ID: 987568167

View in Genome Browser
Species Human (GRCh38)
Location 5:19620566-19620588
Sequence ATGAAGAAGCAGAATGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 1, 2: 4, 3: 97, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987568167 Original CRISPR ATGAAGAAGCAGAATGAGAG AGG Intronic
900110958 1:1005422-1005444 AGGAGGAAGCTGACTGAGAGTGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900767002 1:4512524-4512546 ATGAAGAGACAGAAAGAGATGGG + Intergenic
900946869 1:5835783-5835805 AAGAAAAAACAGAATGGGAGTGG - Intergenic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902608018 1:17580055-17580077 AGGAAGAGGCAGAGTCAGAGTGG + Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
903761082 1:25699326-25699348 AAGAAGAAGAAGCATGAGAGAGG + Intronic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904137087 1:28321528-28321550 ATGGAGAAGCAGAAGGGCAGAGG - Intergenic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905334815 1:37237339-37237361 ATGAGGAATCAGAATGAGCGTGG + Intergenic
905340002 1:37271905-37271927 ACAAAGAGGCAGAAGGAGAGGGG - Intergenic
905722258 1:40215146-40215168 ATGAAATAGCAGAATCAAAGAGG + Intronic
906006291 1:42474730-42474752 GTGAAGAAGCAGGCTTAGAGAGG - Intronic
906141233 1:43534875-43534897 ATGAGGAAGCGGATTCAGAGAGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906643829 1:47458580-47458602 ATAAGGAAGGAGAATGAGAGGGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
907959585 1:59266275-59266297 AGGAGGAAGCAAAAAGAGAGGGG - Intergenic
908152711 1:61320093-61320115 AAAAAGAAGTAGAATGGGAGTGG - Intronic
908356446 1:63328341-63328363 AGGAAGAAGCGGGATGAGAAAGG + Intergenic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
909062986 1:70900701-70900723 AGGCAGAAGAGGAATGAGAGAGG + Intronic
909195112 1:72610424-72610446 AAGAAGAAGAAGAAAGAGATAGG - Intergenic
909569023 1:77087127-77087149 AGAAAGAAAGAGAATGAGAGTGG + Intergenic
909614475 1:77591329-77591351 ACGAAGAGGGAGAAGGAGAGAGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
910453217 1:87368220-87368242 ATGAAGAAGTAGGGTCAGAGAGG + Intergenic
910488457 1:87742071-87742093 ATGAAAAAGGAGAAGGGGAGGGG - Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910559222 1:88572282-88572304 ATGGAGAAGAAGTGTGAGAGGGG - Intergenic
910714226 1:90213414-90213436 GTGAAGTATCAGAAAGAGAGTGG - Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
911233365 1:95383607-95383629 ATGAAGAGGGAGAGAGAGAGAGG + Intergenic
911394076 1:97284668-97284690 ATGAAGTAGCAGGATGGGAGTGG - Intronic
911550331 1:99271030-99271052 ATGAAGAAACAGTAAGATAGTGG - Intronic
912158635 1:106953347-106953369 GAGAAGAAGCAAAGTGAGAGAGG - Intergenic
912269837 1:108198025-108198047 GTGAAGAAGCAAAATCCGAGGGG - Intronic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
913442409 1:118911907-118911929 ATTAAGAGGTAGAGTGAGAGTGG - Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
915945935 1:160151896-160151918 ATGAGGGAGCAGAAAGAAAGAGG - Exonic
916611547 1:166396725-166396747 ATGGTGAAGCAGGATGGGAGGGG + Intergenic
916672553 1:167036049-167036071 ATGAAGCAGTAGACAGAGAGGGG - Intergenic
916808545 1:168284129-168284151 ATGAAGTAGTAGAATGGGGGAGG - Intronic
917311987 1:173688375-173688397 AGGAAGAGGCAGAGAGAGAGAGG - Intergenic
917311993 1:173688429-173688451 AGGAAGAGGCAGAGAGAGAGAGG - Intergenic
917311999 1:173688477-173688499 AGGAAGAGGCAGAGAGAGAGAGG - Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917475228 1:175363570-175363592 ATGCTGCATCAGAATGAGAGTGG - Intronic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919046282 1:192456630-192456652 AGGAAGAAGATGAATAAGAGAGG + Intergenic
919326979 1:196120463-196120485 CTGAACAAACAGAATGAAAGAGG + Intergenic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923475796 1:234329889-234329911 ATGAAGATGCCAAAAGAGAGTGG - Intergenic
923735558 1:236603720-236603742 ATGAAGAAACAAAATTAGAGAGG - Intronic
923753641 1:236770468-236770490 AGAAAGAAGCAGAAAGTGAGAGG - Intergenic
923791443 1:237114796-237114818 ATTAAGCAGCAGGATCAGAGAGG - Intronic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
1063010299 10:2015168-2015190 AAGAAGAATGAGAAAGAGAGAGG - Intergenic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1067704443 10:48596535-48596557 AGGAAGATGCAGAAAGTGAGAGG + Intronic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068092959 10:52455281-52455303 AGCAAGAAGCAGAGTGAGAGAGG - Intergenic
1068316878 10:55356242-55356264 ATGAAAGAAAAGAATGAGAGAGG + Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068894411 10:62183568-62183590 ATGAAGCAGATGAATTAGAGAGG - Intronic
1069057464 10:63859725-63859747 AGGAAGGAGAAGAATGAGTGAGG + Intergenic
1069704509 10:70449702-70449724 TTGAAGAAGGACAATGAGATGGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1070574894 10:77670462-77670484 AGGAAGGGGGAGAATGAGAGAGG + Intergenic
1070574943 10:77670665-77670687 AGGAAGGGGGAGAATGAGAGAGG + Intergenic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070715211 10:78715406-78715428 AGGAGGAAGTAGAATGAGACTGG + Intergenic
1070830910 10:79417641-79417663 ATGAAGAAAGAGAAGAAGAGTGG + Intronic
1071450842 10:85790469-85790491 ATGATGAAGGAGATTCAGAGTGG + Intronic
1071558640 10:86627675-86627697 TTGAAGGAAAAGAATGAGAGAGG - Intergenic
1071836508 10:89423655-89423677 ATGTACAAGCAGAAAGAGAGGGG - Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072028567 10:91492144-91492166 ATCAGGAAACAGAATTAGAGAGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072400467 10:95093702-95093724 TTGAAGAGGGAGAGTGAGAGGGG + Intergenic
1072649028 10:97279017-97279039 TTGAAAAAGCAGTAAGAGAGAGG - Intronic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1073668917 10:105565228-105565250 AGAAAGAACCAGAATGAGAGAGG - Intergenic
1073668983 10:105566050-105566072 AGAAAGAACAAGAATGAGAGAGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075821063 10:125311732-125311754 CTGAAGAGGCATAGTGAGAGTGG - Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076510029 10:131006804-131006826 AGGAAGAAGCAGAGAGACAGAGG - Intergenic
1076546897 10:131251341-131251363 AGGAAGCAGCAGAGGGAGAGGGG - Intronic
1076671783 10:132124843-132124865 ATGAGGATGTAGAACGAGAGGGG - Intronic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079307833 11:19339491-19339513 AGGAAGAAACAGCATCAGAGAGG - Intergenic
1080161877 11:29186103-29186125 AGGAAGATGGAGAATGACAGAGG - Intergenic
1080595106 11:33766054-33766076 ATGAAGAAACAGGATTAAAGAGG - Intronic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1081086470 11:38808208-38808230 ATAAAGCAGCAGAATTTGAGAGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081395607 11:42582745-42582767 ATAAAAAAGGAAAATGAGAGAGG + Intergenic
1081560089 11:44205704-44205726 CTGAAGAAGAAGTATGATAGAGG - Intronic
1081589416 11:44410783-44410805 AGGCAGAAGCAGAATAAGAGAGG + Intergenic
1082888664 11:58114762-58114784 ATGAGGAAGCAGACCCAGAGGGG + Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083758025 11:64801837-64801859 AGGAAGAAGCAGCCTGAGTGGGG - Intronic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084386788 11:68848141-68848163 AGGTAGAAGGAGAACGAGAGAGG + Intergenic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085123309 11:73981300-73981322 CTGAAGGGCCAGAATGAGAGCGG + Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085468228 11:76738662-76738684 AACAAGAAGCAGAAAGAGAGGGG + Intergenic
1085789847 11:79487598-79487620 AAGAAGAAGAAGAAAGAAAGAGG + Intergenic
1085798256 11:79563628-79563650 ATGAAGAAACTGAAGCAGAGAGG + Intergenic
1085901545 11:80705977-80705999 TTGAATAAGCATAGTGAGAGTGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086572537 11:88302056-88302078 TTGAAGGAGCAGAGAGAGAGAGG - Intronic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087639254 11:100737891-100737913 CTGAGGAAGAGGAATGAGAGGGG - Intronic
1087641904 11:100764002-100764024 AAGAAGAAGAAGAAGAAGAGGGG - Intronic
1088560070 11:111105707-111105729 CTGAAGAAGCAGATTCACAGGGG - Intergenic
1089175111 11:116542923-116542945 ATGAAGAAGCAGTCCGGGAGAGG + Intergenic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090129329 11:124123327-124123349 ATGAAGAGACAGAGTGAGAGAGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090900598 11:131027347-131027369 GTGAGGAGGAAGAATGAGAGGGG - Intergenic
1091004655 11:131942178-131942200 ATGCAAAAGCAGAGAGAGAGTGG + Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091905106 12:4179375-4179397 ATGAAGAAGAAGGAGGGGAGGGG + Intergenic
1091987400 12:4922801-4922823 ATTAGGAAGCAGAATGATACTGG + Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092265856 12:6979927-6979949 ATGAAGGAGCAGATTCAAAGTGG - Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094044839 12:26155986-26156008 ATGATGAAGAAGATTGGGAGGGG + Intronic
1094474732 12:30832501-30832523 CTGAAGACGCAGAATGGCAGAGG + Intergenic
1094486386 12:30928682-30928704 AAGAAGAAGCAGACCCAGAGAGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095339699 12:41075171-41075193 ATGCTGAGTCAGAATGAGAGAGG - Intergenic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096194982 12:49643990-49644012 ATCAAGAAGGAGAAGGTGAGGGG + Exonic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097178099 12:57155004-57155026 ATGAAAAAGCAGGATCAAAGAGG + Intronic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1098292158 12:68966909-68966931 AGGATGAAGAAGAAAGAGAGGGG + Intronic
1098335994 12:69405000-69405022 AGAAAGAAGCAGAGAGAGAGAGG + Intergenic
1099227119 12:79982978-79983000 AAGAAGAAACAGAGAGAGAGAGG - Intergenic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1099414552 12:82370869-82370891 ATCAAAAAGAAGAAGGAGAGAGG - Intronic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100176351 12:92035229-92035251 AGGAAGGAGGAGAAAGAGAGTGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101582736 12:106058101-106058123 GTGAAGAAACAGATTGAAAGAGG - Intergenic
1101606302 12:106249163-106249185 AGAAAGAAGCAGACTGAGTGAGG - Intronic
1101615442 12:106331890-106331912 ATGAAGAAGCAGCTTGACTGGGG - Intronic
1101639664 12:106578982-106579004 ATGAACGAGCAGCATGAAAGAGG - Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1101724766 12:107379661-107379683 AGGAAGAAAAGGAATGAGAGAGG - Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101827795 12:108233966-108233988 ATGAGGACACAGGATGAGAGAGG - Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102564187 12:113784026-113784048 ATGAGGAAGCAGATTCAGAGAGG - Intergenic
1102710207 12:114919309-114919331 ATGGGGAAGCAGATTCAGAGAGG - Intergenic
1102795729 12:115687464-115687486 TTGAAGATGCAGACTGGGAGGGG - Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103595157 12:122020930-122020952 ATGAAGAGGGAGACCGAGAGTGG - Exonic
1103744089 12:123110493-123110515 AGGGAGAAGCACAATGGGAGAGG + Intronic
1104432056 12:128724524-128724546 TGGAAGAAGCTGAATGAAAGAGG - Intergenic
1105574087 13:21633615-21633637 ATTAAGAAGCACAATGAAACAGG + Intergenic
1105934694 13:25088215-25088237 ATGAACAAGCACAATGGGATGGG - Intergenic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106200454 13:27532418-27532440 ATGAAGAAACAGAATTAGCGAGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106742817 13:32665097-32665119 ATGTAGAAGCTGAGAGAGAGTGG + Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107037480 13:35916601-35916623 AGGAAGGAGGAGAAAGAGAGAGG - Intronic
1107613197 13:42137436-42137458 ATGAAGAATCTGAAACAGAGAGG + Intronic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1110721641 13:78768646-78768668 CTGAAGAAGGGGAATGGGAGTGG + Intergenic
1111425363 13:88073130-88073152 ATGAAGTAGGAGAACCAGAGTGG - Intergenic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112744830 13:102514819-102514841 AGGAGGAAGAAGAAAGAGAGAGG + Intergenic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114193634 14:20459164-20459186 ATGAGGCTGCAGAATGAAAGAGG + Intronic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1115088097 14:29541475-29541497 ATGAATAAGAATAATGATAGTGG + Intergenic
1115152711 14:30303744-30303766 ATGCTGCAGGAGAATGAGAGTGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115577517 14:34725549-34725571 ATGATGGAGCAGAAAGAGAGAGG + Intergenic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1118704329 14:68466565-68466587 ATGACAAGGCAGCATGAGAGAGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1120007795 14:79379774-79379796 AAGGAGAAGGAGAATTAGAGTGG - Intronic
1120071536 14:80108754-80108776 ATGAAGGAGAAGTATAAGAGTGG + Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120399644 14:84013511-84013533 ATGAAGTAGCATGATGGGAGAGG - Intergenic
1120498472 14:85264443-85264465 ATGAAGAAGTAGAGTGACACTGG - Intergenic
1120724062 14:87917704-87917726 ATAAAGAAGTATAATGAGAAAGG - Intronic
1120877556 14:89388761-89388783 AAGAAGAAGATGCATGAGAGAGG + Intronic
1121240626 14:92427500-92427522 AGGAAGGAGCAGATTGAGAGAGG + Intronic
1121530107 14:94646526-94646548 ATGATGACGCTGGATGAGAGGGG + Intergenic
1121780575 14:96619361-96619383 ATGGAGATGCAGAAAGACAGTGG + Intergenic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1122350820 14:101088998-101089020 AAGAAGAAGCAGACAGGGAGGGG - Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1123929273 15:25153006-25153028 CTGAAGAAGCACAAAGACAGAGG + Intergenic
1124921214 15:34028591-34028613 AAGAAGACCCTGAATGAGAGAGG + Intronic
1124999666 15:34756261-34756283 ATGAAGAAGTACACTGTGAGTGG - Intergenic
1125298883 15:38233223-38233245 ATGAAGGGGCAGAATGAAGGGGG + Intergenic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1126378948 15:48026413-48026435 ATGAAGAAGCAAAATAAAAAAGG - Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127177854 15:56381013-56381035 AAGAAGAGGCAGAAAGAGAGAGG - Intronic
1127235472 15:57046200-57046222 AGGAAGAAGCAGACTTAGATAGG + Intronic
1127948714 15:63783111-63783133 ATGCAGTAGCAGAGTTAGAGAGG + Intronic
1128317872 15:66672445-66672467 GTGAAGAGGCAGCAAGAGAGTGG - Intronic
1128324323 15:66713906-66713928 ATGAAGAATCAAACTGAGTGAGG + Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129247482 15:74288314-74288336 AAGAGGAAGAGGAATGAGAGTGG - Intronic
1129250438 15:74305888-74305910 ATGAAGAGACAGGATCAGAGAGG - Intronic
1129659423 15:77544675-77544697 ATGAAGGTGGGGAATGAGAGGGG + Intergenic
1129799598 15:78404090-78404112 ATGAGGAAGCTGAAGCAGAGAGG - Intergenic
1130380082 15:83364103-83364125 ATGAAGAAGCACAGTTAGCGAGG + Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131673276 15:94645092-94645114 ATGAAGAAGAAGGAAGAGACTGG + Intergenic
1133873830 16:9714287-9714309 ATGAAGAAGAAAAAGCAGAGTGG - Intergenic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1135114590 16:19714143-19714165 AAGAAGAAGAGGAAAGAGAGTGG - Exonic
1135249311 16:20887498-20887520 TTAAAGAAACAGACTGAGAGGGG + Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135855272 16:26004022-26004044 ATGAACAAACAGAAGTAGAGAGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1135918115 16:26624300-26624322 ATGAGCAAGCAGAGAGAGAGGGG + Intergenic
1137704155 16:50522477-50522499 ATGAGGAAGCGGAGGGAGAGTGG + Intergenic
1137722778 16:50637607-50637629 AGGAAGAAGAAGAAAGAGAGAGG + Exonic
1137764987 16:50971127-50971149 ATGAAGATGGAGGATGAGAGGGG + Intergenic
1137782474 16:51109253-51109275 ACTCAGAAACAGAATGAGAGGGG - Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138251674 16:55506493-55506515 ATGAAGAAACAGACTTAAAGAGG - Exonic
1138269882 16:55687949-55687971 ATGTAGAAACACAATGAGAGAGG + Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138629974 16:58285745-58285767 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
1139093025 16:63671914-63671936 ATGAAGAAGCAAAAGGAAAGAGG - Intergenic
1140195815 16:72854507-72854529 GTGAAGAGCCAGAATGGGAGTGG - Intronic
1140912163 16:79464095-79464117 AGGTAGAAGCAAAATAAGAGTGG - Intergenic
1141001565 16:80313072-80313094 AAGAAGTAGAAGAATGAGATGGG + Intergenic
1141537903 16:84696003-84696025 AAATAGAAGCAGAAAGAGAGAGG - Intergenic
1141961580 16:87412656-87412678 ACCAAGAAGCAGCATGAAAGTGG - Exonic
1142607345 17:1089409-1089431 ATGAGGAAGCTGATTCAGAGCGG + Intronic
1143840350 17:9726746-9726768 ATGAAGTGGCACAGTGAGAGTGG + Intronic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145763283 17:27440321-27440343 AGGAAGAAGGAGAGAGAGAGAGG - Intergenic
1146720688 17:35121438-35121460 GTGAAGCAGCATCATGAGAGGGG - Exonic
1146935523 17:36810390-36810412 AAGAAGAAGAAGAAGAAGAGGGG + Intergenic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147977228 17:44254858-44254880 ATGAGGAAAGAGAATCAGAGAGG + Intronic
1148271089 17:46262356-46262378 AAGAAGAAGAAGAAGAAGAGGGG - Intergenic
1148444591 17:47729803-47729825 ATGAAGACTCAAAATGAGAGAGG - Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1149785799 17:59433901-59433923 AAGAAGAAGAAGGAGGAGAGGGG - Intergenic
1149841434 17:59968410-59968432 TTCAAGAAGAAGAATGAGATTGG + Intronic
1150543237 17:66125211-66125233 ATGAAGAAGAGTTATGAGAGTGG - Intronic
1150566832 17:66349512-66349534 ATGAAAAGCCAGAAGGAGAGAGG - Intronic
1151203880 17:72490625-72490647 ATGAAGAGGTAGAATGTGAATGG - Intergenic
1151969946 17:77452441-77452463 ATGAAAAAGCAAAGAGAGAGGGG - Intronic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152123038 17:78430361-78430383 AGGAAGAAGCTGACTGTGAGCGG - Intronic
1153706076 18:7747331-7747353 ATGAAGAGGCAGAAAAGGAGAGG + Intronic
1153849162 18:9077247-9077269 ATGAAGATGCAGAACAGGAGGGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1156103701 18:33630494-33630516 ATAAAGAAGGAGGAGGAGAGAGG + Intronic
1156113254 18:33754137-33754159 ATGAAGAAGAAGAAAGAAACTGG - Intergenic
1156413796 18:36865774-36865796 ATGAAGAGTCAGAACCAGAGAGG - Intronic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157237917 18:45981471-45981493 GTGAAGAGGCAGCAAGAGAGTGG - Intergenic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1158274063 18:55747454-55747476 AGGAAGAAAAAGAATGACAGAGG - Intergenic
1158614025 18:58969362-58969384 ATGAAGAAAGGGTATGAGAGTGG - Intronic
1158905012 18:62003342-62003364 ATGATGGAGCAGAGAGAGAGAGG - Intergenic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159856476 18:73595773-73595795 ATGAAGACGCAGGCTGAGACTGG + Intergenic
1159926659 18:74275840-74275862 ATGAAGAAGCTGAAAAGGAGAGG + Intronic
1160232292 18:77057558-77057580 GTGAAGAAGGACAAGGAGAGAGG + Intronic
1160867102 19:1260814-1260836 AGGAAAAAGCTGAATGGGAGGGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161506549 19:4647083-4647105 ATGAATAAACAAAATGAGATCGG - Intronic
1161772074 19:6236349-6236371 ATGAAGATGCTGAATCAGACAGG + Intronic
1162425802 19:10594690-10594712 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1164426294 19:28144946-28144968 AAGAAGAAAGAGGATGAGAGAGG - Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1164710978 19:30357135-30357157 ATGAAGCAGGAGAATGGGTGGGG + Intronic
1165151931 19:33766135-33766157 AGGAAGAAGAAGAGAGAGAGAGG - Intronic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166566209 19:43767125-43767147 AGGAAGAGGGAGAGTGAGAGTGG + Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1166901534 19:46067672-46067694 ATGAACAAGCAGAATGGAGGAGG + Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168719629 19:58547859-58547881 ATGAAGGAGCTGAATAAGCGGGG + Exonic
924959993 2:26265-26287 AGGCAGAGGCAGAAGGAGAGAGG + Intergenic
924980985 2:221536-221558 AGGATAAAGCAGAGTGAGAGAGG + Intronic
925767573 2:7251434-7251456 GAGAAGAAGCAGAATAAAAGGGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926961568 2:18363748-18363770 TAGAAGAAGCTGAATGAAAGGGG + Intergenic
926974991 2:18505964-18505986 ATGAAGAGGGAGAGCGAGAGAGG + Intergenic
927066239 2:19473766-19473788 AAGAAAATGCAGATTGAGAGTGG - Intergenic
927322852 2:21768642-21768664 ATTATGAAGCAGATAGAGAGAGG + Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
927483553 2:23473155-23473177 ATGAAGACGCAGAGAGGGAGGGG + Intronic
927548413 2:23975431-23975453 ATGTCAAAGCAGACTGAGAGCGG + Intronic
927672365 2:25079435-25079457 ATAAAGAGGCAGGATCAGAGAGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
929122267 2:38493457-38493479 AGGAAGAAGAAAAATGGGAGAGG - Intergenic
929214774 2:39400516-39400538 ATGAAGGGGAAGAAAGAGAGGGG - Intronic
929223226 2:39486641-39486663 AAGAAGAGGAAGAAAGAGAGAGG + Intergenic
929389079 2:41447608-41447630 ATGATCATGCAGAATGAGTGAGG + Intergenic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
931402411 2:61943327-61943349 ATGAAAAAACACAAGGAGAGTGG - Intronic
931494272 2:62784914-62784936 ATGATGAATCAGAATCATAGAGG - Intronic
932107338 2:68956803-68956825 ATGATGAAAGAGAAAGAGAGAGG - Intergenic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933520711 2:83368451-83368473 AAGAAGAAGAAGAAGGATAGAGG + Intergenic
933580861 2:84125568-84125590 AAGAAGAAGAAGAAGGAAAGTGG + Intergenic
933833544 2:86228799-86228821 AGGAGGAAGGAGAATGTGAGTGG - Intronic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
935265993 2:101394764-101394786 AAAAAGAAGAAGAAAGAGAGAGG - Intergenic
935329590 2:101967094-101967116 TTGAGGAAGCAGACTCAGAGAGG + Intergenic
936044828 2:109179358-109179380 ATGAAAAAGCAGAACGTGAGAGG + Intronic
936112136 2:109673736-109673758 TGGAAGAAGGAGAAAGAGAGAGG + Intergenic
936344029 2:111661639-111661661 AGGAAGAAGCTGAAAGAGACAGG - Intergenic
937176927 2:119947281-119947303 ATGAACCAGCAGCCTGAGAGAGG + Intronic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937425729 2:121797041-121797063 AGGAAGAAGAAGAGTGAGTGAGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938123136 2:128647680-128647702 CTCCAGAAGCAGAATAAGAGAGG - Intergenic
938594745 2:132776590-132776612 ATGAAGAAGCAGCAAGAAAATGG + Intronic
938663817 2:133513334-133513356 ATGACCAAGCAGGGTGAGAGTGG + Intronic
939389149 2:141544293-141544315 AAGAAGAAGAAGAAGAAGAGTGG - Intronic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939475325 2:142679511-142679533 ATGAAGAAACAGAATGCAATGGG - Intergenic
939495653 2:142924941-142924963 ATGAAGAAGCAGACTCTGTGTGG + Intronic
940012962 2:149073839-149073861 AAGCAGAAGCTCAATGAGAGAGG + Intronic
942202711 2:173587979-173588001 AAATAGAAGCAGAGTGAGAGAGG + Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942632504 2:177966381-177966403 ATGAATAGGAACAATGAGAGTGG + Intronic
942832924 2:180257811-180257833 ATGAAGAAGCTGAGGGACAGAGG + Intergenic
942881044 2:180860628-180860650 AGGAAAAAGGAGAATGAGAAAGG + Intergenic
942999437 2:182306748-182306770 ATGAAGAAAAAGAATGACATTGG + Intronic
943134185 2:183890814-183890836 ATCAAAAAGGAGAAGGAGAGAGG + Intergenic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
943463039 2:188193448-188193470 ATGCAGAAGCAGGAGGATAGAGG - Intergenic
944126282 2:196296664-196296686 ATGAAGAAGGAGAATTATAGGGG + Intronic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
946743201 2:222820157-222820179 ATGAAGAAGAATAAGGACAGAGG - Intergenic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947934429 2:233991381-233991403 TTGATGTTGCAGAATGAGAGGGG + Intronic
948273240 2:236689547-236689569 AAGAAGAAGAAGAGGGAGAGAGG - Intergenic
948540944 2:238691145-238691167 CTCAAGAAGCAGAGTGAGAGAGG - Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1169270471 20:4195463-4195485 AGGATGAAGTAGAATGATAGGGG - Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169704385 20:8486036-8486058 AGGAAGGAGAAGAATGAGTGGGG + Intronic
1169845040 20:9980978-9981000 AGGAAGAAGGGGAAAGAGAGTGG + Intergenic
1169937035 20:10894739-10894761 ATGAAGAAACAAAAAGACAGAGG - Intergenic
1170154247 20:13255098-13255120 TTAAATAAGCAGAATGATAGAGG + Intronic
1170245052 20:14211673-14211695 GTGAGGCAGCAGAGTGAGAGAGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170786377 20:19471143-19471165 AAGAAGAAGCAGAGTAAGAGGGG + Intronic
1170973598 20:21140121-21140143 AGGAAGAAGCAGAAAGAAATGGG - Intronic
1171507393 20:25648766-25648788 AGGAGGAAGCAGATTTAGAGAGG + Intergenic
1172214347 20:33224470-33224492 ATACAGAAGCAGAATCTGAGAGG + Intronic
1172224363 20:33295505-33295527 ATGAGGCAGGAGAATCAGAGAGG + Intronic
1172325701 20:34032825-34032847 AAGAAAAATCAGAATTAGAGAGG - Intronic
1172353492 20:34262126-34262148 AAGAAGAAGAAGAAAGAAAGAGG + Intronic
1172929071 20:38569858-38569880 AAGAAGAAGAAGACAGAGAGCGG - Intronic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173133018 20:40412101-40412123 ATGAGGAAACGGGATGAGAGAGG - Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173936479 20:46870513-46870535 CTAAAGAAGCAGAATCTGAGTGG + Intergenic
1174096083 20:48090708-48090730 ATGAAGATGGAGCATGTGAGTGG + Intergenic
1174356020 20:49998347-49998369 ATGAATGAGCAGACTGAGGGAGG + Intergenic
1174666030 20:52258576-52258598 AGGAAGAAAGAGAATGAGAGGGG - Intergenic
1174943533 20:54958721-54958743 TTGATGAAGCAGAAGCAGAGAGG - Intergenic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177196307 21:17907102-17907124 ATGAAAAAGCAGGCTCAGAGTGG + Intronic
1178205930 21:30465079-30465101 ATAAAGAAACTGAATCAGAGAGG - Intergenic
1179311082 21:40196666-40196688 ATGAAACAGAAGAAAGAGAGGGG - Intronic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1181971729 22:26695718-26695740 AGCAAGGAGCTGAATGAGAGAGG + Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1181989050 22:26822715-26822737 ATAAGGAAGCAGCAGGAGAGGGG - Intergenic
1182277696 22:29200966-29200988 AAGCAGGAGGAGAATGAGAGTGG - Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1183223373 22:36531786-36531808 ATGAATAAGCAGGTTTAGAGAGG - Intergenic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
1185216618 22:49603529-49603551 ATAACAAAGCAAAATGAGAGTGG - Intronic
949165158 3:931554-931576 ATGAATACGAACAATGAGAGAGG - Intergenic
949347141 3:3087050-3087072 TTGAAGACGCAGAAGGGGAGAGG + Intronic
949348129 3:3096293-3096315 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950872427 3:16241315-16241337 AGAAACAAGCAGAATGAAAGTGG + Intergenic
951152264 3:19305130-19305152 ATCAAGAACCAGAATGACATTGG + Intronic
951181525 3:19664725-19664747 ATGAGGAAGGAGAATGAAAGTGG - Intergenic
951254790 3:20435847-20435869 ATGAAAACTCAGAATGAAAGAGG - Intergenic
951312776 3:21149395-21149417 ATGAAGAAGCAAAATCCGAGAGG - Intergenic
951432570 3:22625394-22625416 ATAAAGAAGAAAAAAGAGAGAGG - Intergenic
951618339 3:24573088-24573110 CTGTAGTAGCATAATGAGAGAGG + Intergenic
951872935 3:27385709-27385731 ATGAGGAAGCAGGCAGAGAGTGG - Intronic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
952553844 3:34509442-34509464 ATGAAGAAGAAGAGAGAAAGAGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953363936 3:42325633-42325655 TTGTAGAAGCAAAAGGAGAGAGG - Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953506515 3:43490999-43491021 ATTAAGAGGCAGAATGGCAGGGG + Intronic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954535809 3:51358488-51358510 ATGAAGAAGGACAGGGAGAGAGG - Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955016027 3:55070196-55070218 AAGAAGAGGCAGAAGGAAAGTGG + Intronic
955506198 3:59635565-59635587 ATTCAGAATCAGACTGAGAGAGG - Intergenic
955521567 3:59780334-59780356 ATGAAGAAGTAGAATGTCAGTGG + Intronic
955701344 3:61685069-61685091 CTTAAGAAAGAGAATGAGAGAGG - Intronic
956014673 3:64869238-64869260 ATGAAGAACCAAAATAATAGTGG + Intergenic
956043644 3:65172592-65172614 ATGAGGGTGCAGACTGAGAGGGG - Intergenic
956077268 3:65518884-65518906 GAGAAAAAGCAGAATAAGAGTGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956639110 3:71397942-71397964 AGGAAGAAGCAGAGAGAGTGGGG + Intronic
957252523 3:77792151-77792173 ACAAAGAAGGAGAAAGAGAGTGG + Intergenic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958061730 3:88492218-88492240 ATAAAGCAGCAGATTAAGAGTGG - Intergenic
958446155 3:94217544-94217566 ATGAAGAGGAGGAAGGAGAGTGG + Intergenic
958479422 3:94627871-94627893 AGGAAGAAAGAGAAGGAGAGAGG - Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960252962 3:115477101-115477123 AGGAAGAGGGAGAAAGAGAGAGG + Intergenic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961953731 3:130778189-130778211 ATGAAGAAGCAGAATTTCTGGGG - Intergenic
962389184 3:134957408-134957430 ATGAAGAAGGAGTCTGGGAGAGG + Intronic
962695945 3:137947449-137947471 ATGAAGAAACAGAAGCACAGAGG - Intergenic
963115586 3:141726439-141726461 AAGAAGAAGAAGAAGAAGAGAGG + Intergenic
963376773 3:144477109-144477131 ATGAAGAAATAAAAGGAGAGAGG - Intergenic
963550248 3:146711765-146711787 AAGAGGAAGGGGAATGAGAGAGG - Intergenic
963999931 3:151758272-151758294 AAGATGAAGCAGAAAGAGATTGG - Intronic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
964411729 3:156404821-156404843 AGGAAGGAGCAGAGGGAGAGTGG + Intronic
964575375 3:158160901-158160923 ATGAAGAAACAGACTTACAGAGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964881446 3:161427753-161427775 ATCAAGAAGCAGAATAAAATTGG + Intergenic
964941878 3:162167952-162167974 ATGCAGAAGAAAAATGAAAGGGG - Intergenic
965011036 3:163091397-163091419 AAAAATATGCAGAATGAGAGAGG + Intergenic
965060280 3:163775821-163775843 CTTAATAATCAGAATGAGAGAGG + Intergenic
965210047 3:165773478-165773500 TTGATGAAGCAGAATGGGAGTGG - Exonic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966248052 3:177830893-177830915 ATAAAGAAGCAGCATGGGAGTGG + Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966900077 3:184475865-184475887 AAGAAGAATAAGAATAAGAGGGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967382333 3:188872946-188872968 GTGAGCAAGCAGACTGAGAGAGG - Intronic
967646581 3:191930947-191930969 AGAAATAAGCAGAATGAAAGTGG - Intergenic
967664852 3:192158719-192158741 AGGAAGAATAAGAAGGAGAGAGG - Intronic
967874779 3:194260501-194260523 ATGAAGAAGAAGAAGGCAAGGGG - Intergenic
968313550 3:197703713-197703735 TTGAGGAAGCAGAAAGGGAGAGG + Intronic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969112851 4:4854490-4854512 ATGAAAGAACAGAATCAGAGAGG - Intergenic
969128967 4:4976943-4976965 ATGAATAAAGAGCATGAGAGAGG - Intergenic
969657308 4:8505654-8505676 ATGAGGAAGCAGAGACAGAGAGG + Intergenic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970222161 4:13822248-13822270 AAGAAGAAGAAGAAAAAGAGTGG - Intergenic
970916268 4:21338819-21338841 ATGAAGAAAAAGAATCTGAGTGG - Intronic
971130150 4:23799430-23799452 ATGAAGAAGCAGAACTGAAGGGG + Intronic
971164214 4:24165938-24165960 ATGATGAAGCTTAATGAGAAAGG + Intergenic
971166052 4:24184834-24184856 ATGATGAGGAAGAAAGAGAGAGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971559448 4:28057634-28057656 ATGAAGGAGAAGTCTGAGAGTGG + Intergenic
971600558 4:28586198-28586220 AGGAAGAAGAAGGAAGAGAGGGG - Intergenic
972688190 4:41371176-41371198 ATGAAGAGAGAGAAGGAGAGAGG - Intronic
972873829 4:43333086-43333108 CTAAAGAAGCATAATGACAGTGG + Intergenic
972885516 4:43481316-43481338 AAGAAGAAGCAGCTTGAGATAGG + Intergenic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973787641 4:54348537-54348559 AGGATGAAGCACAATGAGGGGGG + Intergenic
973849600 4:54948053-54948075 AGGAAGAAGCAGTAGGAGATAGG + Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974294292 4:59975803-59975825 GTGAAGAAGATGAATGTGAGTGG - Intergenic
975588582 4:75977316-75977338 ACTAAGAAGCAGTGTGAGAGTGG + Intronic
975840709 4:78470823-78470845 AGGAGGAAACAGAAAGAGAGGGG + Intronic
977371413 4:96141823-96141845 ATGTAGAAGGAGAAAGGGAGAGG - Intergenic
977691013 4:99910987-99911009 ATGAAAGAGCAACATGAGAGTGG - Intronic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978844780 4:113260175-113260197 GTGAAGAAGCAAAGTAAGAGTGG - Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979163076 4:117488761-117488783 ATGAAGAAGCAGAAGCCTAGAGG + Intergenic
979861955 4:125705647-125705669 ATTATGAAGCAGAATGTGATGGG + Intergenic
979911434 4:126371634-126371656 AGGAAGTACCAGACTGAGAGTGG + Intergenic
979960209 4:127009928-127009950 ATGAAGGAGAAGAGAGAGAGCGG + Intergenic
980387565 4:132106059-132106081 ATGAAGAAGAAGATTGATATTGG + Intergenic
980765666 4:137300766-137300788 ATGAAGATTGAGAATAAGAGTGG - Intergenic
981637862 4:146900672-146900694 TTTAAAAATCAGAATGAGAGGGG + Intronic
982190509 4:152850115-152850137 ATGCTGATGCAGAATGACAGGGG - Intronic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982251342 4:153410069-153410091 ATGAGGAAGTAGGCTGAGAGAGG - Intronic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
982369909 4:154623704-154623726 CTGAAGAAGAGGAATCAGAGAGG - Intergenic
982383650 4:154776935-154776957 ATTAAGAATCAGAATTGGAGTGG + Intergenic
982966136 4:161910731-161910753 ATGAAGAAGCAAGCTGGGAGAGG - Intronic
983654802 4:170071907-170071929 ATGGAGATGGAGAATGTGAGAGG + Intronic
984052136 4:174877452-174877474 TTGAAGAGGCAGTATCAGAGAGG + Intronic
984502673 4:180576340-180576362 ATGAAGAAACAAACTTAGAGAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984694058 4:182761423-182761445 AAAAAGAAGAAGAATTAGAGAGG + Intronic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984765422 4:183397141-183397163 ATCTAGAAACAGAATGAGTGAGG + Intergenic
985157813 4:187010502-187010524 ATGAAGAAGCAGCATGAACTGGG + Intergenic
985305985 4:188540739-188540761 AGGAAGAAGCAGGCTGACAGTGG - Intergenic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986307793 5:6528626-6528648 ATGAACAGCCAGAATCAGAGGGG + Intergenic
986672349 5:10153582-10153604 ATGAAGAACATGAATCAGAGAGG - Intergenic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987244923 5:16039136-16039158 ATGAAAATGCACAATTAGAGTGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987604714 5:20118023-20118045 ATAATGAAGCAGAATTACAGTGG - Intronic
988200713 5:28065650-28065672 ATGAAAAAAGAAAATGAGAGAGG - Intergenic
988501032 5:31783967-31783989 ATGAGGGAACAGATTGAGAGGGG - Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990599523 5:57343528-57343550 ATGAGGAAGCAGACAGTGAGGGG - Intergenic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992520671 5:77547225-77547247 ATGAAGAAGAGTAGTGAGAGTGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993799609 5:92316587-92316609 ATGAGGAAGCAGAAAGACAGAGG + Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
994722109 5:103392295-103392317 ATGAAGAAACAGAAGCTGAGAGG - Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995616394 5:113969063-113969085 ATGAAGGAGAAGGATGGGAGAGG + Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996171583 5:120299259-120299281 ATTATTAAGCAGAAAGAGAGTGG + Intergenic
996185918 5:120475160-120475182 ATGAAGAAGCACAGACAGAGAGG + Intronic
996492944 5:124119978-124120000 ATGAATAGGCATAGTGAGAGTGG + Intergenic
997276034 5:132591297-132591319 ATGAAAAAGCAGACTTAGACAGG + Exonic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997750131 5:136336380-136336402 GTGAAGAAATAGACTGAGAGTGG - Intronic
997792084 5:136770252-136770274 ATGAAGGACCAGACTGTGAGTGG - Intergenic
997890038 5:137667968-137667990 ATGAGGAAACAGCCTGAGAGAGG + Intronic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998501225 5:142634560-142634582 ATGAGGAACCAGACTCAGAGCGG - Intronic
998532875 5:142901686-142901708 ATGAGGAAGCAGGTTCAGAGAGG - Intronic
998685660 5:144521450-144521472 ATGAAGATGTAGAAGGATAGTGG - Intergenic
998720569 5:144943035-144943057 ATAAAGAAGGAGAAGGACAGAGG - Intergenic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
998878890 5:146627447-146627469 ATGAGGGTGAAGAATGAGAGTGG + Intronic
999039057 5:148386366-148386388 ATGAACAAACAGAACCAGAGAGG - Intronic
999057682 5:148597488-148597510 AGTAAGAAGAAGAATGAGACAGG - Intronic
999075490 5:148791584-148791606 ATCAACAAGCTGAATGAGAGGGG + Intergenic
999152713 5:149436958-149436980 AAGAAGAAGAAGAAAAAGAGTGG + Intergenic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
999282271 5:150373706-150373728 ATGAAGAGGCAGTCTGAAAGTGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999921392 5:156325482-156325504 ATGAGGAAACAGATCGAGAGAGG + Intronic
1000293097 5:159889561-159889583 ATGAAGAAGTAGAGACAGAGAGG + Intergenic
1001022220 5:168192860-168192882 ATGAGGAAGCAGATTGAAACAGG - Intronic
1001176018 5:169469669-169469691 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1001399355 5:171437495-171437517 AGGAAGAAGGGGAAAGAGAGTGG - Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002652548 5:180711271-180711293 ATGAAGAATAATAATGAGAATGG + Intergenic
1003001011 6:2333495-2333517 CTAAAGAAAGAGAATGAGAGAGG + Intergenic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003358692 6:5402069-5402091 AAGAAGAATCAGAAAGAAAGTGG - Intronic
1003450124 6:6223040-6223062 AGCCAGAAACAGAATGAGAGTGG - Intronic
1003593068 6:7452259-7452281 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1003631480 6:7791498-7791520 ATGAAGATGGAGAAGCAGAGAGG - Intronic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1004974827 6:20952907-20952929 ATGAAGAATCCTAATGAGAATGG - Intronic
1005143454 6:22661141-22661163 ATGAAGAAACTGAAGCAGAGAGG - Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005699859 6:28389573-28389595 CTAATGAAGCAGAATGTGAGTGG + Intronic
1006064134 6:31449758-31449780 AAGAGGAAGCAGAATCAAAGTGG + Intergenic
1006721333 6:36153734-36153756 AGGAAGAAGCCAGATGAGAGCGG - Intergenic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007350794 6:41272148-41272170 AGGAAGATGCAGAAAAAGAGAGG + Intronic
1007957764 6:45932885-45932907 ATGAGGAAGGGAAATGAGAGAGG + Intronic
1008383243 6:50857472-50857494 CTGATGAAGCAGATTCAGAGAGG - Intergenic
1008456343 6:51715319-51715341 AGGAAGAAGCATAATGAAGGAGG - Intronic
1009451671 6:63808302-63808324 ATGAAGAAGAAAAGTGAGAGTGG + Intronic
1009831506 6:68942555-68942577 ATTAAGAATTAGGATGAGAGTGG + Intronic
1010708766 6:79146872-79146894 ATGAAGATGGAAAAGGAGAGTGG + Intergenic
1011128240 6:84029570-84029592 ATGAAGAGGCAGCATGGGGGTGG - Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011165734 6:84443911-84443933 ATGAAGAAGCAGAAACTCAGGGG + Intergenic
1011407045 6:87026489-87026511 AAGAAGAAGAAGAAAGTGAGGGG + Intergenic
1012427514 6:99130751-99130773 AGGAAGAGGGAGAATGAGAGAGG - Intergenic
1012572268 6:100743325-100743347 ATCATGAAGCGGAATGAAAGGGG - Intronic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012903982 6:105042821-105042843 AAGAAAAACCACAATGAGAGGGG - Intronic
1013284886 6:108672744-108672766 AAGAAGAAAGAGGATGAGAGAGG - Intronic
1013323175 6:109015660-109015682 ATGAAAAAGGTGAATGTGAGGGG + Intronic
1013551328 6:111210614-111210636 AGGAAGAAGCCGAATGTGTGTGG + Intronic
1013651774 6:112202256-112202278 AGGAAGAAGAAGAAAGAGAGAGG - Intronic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1014366361 6:120547618-120547640 AGGAAGTAGTAGAATGAGACAGG - Intergenic
1014795713 6:125721960-125721982 CTGAAGAGTGAGAATGAGAGCGG - Intergenic
1014919741 6:127200078-127200100 ATGATGAAGGAGAAGGAAAGTGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015689247 6:135902918-135902940 ATTAGGAAACAGGATGAGAGAGG + Intronic
1016413566 6:143809288-143809310 ATGAAGAAGCACAATAAAATTGG + Intronic
1017406141 6:154121305-154121327 ATGAAGGAGCAAAATAACAGTGG - Intronic
1017644323 6:156525102-156525124 ATGAGAAAGCAGAATCAGGGAGG - Intergenic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1018756668 6:166855503-166855525 AAGAAGAAGAAGAATAAGAAGGG + Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019521149 7:1461059-1461081 ATCAAGAAGCAGAAGCAGCGGGG + Intergenic
1019772802 7:2894376-2894398 ATGAAGAAGGAGACACAGAGAGG - Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020522472 7:9209652-9209674 AAGAATAATCAGAATGAGATAGG - Intergenic
1020791009 7:12628180-12628202 ATGAGGAGGCAGAATGAAAGTGG + Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022254116 7:28638641-28638663 ATCAAGAAACAGAATGTGACCGG - Intronic
1022574181 7:31481918-31481940 TTCCAGAAGAAGAATGAGAGAGG + Intergenic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1022998631 7:35784804-35784826 ATGGAGGGGCAGAAAGAGAGGGG - Intergenic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023478425 7:40606165-40606187 AAGAAGAAGGACAAAGAGAGTGG + Intronic
1023737529 7:43248141-43248163 AGAAAGAAGAAGAAAGAGAGAGG + Intronic
1024321287 7:48073565-48073587 ATGAATAAGAAGGGTGAGAGTGG - Intergenic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1026015863 7:66670053-66670075 TTTAAGAAGGAGAATGAGATGGG - Intronic
1026494151 7:70888188-70888210 AGGAAAAGGGAGAATGAGAGGGG + Intergenic
1026675186 7:72422658-72422680 ATGAAGAATAAGAATGAAACAGG - Intronic
1027552185 7:79612774-79612796 ATGAAAAAGCCGGCTGAGAGTGG - Intergenic
1027818198 7:83006494-83006516 ATGAAACAGCAGTATGAGAAAGG - Intronic
1027961427 7:84950771-84950793 AGGAAGAAGCAAAGTGACAGAGG - Intergenic
1028070815 7:86447974-86447996 AGAAAGAAGGAGAAAGAGAGAGG + Intergenic
1029422096 7:100477178-100477200 ATGGAGAAGGAGGAGGAGAGGGG + Intronic
1029853802 7:103492687-103492709 AATAAGAAGCATAATGATAGTGG + Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030878640 7:114848489-114848511 ATGAAGAAGGTGCATGAGATAGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031443537 7:121823192-121823214 ATGAAGAAATAGAAAGTGAGAGG - Intergenic
1031837404 7:126694941-126694963 ATGGAGAAACAGAATGTAAGTGG + Intronic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032725544 7:134587129-134587151 GGGAAGAAGCAGAGAGAGAGGGG + Intergenic
1032961588 7:137041622-137041644 ATGAAGAAGCAGCAAGAAAATGG - Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033952757 7:146805544-146805566 GTAAAGTAGCAGAATGAAAGAGG + Intronic
1034375957 7:150644322-150644344 AGGAAGGAGAAGAATGACAGTGG - Intergenic
1034633651 7:152550398-152550420 TTGAAGCAGAAGAATGTGAGAGG + Intergenic
1035017256 7:155777488-155777510 GGAAAGAAGCAGAATGAGAAAGG + Exonic
1035093820 7:156335723-156335745 GTGAAGCAGCAGAATGTGTGAGG - Intergenic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1036824993 8:11968993-11969015 ATCAGGAAGCAGAAAGGGAGTGG + Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037308610 8:17531201-17531223 ATAAAGAAGCAGCAAGAGCGGGG + Intronic
1037394260 8:18425488-18425510 AATAAGAAACAGACTGAGAGTGG + Intergenic
1037483985 8:19330418-19330440 AAGAAGAAAGAGAATGAGATGGG - Intronic
1037699100 8:21256228-21256250 AAGAAGAACAAGAATGAGTGAGG - Intergenic
1038011245 8:23477788-23477810 AAAAAAAAGCAGAATGGGAGTGG - Intergenic
1038881312 8:31616304-31616326 ATAAATAAGCAGAATTATAGAGG - Intergenic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039642122 8:39235004-39235026 ATGAAGAGTCAGACAGAGAGGGG - Intronic
1040356785 8:46626085-46626107 GTGAAGAAACAGAATCTGAGGGG - Intergenic
1040551394 8:48440207-48440229 ATGAAGAGTCAGGATGACAGTGG + Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1041094110 8:54332255-54332277 ATGAAGAAGGAGGTTCAGAGAGG - Intergenic
1041179979 8:55237009-55237031 AAGAAGAAGCACAACCAGAGGGG - Intronic
1041370493 8:57154641-57154663 AAAGAAAAGCAGAATGAGAGAGG - Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042580780 8:70276910-70276932 ATGAGACAGCAGAATGAAAGTGG - Intronic
1043157826 8:76807408-76807430 CTGAACAAGCAGAATTAGATTGG + Intronic
1043211056 8:77518505-77518527 TTGAAGAATGAAAATGAGAGAGG + Intergenic
1043550086 8:81361557-81361579 ATGATGGAGCAGAGGGAGAGAGG + Intergenic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1044335468 8:90979216-90979238 TGGAAGAATGAGAATGAGAGGGG - Intronic
1045841262 8:106584527-106584549 ATCAAGAATCAGAATGACATAGG + Intronic
1045845343 8:106628411-106628433 ATGAAGAAACAGATTTTGAGAGG + Intronic
1045906146 8:107347431-107347453 ATGAAAAAATAGAATCAGAGAGG + Intronic
1045949742 8:107838229-107838251 ATGCAGAGGCAGAAAGATAGGGG + Intergenic
1047467611 8:125133057-125133079 AGATAGAAGCAGAATGAAAGTGG - Intronic
1047481175 8:125284447-125284469 ATGAGGAAACAGAACCAGAGAGG + Intronic
1047665301 8:127085330-127085352 AGGAAGAAGGAGAATGAAAGTGG - Intergenic
1047809894 8:128396990-128397012 TTGAAGCAGCAGGATGTGAGAGG + Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048444919 8:134486124-134486146 ATGAAAAACCAGAATGACAGTGG + Intronic
1048700732 8:137086033-137086055 ATAAAGGAGGAGAAAGAGAGAGG + Intergenic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1050325729 9:4495641-4495663 ATCAAGGAGTAGAATGAGGGAGG + Intronic
1050408051 9:5330661-5330683 AAGAAGAAGAAGAATTAGAGAGG + Intergenic
1050515907 9:6444550-6444572 ATGAGGAAGCAGGGAGAGAGAGG - Intronic
1050890929 9:10823704-10823726 ATAAAGCACCAGAATGTGAGTGG + Intergenic
1051308352 9:15740785-15740807 AAAAAGAAGAGGAATGAGAGGGG - Intronic
1052160566 9:25253640-25253662 AGGAAGAAGTGGAAGGAGAGAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052224917 9:26074155-26074177 ATGTTGAATCAGAGTGAGAGAGG + Intergenic
1053257481 9:36630333-36630355 TTGAAGAAGCAGAATGCTACTGG - Exonic
1053513760 9:38711642-38711664 AAAAAGAAGAAGAAAGAGAGAGG - Intergenic
1054452859 9:65412732-65412754 AGGAAGGAGCAGCGTGAGAGGGG - Intergenic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1055807051 9:80107599-80107621 ATCAAGATGCAGGATCAGAGAGG + Intergenic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1056390005 9:86132146-86132168 AGAGAGTAGCAGAATGAGAGAGG - Intergenic
1056620051 9:88204990-88205012 AGGAAGAAAGAGAATGATAGGGG + Intergenic
1056636912 9:88338787-88338809 ATGAAAAAGCAGCATGGGACTGG - Intergenic
1057955108 9:99401136-99401158 ATGTGGAAGGAGAATGTGAGAGG - Intergenic
1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG + Intergenic
1058040061 9:100293366-100293388 ATGAAGAAGCAGAGGGTCAGGGG - Intronic
1058551474 9:106120035-106120057 ATGAAGAAGCAGGAAGCAAGGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059025007 9:110616985-110617007 AGGAAGAAACAGAGTGGGAGGGG + Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059827928 9:118053336-118053358 GTGAACAACCAGAATGAGATTGG - Intergenic
1059976434 9:119722822-119722844 AGGCAGAAGCAGAACGAGAGAGG - Intergenic
1060067001 9:120511165-120511187 AAGAAGAGGCACAATGAGACTGG + Intronic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060185506 9:121561810-121561832 GTAAAGGAGCAGCATGAGAGAGG - Intergenic
1060237266 9:121873639-121873661 AAGAAGAAGAAGAAGAAGAGAGG - Intronic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1062530475 9:136997325-136997347 AAAAAGAAGCAGCAGGAGAGGGG + Intergenic
1185793426 X:2945009-2945031 AAGAAGAAGAAGAAGAAGAGGGG + Intronic
1185948706 X:4406435-4406457 ATGGAGAGAGAGAATGAGAGAGG + Intergenic
1185966806 X:4614786-4614808 AGGAAGAAACAGAGTGACAGAGG + Intergenic
1186368225 X:8918578-8918600 ATGAATAAGCTCAATGAGTGTGG - Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186550981 X:10505379-10505401 ATGAAGAAGCAGAATGGAAGGGG + Intronic
1187021624 X:15388449-15388471 ATGAAGAAGCAGAAGGTCAAAGG - Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187909415 X:24097062-24097084 TTGAAGAAGGTAAATGAGAGGGG + Intergenic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188409514 X:29854049-29854071 ATTTGGAAGGAGAATGAGAGAGG - Intronic
1188992651 X:36841528-36841550 AAAAAGAAGAAGAATGAGAGTGG - Intergenic
1189060403 X:37747101-37747123 CTGATGAAGAAGAAAGAGAGGGG + Intronic
1189110611 X:38286128-38286150 AGGAGGAAGGAGAATGGGAGGGG - Exonic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1190725979 X:53190849-53190871 ATGAGAAAGCAAAATAAGAGTGG + Intergenic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190792210 X:53711024-53711046 GTGAAGAGGCAGCAAGAGAGAGG + Intergenic
1191112213 X:56812793-56812815 AAGAAGAAGAAGAAAGAAAGAGG - Intergenic
1191680662 X:63836799-63836821 ATGAAGTTAGAGAATGAGAGGGG - Intergenic
1192617745 X:72645593-72645615 ATGCAGAGGAAGAATGATAGGGG + Intronic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1193568364 X:83108606-83108628 AAGAAGGAGGAGAGTGAGAGAGG - Intergenic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1194082342 X:89484637-89484659 ATTAAAAAACATAATGAGAGGGG - Intergenic
1194294505 X:92111731-92111753 ATGAAAAATGAGAATTAGAGTGG - Intronic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195577549 X:106468143-106468165 AGGAAGAAGAAGAAGGAGAGGGG - Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1196071198 X:111524468-111524490 TTGAAGAAGCACAGTGAGTGAGG + Intergenic
1196518409 X:116641494-116641516 ATAAAAAGGCAGAATGAAAGTGG + Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1197176498 X:123491767-123491789 AAGAAGAAGAAAAATGGGAGTGG + Intergenic
1197551105 X:127893840-127893862 AAGAAGACGCAAAATCAGAGTGG - Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1198107133 X:133472709-133472731 ATAAAGAAACAGGGTGAGAGTGG + Intergenic
1198434303 X:136600442-136600464 TTGAAGAAATAGAATGAGTGGGG - Intergenic
1198442791 X:136680570-136680592 ATGAGAAATCAGAATGAGTGAGG + Intronic
1198522362 X:137465854-137465876 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199316576 X:146385545-146385567 ATGAAAAAGAAAAAGGAGAGTGG + Intergenic
1200414201 Y:2890819-2890841 AAGAAGAAGAAGAAAGAAAGAGG + Intronic
1200435009 Y:3140823-3140845 ATTAAAAAACATAATGAGAGGGG - Intergenic
1200755297 Y:6985028-6985050 ATGAGGAAGCAGAAGTGGAGAGG - Intronic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic
1202051362 Y:20784181-20784203 ATGAAGAAGTAAAATGGGACTGG + Intergenic