAAGATAAATAGATGG - Intergenic
968109921 3:196036296-196036318 AGAAGACATAAATAAATGGAAGG - Intronic
968182044 3:196602724-196602746 TGAAAACATAAATAAATAAATGG - Intergenic
968777724 4:2554081-2554103 CAAAAAAATAAATAAATAAAAGG - Intronic
968981822 4:3854409-3854431 CTAAATCAGAAACAAAACGATGG + Intergenic
969999861 4:11354118-11354140 CTTAGAAATAAATAAAACGATGG + Intergenic
970165657 4:13234984-13235006 CAAAAACAAAAATAAATAAATGG + Intergenic
970269640 4:14331461-14331483 CAAAAACAAAGATAAATAGATGG - Intergenic
970539477 4:17062783-17062805 CGAAAACAAAGATAAATAGATGG + Intergenic
970548781 4:17157631-17157653 CTAAAAAATAAATAAATTCGAGG - Intergenic
970706147 4:18805229-18805251 CAAAAACAAAAATAAATAGATGG + Intergenic
970855058 4:20641562-20641584 CAAAAACAAAAATAAATAGATGG - Intergenic
970856653 4:20656957-20656979 CAAAAACAAAAATAAGTAGATGG + Intergenic
971012814 4:22457716-22457738 CTGAAAGATAAATAACTAGATGG + Intronic
971062103 4:22983848-22983870 CAAAAACAAAAATAAATAAATGG + Intergenic
971237970 4:24860573-24860595 CAAAAACAAAGATAAATAGATGG + Intronic
971554577 4:27997443-27997465 CAAAAACAAAGATAAATAGATGG - Intergenic
971861440 4:32110904-32110926 CTAAGACATAAAGAAATGTAAGG + Intergenic
972181274 4:36469447-36469469 TTGAAATATAAATAAATCAAAGG - Intergenic
972210314 4:36828825-36828847 CTAAAACAAAAATGAATAAATGG + Intergenic
972439780 4:39076902-39076924 CAAAAACAAAGATAAATAGATGG + Intronic
972493972 4:39615375-39615397 TTAAAAAATAAATAAATGAATGG + Intronic
972624919 4:40787828-40787850 CAAAAAAATAAATAAATAAAAGG - Intronic
972806327 4:42532482-42532504 AAAAAAAATAAATAAATTGAAGG + Intronic
972955827 4:44390147-44390169 CAAAAACAGTAATAAATAGATGG - Intronic
973066406 4:45798788-45798810 TAAAAACATCACTAAATCGAAGG + Intergenic
973104594 4:46319267-46319289 CTAAAACACAACTAAATTGTAGG + Intronic
973650092 4:52990685-52990707 CTAAAGCATACACAAATTGAAGG + Intronic
973675628 4:53259231-53259253 CAAAAACAAAGATAAATAGATGG - Intronic
973915553 4:55631303-55631325 CAAAAACAAAAATAAATAAATGG + Intronic
973926104 4:55739217-55739239 CAAAAACAAAAATAAATAAATGG + Intergenic
974472386 4:62335496-62335518 CAAAAACAAAGATAAATAGATGG + Intergenic
974533899 4:63149635-63149657 CCAAAACAAAAATAAATAAATGG - Intergenic
974737406 4:65954735-65954757 CAAAAACATAAATAAAATGGTGG + Intergenic
974879883 4:67742063-67742085 CAAAAACAAAGATAAATAGATGG - Intronic
975266297 4:72372806-72372828 GAAAAACCTAAATAAATGGAAGG + Intronic
975375384 4:73637802-73637824 CAAAAACAAAAATAAATAAATGG + Intergenic
975790081 4:77939551-77939573 CAAAAACAAAGATAAATAGATGG - Intronic
975892175 4:79042998-79043020 TTAAAAAATAAATAAAACGATGG + Intergenic
975944631 4:79690709-79690731 CAAAAACAAAGATAAATTGATGG - Intergenic
976086773 4:81414898-81414920 CAAAAACAAAGATAAATAGATGG + Intergenic
976363821 4:84211067-84211089 CAAAAACAAAAATAAATAAATGG + Intergenic
977076446 4:92457323-92457345 CATAAACATAAATAATTCAATGG - Intronic
977229642 4:94436662-94436684 CAAAAACATAAATAAATAAATGG + Intergenic
977654956 4:99510110-99510132 CTAAAACATAGATGAAGCCAAGG + Intergenic
977748041 4:100575224-100575246 ATAAATAATAAATAAATAGAAGG - Intronic
977834020 4:101627720-101627742 CAAAAACAAAAATAAATAGATGG - Intronic
977904537 4:102460299-102460321 CAAAAACAAAGATAAATAGATGG + Intergenic
977906997 4:102488568-102488590 CAAAAACAAAGATAAATAGATGG + Intergenic
977948571 4:102942806-102942828 CAAAAACAAAGATAAATAGATGG + Intronic
978041913 4:104076660-104076682 CAAAAACAAAGATAAATAGATGG - Intergenic
978146896 4:105385732-105385754 CTAAGACATATAAAAATCCAAGG + Intronic
978282149 4:107031016-107031038 CTAACACAAAAATAAAATGATGG + Intronic
978671547 4:111253349-111253371 CTTAAATATAAATAATTGGAAGG + Intergenic
979540245 4:121872139-121872161 CAAAAACAAAAATAAATAAATGG - Intergenic
979712244 4:123793342-123793364 CAAAAACAAAGATAAATAGATGG - Intergenic
979790358 4:124772753-124772775 CAAAAACAAAGATAAATAGATGG - Intergenic
979887493 4:126047497-126047519 CCAAAACAAAGATAAATAGATGG - Intergenic
979984888 4:127301512-127301534 CAAAAACAAAGATAAATAGATGG + Intergenic
980019585 4:127692596-127692618 CAAAAACAAAGATAAATAGATGG - Intronic
980034460 4:127867582-127867604 CAAAAACAAAGATAAATAGATGG + Intergenic
980245721 4:130238644-130238666 CCAATACATAAATAAATAAATGG - Intergenic
980341709 4:131557981-131558003 CAAAAAAATAAATAAATAAAAGG + Intergenic
980536640 4:134132194-134132216 CAGAAACAAAAATAAATAGATGG + Intergenic
980544325 4:134238400-134238422 CAAAAGCATAGATAAATAGATGG - Intergenic
980580277 4:134741415-134741437 CAAAAACAAAAACAAATAGATGG + Intergenic
980596040 4:134955619-134955641 CAAAAACAAAGATAAATAGATGG + Intergenic
980672496 4:136027405-136027427 CAAAAACAAAAATAAATAGAAGG + Intergenic
980926913 4:139147006-139147028 CTAAAACAAAAATAAATAAATGG + Intronic
981052953 4:140329429-140329451 CAAAAACAAAAACAAATAGATGG + Intronic
981059603 4:140408308-140408330 CAAAAACAAAAATAAATAAATGG + Intronic
981076361 4:140596517-140596539 CAAAAACAAAAATAAATAAATGG - Intergenic
981086048 4:140684992-140685014 ATAAATAATAAATAAATGGAGGG + Intronic
981177318 4:141697023-141697045 CAAAAACAAAAATAAATAAATGG - Intronic
981224488 4:142277347-142277369 ATAAAACAAAGATAAATAGATGG - Intronic
981351526 4:143735315-143735337 CAAAAACAAAGATAAATAGATGG - Intergenic
981552541 4:145956736-145956758 CTAAAACATCAAGAAACTGAAGG - Intergenic
981680706 4:147394507-147394529 CAAAAACAAAGATAAATAGATGG + Intergenic
981889836 4:149722306-149722328 CAAAAACAAAAATAAATTAATGG - Intergenic
981930497 4:150184288-150184310 CTTGAACAGAAAGAAATCGATGG + Intronic
981959377 4:150517520-150517542 CAAAAAAATAAATAAATAGAAGG + Intronic
982434983 4:155374683-155374705 CGAAAATATAAATTAATTGATGG - Intronic
982556385 4:156871230-156871252 CTAAAACAGAAATGAATGGCAGG + Intronic
982804063 4:159741193-159741215 CCAAAACAAAGATAAATAGATGG - Intergenic
982887605 4:160801618-160801640 CTAAAACAAAAATAAATAAATGG + Intergenic
983067137 4:163224426-163224448 CAAAAACAAAGATAAATAGACGG + Intergenic
983072347 4:163283563-163283585 CGAAAACAAAGATAAATAGATGG - Intergenic
983347371 4:166544230-166544252 CAAAAACAAAAATAAATAAATGG + Intergenic
983362142 4:166739751-166739773 TTAAAAAATAAATAAATAAATGG + Intronic
983477536 4:168232839-168232861 CAAAAACAAAGATAAATAGATGG + Intronic
983546657 4:168971803-168971825 CAAAAACAAAGATAAATAGATGG - Intronic
983605681 4:169580694-169580716 ATAAAACATTAATAATTCTAAGG + Intronic
983825890 4:172259621-172259643 CAAAAACAAAAATAAATAGATGG - Intronic
983857053 4:172659472-172659494 CAAAAATATAATTAAATAGAAGG - Intronic
983867682 4:172788369-172788391 CTAAAAAATAGATAGATAGATGG + Intronic
983962613 4:173772979-173773001 CAAAAACAAAGATAAATAGATGG - Intergenic
984501213 4:180561518-180561540 CAAATAAATAAATAAATAGATGG - Intergenic
984851821 4:184161027-184161049 CAAAAACAAAAATAAATAGATGG + Intronic
984961632 4:185103069-185103091 CAAAAAAATAAATAAATAGAAGG + Intergenic
985483285 5:132403-132425 CAAAAACAAAGATAAATAGATGG - Intergenic
986328236 5:6697024-6697046 CAAAAACAAAAATAAATAAATGG - Intergenic
986408648 5:7453111-7453133 CAAAAACAAAAATAAATAAATGG - Intronic
986617483 5:9633954-9633976 CAAAACCAAAAATAAATAGATGG - Intronic
986704629 5:10444973-10444995 CTAAAAAATAAATAAATAAATGG - Intronic
986917750 5:12643969-12643991 CCAAAACAAAGATAAATAGATGG + Intergenic
986967840 5:13296887-13296909 CAAAAACAAAGATAAATAGATGG + Intergenic
987074006 5:14363534-14363556 ATTAAACATAAATAAATAAATGG - Intronic
987333703 5:16879682-16879704 ATAATTCATAAATAAATCAAAGG + Intronic
987558988 5:19494222-19494244 CTAAAACATAAATAAATCGATGG - Intronic
987563944 5:19560641-19560663 CAAAAACAAAGATAAATAGATGG + Intronic
988008200 5:25447915-25447937 CAAAAACATACATAAATCTCAGG - Intergenic
988249029 5:28730361-28730383 CAAAAACAAAGATAAATAGATGG - Intergenic
988345015 5:30025805-30025827 CCAAAACAAAGATAAATCGCTGG + Intergenic
988367793 5:30323842-30323864 CTAAAACAAAAATAAATAAATGG - Intergenic
988420724 5:31002642-31002664 CAAAAACAAAGATAAATAGATGG - Intergenic
988804069 5:34724014-34724036 CTCAAAAATAAATAAATAAAAGG - Intronic
988882759 5:35521365-35521387 CAAAAACAAAGATAAATAGATGG + Intergenic
989049610 5:37306436-37306458 CTATAACATATATATATGGAGGG - Intronic
989070108 5:37501270-37501292 ATAAAACAAAAATAAATAAATGG - Intronic
989139637 5:38189987-38190009 CAAAAAAATAAATAAAACCATGG - Intergenic
989231933 5:39096689-39096711 TGAAAACATAAATAAATGCATGG + Intergenic
989393830 5:40930908-40930930 CTAAAATATATAAAAATGGAGGG - Intronic
989407818 5:41081158-41081180 CAAAAACAAAAATAAATAAATGG - Intergenic
989412097 5:41131797-41131819 CAAAAACAAAGATAAATAGATGG - Intergenic
989607612 5:43259797-43259819 CAAAAACAAAAATAAATAAATGG - Intronic
989693966 5:44177659-44177681 CAAAAACAAAAATAAATAGATGG - Intergenic
989967623 5:50483752-50483774 ATAAAAAATAAATAAATGGATGG + Intergenic
990157849 5:52899676-52899698 CGAAAACTTAAAGAAATTGAAGG + Intronic
990235039 5:53758052-53758074 ATAAAATACAAATAAATCTATGG + Intergenic
990930213 5:61081171-61081193 CAAAAAGATAAATAACTCCATGG - Intronic
991310763 5:65238785-65238807 TAAAGACATAAATAAATTGAGGG + Intronic
991325056 5:65421940-65421962 CAAAAACAAAAATAAATAAATGG + Intronic
991543567 5:67756789-67756811 CAAAAACAAAGATAAATCGATGG + Intergenic
991623380 5:68570355-68570377 CAAAAACAAAGATAAATAGATGG + Intergenic
992364005 5:76073101-76073123 CAAAAACAAAGATAAATAGATGG - Intergenic
992580206 5:78166975-78166997 CAAAAACAAAGATAAATAGATGG + Intronic
992689974 5:79232814-79232836 CTCAAAAATAAATAAATAAATGG - Intronic
993381030 5:87208061-87208083 CAAAAACAAAAATAAATAAATGG - Intergenic
993384653 5:87250606-87250628 CCAAAAAATATATAAATTGAGGG + Intergenic
993408241 5:87539883-87539905 GTAAAACATAAATATTTCCATGG + Intergenic
993439443 5:87937330-87937352 CCAAAAAATAAATAAATAAAAGG - Intergenic
993537081 5:89099762-89099784 CAAAAACAAAAATAAATAAATGG - Intergenic
993581527 5:89667590-89667612 ATAACACATATATAAATAGATGG - Intergenic
993637480 5:90362636-90362658 CAAAAACAAAAATAAATAAATGG + Intergenic
993744320 5:91577332-91577354 CAAAAACAAAAATAAATAAATGG - Intergenic
993948157 5:94139545-94139567 CAAAAACAAAGATAAATAGATGG - Intergenic
994188618 5:96842790-96842812 CAAAAACAAAAATAAATAGATGG - Intronic
994347689 5:98706591-98706613 CAAAAACAAAGATAAATAGATGG + Intergenic
994564167 5:101419140-101419162 ATAAAAAATAAATAAAGCAAGGG - Intergenic
994595364 5:101826017-101826039 CAAAAACAGAGATAAATAGATGG + Intergenic
994636451 5:102350471-102350493 CAAATAAATAAATAAATAGATGG + Intergenic
994823625 5:104683977-104683999 CAAAAACAAAGATAAATAGATGG + Intergenic
995347870 5:111141485-111141507 CAAAAACAAAAATAAATAAATGG + Intergenic
995399290 5:111722064-111722086 CTAAGACATAACTAAGTAGAAGG - Intronic
995587967 5:113669005-113669027 CAAAAACAAAGATAAATAGATGG + Intergenic
995875101 5:116781870-116781892 ATAAAAAATAAATAAACAGATGG - Intergenic
996056288 5:118986660-118986682 ATAAAATATAAATGAATTGATGG - Intronic
996137072 5:119856136-119856158 CAAAAACAGAGATAAATAGATGG + Intergenic
996279841 5:121715818-121715840 CTAAAACAAAGATAAATAGATGG + Intergenic
996326601 5:122281775-122281797 CAAAAACAAAGATAAATAGATGG - Intergenic
996427089 5:123325630-123325652 CAAAAACAAAAGTAAATAGATGG - Intergenic
996504004 5:124248714-124248736 CAAAAACAAAAATAAATAAATGG + Intergenic
996507646 5:124286319-124286341 CTAATAAATAAATAAATAAACGG + Intergenic
996577313 5:124989969-124989991 TTAAGAGATAAATAAATCCATGG - Intergenic
996606721 5:125331332-125331354 TTACAACTTAAGTAAATCGACGG - Intergenic
996795904 5:127346723-127346745 CAAAAACAAAGATAAATAGATGG - Intronic
996986434 5:129571800-129571822 AGAAAACATACATAAATCAATGG + Intronic
997003649 5:129792922-129792944 CAAAAACAAAGATAAATAGATGG - Intergenic
997066742 5:130569133-130569155 CTAAAATATCAATAATTCCAAGG + Intergenic
997760108 5:136438084-136438106 TAAAAACATAAATAAATCAATGG - Intergenic
997763536 5:136474917-136474939 CAAAAACAAAGATAAATAGATGG - Intergenic
997789914 5:136749616-136749638 CAAAAAAATAAATAAATAGCTGG - Intergenic
998289928 5:140905048-140905070 CTACAACAAAAATAAATAAATGG - Intronic
998758860 5:145410290-145410312 CAAAAACAAAAATAAATCAATGG + Intergenic
998916795 5:147021939-147021961 ATAAAACATAAAAATATTGAGGG + Intronic
999086523 5:148896582-148896604 CAAAAACAAAGATAAATTGATGG + Intergenic
999264871 5:150260102-150260124 CTAAAAATTAAATAAACCAATGG - Intronic
999348096 5:150842131-150842153 CAAAAACAAAAATAAATAAATGG - Intergenic
999575325 5:152970254-152970276 CAAAAACAAAAATAAATAAATGG + Intergenic
999874112 5:155783343-155783365 CTAAAATATAAATAAGTTGGTGG + Intergenic
999881127 5:155865157-155865179 CTAAAACATTTAAAAATTGATGG + Intergenic
999923516 5:156349234-156349256 CAAAAACAAAAATAAATAAATGG + Intronic
1000076437 5:157791996-157792018 CTAAGACAGAAATAACTCTAAGG + Intronic
1000135761 5:158349011-158349033 CTAGAACAAAAATAAACCTAAGG - Intergenic
1000298295 5:159931965-159931987 CTAAAACATGGTTATATCGATGG - Intronic
1000510787 5:162179890-162179912 CTAAAACAAAGATAAATAGATGG - Intergenic
1000688481 5:164284203-164284225 CAAAAACAAAGATAAATAGATGG - Intergenic
1001487720 5:172131543-172131565 CAAAAAAATAAATAAATAAAAGG - Intronic
1001750226 5:174123960-174123982 CAAAAACAAAAATAAATAAATGG - Intronic
1002606780 5:180388178-180388200 CAAAAAAATAAAAAAATAGATGG + Intergenic
1002848989 6:974968-974990 CAAAAACAAAGATAAATAGATGG - Intergenic
1003297064 6:4839431-4839453 CAAAAACAAAGATAAATAGATGG - Intronic
1003311964 6:4976696-4976718 CAAAAACAAAAATAAATAAATGG - Intergenic
1004269391 6:14180352-14180374 TCAAAAAATAAATAAATGGAAGG - Intergenic
1004769675 6:18768011-18768033 CAAGAACATAAATAAAGGGAAGG - Intergenic
1005252757 6:23966340-23966362 CAAAAACAAAAATAAATAAATGG - Intergenic
1005255188 6:23994944-23994966 CAAAACCAAAAATAAATAGATGG + Intergenic
1005305420 6:24509128-24509150 CTAAAACAAAGATAAATAGCTGG - Intronic
1005414890 6:25589487-25589509 CTCAAAAATAAATAAATAAAAGG - Intronic
1005743714 6:28816440-28816462 CTAAAAGATAAGTAGATCGCAGG - Intergenic
1005930284 6:30478545-30478567 CAAAAACAAAGATAAATAGATGG + Intergenic
1006061775 6:31426222-31426244 CAAAAACAAAAATAAATTCATGG - Intergenic
1007525723 6:42490825-42490847 CCAACCCATAAATAAATCCAGGG + Intergenic
1007526222 6:42496061-42496083 CAAAAACAAAGATAAATAGATGG - Intergenic
1007837717 6:44687367-44687389 CAAAAACAAAGATAAATAGACGG - Intergenic
1008190623 6:48452621-48452643 CAAAAACAAAGATAAATAGATGG + Intergenic
1008245273 6:49163561-49163583 CAAAAACAAAGATAAATAGATGG + Intergenic
1008262577 6:49385335-49385357 CAAAAAAATAAATAAATAAAAGG + Intergenic
1008655420 6:53607378-53607400 CAAAAACAAAGATAAATAGATGG - Intronic
1009038552 6:58148567-58148589 CCAAAACATTAATAAATCCTAGG - Intergenic
1009214441 6:60903431-60903453 CCAAAACATTAATAAATCCTAGG - Intergenic
1009267604 6:61575092-61575114 CAAAAACAAAAATAAATAGATGG + Intergenic
1009359870 6:62797865-62797887 CAAAAACAAAAATAAATAGATGG - Intergenic
1009522848 6:64706441-64706463 CTAAAACAAAGATAAATATATGG + Intronic
1009725064 6:67528535-67528557 CTAAAACAAAAATTAATTTAAGG + Intergenic
1009779512 6:68251861-68251883 AAAAAACAGAAATAAATAGATGG - Intergenic
1009920209 6:70049434-70049456 CTAAAACATAAATATTTCCAGGG - Intronic
1010028083 6:71242943-71242965 CAAAAACAAACATAAATAGATGG + Intergenic
1010045765 6:71441475-71441497 CAAAAACAAAAATAAATAGCTGG + Intergenic
1010389909 6:75325065-75325087 CAAAAACAAAAATAAATAGATGG + Intronic
1010401206 6:75448481-75448503 CAAAAACAAAGATAAATAGATGG + Intronic
1010858255 6:80870867-80870889 CAAAAACAAAGATAAATAGATGG + Intergenic
1010875614 6:81101562-81101584 CCAAAACATAAATAGAGGGAAGG + Intergenic
1010942621 6:81936442-81936464 GTAATACATAAATAAATAAAAGG - Intergenic
1010962175 6:82157618-82157640 CAAAAACAAAAATAAATATATGG + Intergenic
1011008246 6:82673199-82673221 CAAAAACAAAGATAAATAGATGG + Intergenic
1011160596 6:84385673-84385695 CAAAAACAAAAATAAATAGATGG + Intergenic
1011364304 6:86564046-86564068 CAAAAACAAAAATAAATAAATGG - Intergenic
1011365640 6:86578894-86578916 CAAAAACAAAGATAAATAGATGG - Intergenic
1011565968 6:88672089-88672111 CAAAAACAAAAATAAACAGAAGG + Intronic
1011589524 6:88958349-88958371 CAAAAACAAAAATAAATAGATGG + Intronic
1011731679 6:90271200-90271222 CAAAAACAAAAATAAATAGTTGG + Intronic
1011964763 6:93141963-93141985 TTAAAAGAAAAAAAAATCGAAGG + Intergenic
1011965428 6:93151573-93151595 CAAAAACAAAGATAAATAGATGG - Intergenic
1012202923 6:96428157-96428179 CAAAAACAAAAATAAATAAATGG - Intergenic
1012302595 6:97607831-97607853 CAAAAACAAAGATAAATAGATGG - Intergenic
1012601471 6:101102715-101102737 CAAAAACATGAATAAAATGACGG - Intergenic
1012658925 6:101861311-101861333 CTAAAACATAAACATTTAGATGG + Intronic
1012700091 6:102445258-102445280 CGAAAACAAAAATAAATACATGG - Intergenic
1012717161 6:102689997-102690019 CAAAAACAAAGATAAATAGATGG - Intergenic
1012966006 6:105674075-105674097 CAAAAACAAAGATAAATAGATGG + Intergenic
1013104432 6:107014577-107014599 CTAAAAATTAAAAAAATCGCTGG + Intergenic
1013259646 6:108428936-108428958 CAAAAACAAAAATAAATAAATGG - Intronic
1013323978 6:109025843-109025865 CTAATACATATATAATTGGAAGG + Intronic
1013946040 6:115723561-115723583 CAAAAACAAAGATAAATAGATGG - Intergenic
1014056150 6:117017129-117017151 CAAAAACAAAGATAAATAGATGG + Intergenic
1014088500 6:117374605-117374627 CAAAAACAAAGATAAATAGATGG + Intronic
1014108740 6:117596403-117596425 CAAAAACAAAGATAAATAGATGG - Intronic
1014312940 6:119828377-119828399 CAAAAACAAAGATAAATAGATGG - Intergenic
1014481653 6:121946304-121946326 CAAAAACAAATATAAATAGACGG - Intergenic
1014658610 6:124137993-124138015 CAAAAACAAAAATAAATAAATGG + Intronic
1015048539 6:128810265-128810287 CAAAAACAAAAATAAATAAATGG - Intergenic
1015337363 6:132055462-132055484 CAAAAACATAATTAAATAGAAGG - Intergenic
1015643378 6:135362870-135362892 CAAAAACAAAGATAAATAGATGG - Intronic
1015686025 6:135861765-135861787 CAAACACCTAAATAAATAGAAGG - Intronic
1015900269 6:138058075-138058097 CAAAAACAAAAATAAATAGATGG + Intergenic
1015972483 6:138756664-138756686 ATAAAATAAATATAAATCGACGG + Intronic
1016028161 6:139310107-139310129 CAAAAACAAAAATAAATAAATGG + Intergenic
1016134472 6:140522608-140522630 CAAGAACATAAATTAATCAATGG - Intergenic
1016351330 6:143172196-143172218 CAAAAACAAAGATAAATAGATGG - Intronic
1016435337 6:144031361-144031383 CAAAAACAAATATAAATAGATGG - Intronic
1017354167 6:153482716-153482738 CTAAAACCCAAATAAACTGATGG - Intergenic
1017640297 6:156487317-156487339 CTCAAAAATAAATAAATAAAAGG - Intergenic
1017659824 6:156663148-156663170 TTAAAACATAAATAAAGGGCTGG + Intergenic
1018200889 6:161394458-161394480 CTAAAACAAAAATAAGCCTAGGG - Intronic
1018339537 6:162836639-162836661 ATAAAAAATAATCAAATCGAGGG - Intronic
1018383124 6:163278345-163278367 CAAAAACAAAAATAAATAGATGG - Intronic
1018755686 6:166847890-166847912 CAAAAACAAAGATAAATAGATGG + Intronic
1018925001 6:168199697-168199719 TTAAAAAATAAATAAATAAATGG - Intergenic
1019000885 6:168750346-168750368 CAAAAACAAAGATAAATAGATGG - Intergenic
1019072261 6:169357062-169357084 ATAAAACATAAATAATATGATGG + Intergenic
1019765347 7:2845519-2845541 CAAAAACAAAGATAAATAGATGG - Intergenic
1019974849 7:4572969-4572991 CTATAAGAGAAATAAATTGATGG + Intergenic
1020222838 7:6254217-6254239 ATAAAAGATAACTAAATAGAAGG + Intronic
1020449933 7:8309305-8309327 CAAAAACAAAAATAAATATATGG - Intergenic
1020557340 7:9687138-9687160 CAAAAACAAAAATAAATAAATGG - Intergenic
1020608748 7:10368839-10368861 CAAAAACAAAAACAAATCCAAGG + Intergenic
1020820364 7:12959499-12959521 CCAAAATATAAATAAATAAATGG - Intergenic
1021154997 7:17199045-17199067 CCAACAGATAAATAAAACGAAGG - Intergenic
1021159114 7:17249671-17249693 ATAAAATATTAACAAATCGAAGG + Intergenic
1021159144 7:17250257-17250279 CAAAAACAAAGATAAATGGATGG - Intergenic
1021183717 7:17538165-17538187 CAAAAACAAAGATAAATAGATGG + Intergenic
1021204218 7:17760025-17760047 CAAAAACAAAAATAAATAAATGG + Intergenic
1021339541 7:19447339-19447361 CAAAAACAAAAATAGATCAATGG - Intergenic
1021339876 7:19451857-19451879 CAAAAACAAAGATAAATAGATGG - Intergenic
1021506018 7:21386020-21386042 CTAATACATTAATAAATGGGAGG + Intergenic
1021706482 7:23373036-23373058 ATAAAATATAAATACACCGACGG + Intronic
1021770040 7:23990420-23990442 CAAAAACAAAAATAAATAAATGG + Intergenic
1021846464 7:24767899-24767921 ATAAAACATTAATAAAGCAAAGG - Intergenic
1021952636 7:25790132-25790154 CTAAAGCATAAATAAAAGGTAGG - Intergenic
1022869802 7:34464307-34464329 CAAATACATAAATACATTGAAGG - Intergenic
1023144879 7:37140512-37140534 CAAAAACAAACATAAATAGAAGG + Intronic
1023657232 7:42436190-42436212 CAAAAACAAAGATAAATAGATGG - Intergenic
1023723714 7:43120628-43120650 CAAATAAATAAATAAATAGAGGG - Intronic
1023909980 7:44546964-44546986 CAAAAAAATAAATAATTGGAAGG + Intergenic
1024324595 7:48099185-48099207 CAAAAACAAAAACAAATTGAAGG + Intronic
1024327590 7:48122578-48122600 CAAAAACAAAGATAAATAGATGG - Intergenic
1024417447 7:49123380-49123402 CAAAAACAAAAATGAATGGATGG + Intergenic
1024782690 7:52870079-52870101 CATAAACATAAATAAATAAATGG + Intergenic
1024847444 7:53663575-53663597 CAAAAACATAAATAAATATATGG - Intergenic
1024894024 7:54236149-54236171 CAAAAACAAAAATAAATAAATGG + Intergenic
1025195023 7:56925901-56925923 CTCAAAAATAAATAAATAAAAGG + Intergenic
1025676929 7:63651042-63651064 CTCAAAAATAAATAAATAAAAGG - Intergenic
1025768181 7:64477994-64478016 CAAAAACAAAGATAAATAGATGG - Intergenic
1027494389 7:78869235-78869257 CAATAACAAAAATAAATAGATGG - Intronic
1027515165 7:79133160-79133182 CAAAAACAAAAATAAATAAATGG - Intronic
1027562785 7:79753030-79753052 CAAAAACAAAGATAAATAGATGG - Intergenic
1027897130 7:84059719-84059741 CTAAAACATAAAAAAATTCTGGG - Intronic
1028007917 7:85600978-85601000 CTAATACATGAATATATTGATGG - Intergenic
1028008684 7:85612802-85612824 CAAAAACAAAGATAAATAGATGG + Intergenic
1028237476 7:88379811-88379833 CAAAAACAAAGATAAATAGATGG - Intergenic
1028527621 7:91802776-91802798 CAAAAACAGAAATAAATAAATGG - Intronic
1028605635 7:92652411-92652433 CTAAAAAATAAATATATGAAAGG - Intronic
1028947539 7:96597603-96597625 CCAAAACATAAATAAAGTGCAGG - Intronic
1028967909 7:96823260-96823282 ATAAAAAATAAATAAATAAAAGG - Intergenic
1029619939 7:101684060-101684082 CTCAAAAATAAATAAATAGGCGG + Intergenic
1029673306 7:102048826-102048848 CTCAAAAATAAATAAATAAAGGG + Intronic
1030141146 7:106304953-106304975 CTAATACAGAAAGAAATTGATGG - Intergenic
1030456252 7:109777951-109777973 CAAAAACAGAGATAAATAGATGG + Intergenic
1030639629 7:111989414-111989436 TTAAAAAATAAATAAATAAAAGG - Intronic
1031006120 7:116474480-116474502 CAAAAACAAAGATAAATCGATGG + Intronic
1031090057 7:117343721-117343743 CAAAAACAAAGATAAATAGATGG - Intergenic
1031109112 7:117584183-117584205 CAGAAACAAAAATAAATAGATGG - Intronic
1031138466 7:117913097-117913119 ATAAAATATATATAAATAGATGG - Intergenic
1031190692 7:118545812-118545834 CTAATACATGAATAAATGAATGG + Intergenic
1031219986 7:118952849-118952871 CAAAAACAAAGATAAATAGATGG - Intergenic
1031261725 7:119529557-119529579 CAAAAACAAAGATAAATAGATGG + Intergenic
1031268404 7:119612071-119612093 TTAAGACATACATAAATCTAAGG + Intergenic
1031376877 7:121037150-121037172 CCAAAACAAAGATAAATAGAAGG - Intronic
1031925967 7:127638933-127638955 CTCAAAAATAAATAAATAAAAGG - Intergenic
1032216737 7:129963175-129963197 CTAAAAAATAAATAAATGGCCGG - Intergenic
1032409807 7:131686697-131686719 CTAAAACAAAAATTAGCCGAGGG - Intergenic
1033028813 7:137805155-137805177 AAAAAACATAAATAAAACGAGGG - Intronic
1034060872 7:148087590-148087612 CTAAAACACTAAAAAATCAATGG - Intronic
1034208050 7:149335542-149335564 CAAAAACAAAGATAAATAGATGG + Intergenic
1034229723 7:149512989-149513011 CAAAAACAAAAATAAATAGATGG - Intergenic
1034403492 7:150884144-150884166 CAAAAACAAAAATAAATAAATGG + Intergenic
1034406487 7:150906563-150906585 CAAAAGCAAAAATAAATCAATGG + Intergenic
1034705091 7:153134867-153134889 CAAAAACAAAGATAAATAGATGG - Intergenic
1034715986 7:153242177-153242199 CAAAAACAAAGATAAATAGACGG - Intergenic
1036063608 8:5353862-5353884 CAAATACATATATAAATGGAGGG + Intergenic
1036179623 8:6573032-6573054 TTAAAAAATAAATAAATAAAAGG + Intronic
1036253391 8:7184071-7184093 CAAAAACACAGATAAATAGATGG - Intergenic
1036395606 8:8368053-8368075 CTAAAACCTAAACAAATAGCTGG - Intronic
1036438167 8:8755178-8755200 TGAATACATAAATAAATGGATGG - Intergenic
1037061250 8:14512457-14512479 CTAAAATATAAATAAATAAATGG - Intronic
1037466222 8:19163184-19163206 CTAAAACCTAAAGAAATTGGAGG - Intergenic
1037479471 8:19290683-19290705 CTACAACATAAATAAAAAGGAGG + Intergenic
1037978911 8:23236302-23236324 AGAAAACATCAATAAATGGAAGG + Intergenic
1038436916 8:27542801-27542823 CTAAAACACAAAAAATTCGCTGG - Intronic
1038631265 8:29246744-29246766 GAAAGACATATATAAATCGATGG + Intronic
1038806060 8:30792750-30792772 CTAAAACATAAATGATTGGCTGG - Intronic
1039021601 8:33213457-33213479 ATCAAACTTAAATAAATTGATGG + Intergenic
1039157289 8:34575325-34575347 CTTAAACATAAATAAAACTATGG - Intergenic
1039348940 8:36739996-36740018 CAAAAACAAAAAAAAATAGATGG + Intergenic
1039653555 8:39372684-39372706 CTAAAACAAAGATAAATAGATGG + Intergenic
1039763465 8:40602921-40602943 CAAAAACAAAGATAAATGGATGG - Intronic
1040004316 8:42605900-42605922 CAAAAACAAAAATAAATCAATGG - Intergenic
1040615449 8:49032206-49032228 CCAATAAATAAATAAATTGATGG - Intergenic
1040626353 8:49153852-49153874 CAAAAACAAAGATAAATAGATGG - Intergenic
1040683029 8:49836912-49836934 CAAAATCATAAATAAATACATGG - Intergenic
1040820538 8:51551804-51551826 CAAAAACAAAGATAAATAGATGG + Intronic
1040966857 8:53091109-53091131 CAAAAACAAAGATAAATAGATGG - Intergenic
1041100849 8:54395456-54395478 ATGAAACATAAATAAATAAAAGG - Intergenic
1041434399 8:57821682-57821704 CAAAAACAAAGATAAATAGATGG + Intergenic
1041508424 8:58627221-58627243 CAAAAACAAAAATAAATAAACGG - Intronic
1041524862 8:58793962-58793984 CAAAAACAAAAATAAATAAATGG + Intergenic
1041689517 8:60675456-60675478 TTAAAATATAAATATATAGAGGG - Intergenic
1042000651 8:64120240-64120262 CAAAAACAAAAATAAATAAATGG + Intergenic
1042095202 8:65207873-65207895 CAAAAACAAAAATGAATAGATGG - Intergenic
1042392044 8:68247227-68247249 CCAAAACAAAAATAAATAAATGG - Intergenic
1042431808 8:68715251-68715273 CAAAAACAAAGATAAATAGATGG + Intronic
1042478206 8:69274092-69274114 CTAAAACATTAATAATCCAAAGG + Intergenic
1042995918 8:74698486-74698508 CAAAAACAAAGATAAATAGATGG + Intronic
1043448793 8:80345466-80345488 CAAAAACAAAAATAAATAGATGG - Intergenic
1043537353 8:81220535-81220557 CAAAAACAGAAATAAATAGATGG - Intergenic
1043616772 8:82135027-82135049 CAAAAACAAAAATAAATAGATGG + Intergenic
1044056388 8:87575140-87575162 CTAAAAGATAAACAATTGGAAGG + Intronic
1044292876 8:90493215-90493237 CAAAAACAAAGATAAATAGATGG + Intergenic
1044451278 8:92338258-92338280 CAAAAACAAAAATAAATAAAAGG + Intergenic
1044510585 8:93073859-93073881 CTAAAGGATAAATAAAGTGAAGG - Intergenic
1044552485 8:93527602-93527624 CAAAAACAAAAATAAATAAATGG - Intergenic
1044665734 8:94632824-94632846 ATAAAAAATAAATAAAATGATGG - Intergenic
1044782443 8:95757270-95757292 ATTAAAAATAAATAAATAGATGG + Intergenic
1044876877 8:96677682-96677704 CAAAAACAAAAATAAATAAATGG - Intronic
1044947476 8:97403380-97403402 CAAAAACAAAGATAAATAGATGG - Intergenic
1044978876 8:97694759-97694781 CTAAAATACAAAAAAATCGCTGG + Intronic
1045122943 8:99058291-99058313 CTAAAACAAAAATAAAAAAAGGG - Intronic
1045154837 8:99456165-99456187 CAAAAAAATAAATAAATTCAAGG - Intronic
1045182887 8:99804998-99805020 CTAAAACATAATAAAATAAATGG + Intronic
1045825763 8:106396104-106396126 TAAATACATAAATAAATAGAGGG + Intronic
1045951945 8:107862193-107862215 CAAAAACAAAAATAAATAGATGG - Intergenic
1046033531 8:108812690-108812712 CAAAAACACAGATAAATAGATGG - Intergenic
1046110712 8:109720467-109720489 CTAAAACACAAATAAGTCCTAGG - Intergenic
1046140006 8:110079262-110079284 CTAAAAAAGAAATAAAGCAAAGG - Intergenic
1046460616 8:114529757-114529779 CAAAAACAAATATAAATCGATGG - Intergenic
1046882178 8:119321122-119321144 CAAAAACATAAATCAATACATGG - Intergenic
1046975772 8:120275469-120275491 CAAAAACAAAAATAAATAAATGG + Intronic
1047148349 8:122231433-122231455 CAAAAACAAAAATAAATAAATGG + Intergenic
1047226926 8:122963133-122963155 CAAAAACAAAGATAAATAGATGG - Intronic
1047596062 8:126378957-126378979 ATAAAAAATAAAAAAATTGAAGG + Intergenic
1048015975 8:130498343-130498365 CAAAAAAATAAATAAATAAAAGG - Intergenic
1048040813 8:130726844-130726866 CAAAAACAAAGATAAATAGATGG - Intergenic
1050223338 9:3422000-3422022 CTAAAAAAAAAAAAAATCTAAGG + Intronic
1050525740 9:6544678-6544700 TTAAAACATAAAGAAAACGTTGG + Intronic
1050582757 9:7078087-7078109 TTAAAAAATAAATAAATAAATGG - Intergenic
1050785684 9:9398601-9398623 CAAAAAAATAAAGAAATTGAGGG + Intronic
1051012647 9:12437478-12437500 CAAAAACAAAAATAAATGAATGG - Intergenic
1051190238 9:14503833-14503855 CAAAAACAAAGATAAATAGATGG - Intergenic
1051305224 9:15701253-15701275 CAAAAACAAAAATAAACCAAAGG - Intronic
1051477068 9:17519482-17519504 CTGAAACATAAATAAAACAAAGG + Intergenic
1051600957 9:18873310-18873332 TAAAAACAAAAATAAATAGATGG - Intronic
1051929863 9:22372181-22372203 CAAAAACAAAGATAAATAGATGG + Intergenic
1052053191 9:23872879-23872901 CAAAAACAAAGATAAATAGATGG + Intergenic
1052307006 9:27021839-27021861 CAAAAACAAAGATAAATAGATGG - Intronic
1052532964 9:29710867-29710889 CAAAAACAAAGATAAATAGATGG + Intergenic
1052564979 9:30138132-30138154 CAAAAACAAAGATAAATAGATGG + Intergenic
1052957356 9:34263712-34263734 GAAAAAAATAAATAAAACGAGGG - Intronic
1053063894 9:35053026-35053048 CAAAAACAAAGATAAATAGATGG + Intergenic
1053252437 9:36586035-36586057 TTAACACATAAATAAGTCAAAGG + Intronic
1053521902 9:38789272-38789294 GTAATACAGAAATAAATTGATGG - Intergenic
1054194070 9:62013260-62013282 GTAATACAGAAATAAATTGATGG - Intergenic
1054644337 9:67575431-67575453 GTAATACAGAAATAAATTGATGG + Intergenic
1055061258 9:72071339-72071361 CAAAAACAAAGATAAATAGATGG + Intronic
1055156715 9:73071683-73071705 CTAAAAGAAAAATAAATAGATGG + Intronic
1055206375 9:73735683-73735705 CAAAAACCTAAATAAAGTGAGGG + Intergenic
1055367001 9:75555289-75555311 TGAAAAAATAAATAAATGGATGG - Intergenic
1055530453 9:77177982-77178004 CCAAAATATAAACAACTCGAGGG - Intronic
1055959545 9:81807437-81807459 CTCAAAAATAAATAAATAAATGG + Intergenic
1056027065 9:82509739-82509761 CAAAAACAAAGATAAATAGATGG + Intergenic
1056215633 9:84403602-84403624 CAAAAAAATAAATAAATAAAAGG - Intergenic
1056395649 9:86179024-86179046 TTAAAACATAAATTTATCAAGGG + Intergenic
1056397059 9:86191648-86191670 CAAAAACAAAGATAAATAGACGG + Intergenic
1056429962 9:86517393-86517415 CAAAAACAAAAATAAATAAATGG - Intergenic
1056696590 9:88860983-88861005 CAAAAACAAAGATAAATAGATGG + Intergenic
1056948526 9:91022771-91022793 CAAAAACAAAGATAAATTGATGG + Intergenic
1057106116 9:92418954-92418976 CTAAAACTTAAATATATTAATGG - Intronic
1057116258 9:92525154-92525176 CTAAAACATAAAAAATTAGCTGG + Intronic
1058008413 9:99945477-99945499 CTAAAACATAAAGAAAAGAATGG - Intronic
1058343179 9:103922897-103922919 CAAAAACACAAATAAATAAATGG + Intergenic
1058411393 9:104736967-104736989 CAAAAACAAAAATAAATAGATGG + Intergenic
1058690039 9:107512246-107512268 CTCAAAAATAAATAAATAAAAGG + Intergenic
1059143335 9:111874999-111875021 CTCAAAAATAAATAAATAAATGG - Intergenic
1059212947 9:112531394-112531416 ATAAAAAATAAATAAATAAAAGG + Intronic
1059294170 9:113254896-113254918 CTCAAAAATAAATAAATAAAAGG + Intronic
1059542216 9:115142441-115142463 TACAAACATAAATAAATGGAGGG + Intronic
1059634425 9:116157396-116157418 CTAATACATAAAAAAAGGGAAGG + Intronic
1059997857 9:119930630-119930652 ATAAAACACTAATAAATCAAAGG - Intergenic
1060146279 9:121255242-121255264 CTCAAAAATAAATAAATGGCCGG - Intronic
1060383377 9:123198607-123198629 CAAAAACAAAAATAAATAAATGG - Intronic
1060635943 9:125200137-125200159 CAAAAAAATAAATAAATAAAAGG - Intergenic
1060636288 9:125201928-125201950 TTAAAAAATAAATAAATGGCCGG + Intronic
1060873736 9:127064857-127064879 CAAAAAAATAAATAAATCCAGGG - Intronic
1061294617 9:129670367-129670389 CTAAAAAATAAAAAAATTAAAGG - Intronic
1061633995 9:131894206-131894228 CAAAAATATAAATAAATTTAGGG - Intronic
1185879898 X:3731677-3731699 CTCAAAAATAAATAAATAAAAGG + Intergenic
1186056391 X:5654167-5654189 CTAAAACATAAATCCCTCAAAGG + Intergenic
1186941513 X:14513397-14513419 CAAAAACAAAGATAAATAGATGG + Intergenic
1186956120 X:14684047-14684069 CTAAAAAATAAATAAATAAATGG + Intronic
1188388921 X:29595747-29595769 CAAAAACAAAGATAAATAGATGG - Intronic
1188701134 X:33265365-33265387 CAAAAAAATAAATAAATAAAAGG - Intronic
1188708959 X:33370804-33370826 CAAAAACAAAAATAAATAGATGG - Intergenic
1188889975 X:35597874-35597896 CTAAAACAAAGACAAATAGATGG + Intergenic
1189567471 X:42258080-42258102 CAAAAACAAAGATAAATAGATGG + Intergenic
1189662853 X:43321543-43321565 CAAAAACAAAGATAAATAGATGG - Intergenic
1189945596 X:46174556-46174578 CAAAAACAAATATAAATAGATGG - Intergenic
1190100011 X:47515452-47515474 CAAAAAAATAAATAAATAAAAGG - Intergenic
1190428592 X:50355915-50355937 CAAAAACAAAAATAAATAAATGG - Intergenic
1190500345 X:51070002-51070024 CCAAAACACAAATAAGTTGAAGG + Intergenic
1190715985 X:53104038-53104060 CTCAAAAATAAATAAATAAAAGG - Intergenic
1190967516 X:55314883-55314905 CAAAAACAAAGATAAATAGATGG - Intergenic
1191137211 X:57078113-57078135 CAAAAACAAAAATAAATAAATGG - Intergenic
1191143934 X:57145569-57145591 CTAAAACAAAAATAAATAAGTGG - Intergenic
1191148568 X:57195614-57195636 CAAAAACACAGATAAATTGATGG - Intergenic
1191195501 X:57717718-57717740 CTAAAACATACAGACATCTACGG - Intergenic
1191601564 X:63014771-63014793 CAAAAAAATAAATGAATCCAGGG - Intergenic
1191712808 X:64169914-64169936 CAAAAAAATAAATAAATAAAAGG - Intergenic
1191787254 X:64929378-64929400 CTAAAACAAAAATAAATAAATGG - Intronic
1191871990 X:65754244-65754266 CAAAAACAGAGATAAATTGATGG + Intergenic
1191888498 X:65915577-65915599 CAAAAACAAAGATAAATAGATGG - Intergenic
1192058303 X:67796226-67796248 CAAAAACAAAAATAAATAAATGG + Intergenic
1192154731 X:68736039-68736061 CAAAAACAAAAATAAATAAATGG + Intergenic
1192164367 X:68817693-68817715 CAAAAACAAAGATAAATAGATGG + Intergenic
1192290823 X:69792978-69793000 CAAAAACAAAACTAAATAGATGG - Intronic
1192531029 X:71885921-71885943 CAAAAACAAAGATAAATAGATGG - Intergenic
1192690866 X:73362183-73362205 CAAAAACAAAAATAAACAGATGG - Intergenic
1192884543 X:75323146-75323168 CAAAAACAAAAATAAATAAATGG - Intergenic
1193119571 X:77809135-77809157 CAAAAACAAAAGTAAATAGATGG - Intergenic
1193162710 X:78245899-78245921 CAAAAACATACATAGATCAATGG + Intergenic
1193190715 X:78567047-78567069 CAAAAACAAAAATAAATAGATGG - Intergenic
1193207648 X:78767300-78767322 ATAAAAAATAAATAAATAAATGG + Intergenic
1193231006 X:79046421-79046443 CAAAAACAAAGATAAATAGAGGG + Intergenic
1193303093 X:79916254-79916276 CAAAAACAAAAATAAATAGATGG - Intergenic
1193390772 X:80926127-80926149 CGAAAACAAAAATAAATAGATGG + Intergenic
1193397890 X:81007126-81007148 CAAAAACAAAAATAAATACATGG - Intergenic
1193533361 X:82683654-82683676 AGAAGACATAAATAAATGGAAGG - Intergenic
1193549053 X:82867113-82867135 CAAAAACAAAAATAAATAAATGG - Intergenic
1193616827 X:83698990-83699012 CAAAAACAAAAATAAGTAGATGG - Intergenic
1193618907 X:83726427-83726449 CAAAAACAAACATAAATAGATGG + Intergenic
1193723206 X:85011347-85011369 CAAAAACAAAAATAAATAGATGG - Intronic
1193775586 X:85637192-85637214 CAAAAACAAAGATAAATAGATGG - Intergenic
1193938077 X:87646878-87646900 CAAAAACAGAGATAAATAGATGG + Intronic
1193964306 X:87965717-87965739 CCAAAACAAAAATAAATAAATGG + Intergenic
1194038128 X:88906027-88906049 CAAAAACAAAAATAAACAGATGG - Intergenic
1194058767 X:89170551-89170573 CAAAAACATAGATACATAGATGG + Intergenic
1194200455 X:90948545-90948567 CAAAAACAAAAATAAATACATGG - Intergenic
1194224497 X:91239450-91239472 CAAAAACAAAGATAAATAGATGG - Intergenic
1194226362 X:91264346-91264368 AGAAAACATCAATAAATGGAGGG - Intergenic
1194228491 X:91292430-91292452 CAAAAACAAAAATAAATAAATGG - Intergenic
1194245558 X:91507487-91507509 CAAAAACAAAAATAAATAGATGG + Intergenic
1194546265 X:95238850-95238872 ATAAAACATAAGTAAATTGGAGG + Intergenic
1194633577 X:96316597-96316619 CAAAAACAAAGATAAATAGATGG - Intergenic
1194633737 X:96318858-96318880 CAAAAACAAAAATAAATAAATGG - Intergenic
1194771381 X:97910264-97910286 CAAAAAAATAACTAAATCAAAGG - Intergenic
1194816176 X:98444773-98444795 CAAAAACAAAGATAAATAGATGG + Intergenic
1194967756 X:100308514-100308536 CAAAAACAAACATAAATAGATGG + Intronic
1195237461 X:102915598-102915620 CAAAAACAAGAATAAATAGATGG + Intergenic
1195293095 X:103448207-103448229 CAAAAACAAAAATAAATAAATGG - Intergenic
1195578507 X:106476305-106476327 CAAAAACATAAATCAATACATGG - Intergenic
1195784510 X:108504365-108504387 CAAAAACAAAAATAAATAAATGG + Intronic
1195818412 X:108914666-108914688 CAAAAACAAAGATAAATTGATGG + Intergenic
1195855106 X:109323012-109323034 CAAAAACAAAGATAAATAGATGG - Intergenic
1196024555 X:111027296-111027318 CAAAAACAAAGATAAATAGATGG + Intronic
1196090330 X:111734172-111734194 CAAAAACAAAGATAAATAGATGG - Intronic
1196231792 X:113232820-113232842 TTAAAACAAAGATAAATAGATGG - Intergenic
1196484400 X:116187917-116187939 CAAAAACAAAAATAAATAGATGG - Intergenic
1196942299 X:120789098-120789120 CTAAAACAAAAATCAAACCATGG - Intergenic
1196966242 X:121058629-121058651 CAAAAACAAAAATAAATAAATGG - Intergenic
1196979901 X:121200952-121200974 CAAAAACAGAAATAAATAAATGG - Intergenic
1196994243 X:121363466-121363488 CAAAAACAAAGATAAATAGATGG - Intergenic
1197325015 X:125082158-125082180 ATAAAAAATAAATAAATGAAAGG + Intergenic
1197383979 X:125781069-125781091 CAAAAACAAAGATAAATAGATGG - Intergenic
1197471790 X:126872325-126872347 CGAAAACAAAAATAAACAGATGG - Intergenic
1197487487 X:127071931-127071953 CTATAACAAAAATAAATAAATGG - Intergenic
1197571742 X:128158217-128158239 CAAAAACAAAAATAAATAGATGG - Intergenic
1197591252 X:128413443-128413465 CAAAAACAAAGATAAATAGATGG - Intergenic
1198262783 X:134980773-134980795 CAAAAACAAAAATAAATACATGG - Intergenic
1198452051 X:136776690-136776712 CAAAAACAAAGATAAATAGATGG + Intronic
1198987226 X:142468973-142468995 CTAAAACAAAGATAAATAGATGG + Intergenic
1199018778 X:142850827-142850849 CAAAAACAAAGATAAATAGATGG + Intergenic
1199101970 X:143812842-143812864 CAAAACCAAAAATAAATAGATGG + Intergenic
1199120379 X:144045712-144045734 CAAAAACAAAGATAAATAGATGG - Intergenic
1199229890 X:145424365-145424387 CAAAAACAAAAATAAATAAATGG + Intergenic
1199242197 X:145560320-145560342 CAAAAACAAAAATAAATAAATGG + Intergenic
1199584559 X:149400442-149400464 CAAAAACAAAGATAAATAGATGG + Intergenic
1200284675 X:154808802-154808824 CAAAAACAAAAATAAATAGGTGG + Intronic
1200313835 X:155109419-155109441 TTAAAATCTAAATAAATGGAGGG - Intronic
1200560959 Y:4702806-4702828 CAAAAACAAAGATAAATAGATGG - Intergenic
1200564526 Y:4748737-4748759 CAAAAACAAAAATAAATAGATGG + Intergenic
1200783889 Y:7241639-7241661 CTCAAAAATAAATAAATAAATGG + Intergenic
1201409236 Y:13681754-13681776 CAAAAACATAAATGACTTGAGGG + Intergenic
1201705397 Y:16930848-16930870 ATAAAAAATAAATAAATAGTGGG + Intergenic
1201757816 Y:17506081-17506103 ATAAAACAGAAATAAAGCAACGG - Intergenic
1201843738 Y:18399901-18399923 ATAAAACAGAAATAAAGCAACGG + Intergenic