ID: 987571125

View in Genome Browser
Species Human (GRCh38)
Location 5:19660906-19660928
Sequence GTTTCAAGCCTGAAAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 375}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987571120_987571125 21 Left 987571120 5:19660862-19660884 CCTGGACTTCTGACCTTCAGCAC 0: 1
1: 1
2: 23
3: 120
4: 485
Right 987571125 5:19660906-19660928 GTTTCAAGCCTGAAAGTGTGTGG 0: 1
1: 0
2: 0
3: 25
4: 375
987571122_987571125 8 Left 987571122 5:19660875-19660897 CCTTCAGCACTGTGAGGCAAGAG 0: 1
1: 0
2: 1
3: 29
4: 419
Right 987571125 5:19660906-19660928 GTTTCAAGCCTGAAAGTGTGTGG 0: 1
1: 0
2: 0
3: 25
4: 375
987571119_987571125 24 Left 987571119 5:19660859-19660881 CCACCTGGACTTCTGACCTTCAG 0: 1
1: 8
2: 23
3: 87
4: 359
Right 987571125 5:19660906-19660928 GTTTCAAGCCTGAAAGTGTGTGG 0: 1
1: 0
2: 0
3: 25
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987571125 Original CRISPR GTTTCAAGCCTGAAAGTGTG TGG Intronic
901501706 1:9656467-9656489 GTTTTAAGCCACAAAGTTTGAGG - Intronic
902635318 1:17731305-17731327 GTTTTAAACCTCAAAGTGTTGGG - Intergenic
903223535 1:21882155-21882177 GTTCCAGCCCTGAAAGTCTGTGG - Intronic
904852201 1:33467648-33467670 GCTTCATGCCTGAAACTGCGTGG - Intergenic
905993775 1:42363274-42363296 GTTTCAAGCCACAAAGTTTGTGG + Intergenic
906586718 1:46984758-46984780 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
906778360 1:48550199-48550221 GTTTTAAGCCACTAAGTGTGTGG - Intronic
907309360 1:53530416-53530438 TTTTCAAGCTTGAGACTGTGTGG + Intronic
907932077 1:59009979-59010001 GATTAAAGCCTGAAAGTGAGTGG + Intergenic
908523655 1:64967450-64967472 GTTTTAAGCATGGGAGTGTGTGG - Intergenic
908888167 1:68813880-68813902 GTTTCAAGCCATGAAGTTTGTGG + Intergenic
910556755 1:88542956-88542978 GTTTTAAGCCTCTAAGTTTGTGG + Intergenic
912967098 1:114245751-114245773 GTTTTTAGCATGAAAGGGTGTGG - Intergenic
913113261 1:115674782-115674804 GTTGCAGGCCATAAAGTGTGAGG + Intronic
913570755 1:120117743-120117765 GCTTCAAGCATGACATTGTGAGG - Intergenic
913615133 1:120551450-120551472 TAATCAAGTCTGAAAGTGTGAGG - Intergenic
914291562 1:146278719-146278741 GCTTCAAGCATGACATTGTGAGG - Intergenic
914552606 1:148729502-148729524 GCTTCAAGCATGACATTGTGAGG - Intergenic
914575140 1:148959458-148959480 TAATCAAGTCTGAAAGTGTGAGG + Intronic
916274242 1:162976763-162976785 GTTTTAAGCCTCTAAGTGTGTGG - Intergenic
917839777 1:178968336-178968358 GTTTTAAGCCTCTAAGTCTGTGG + Intergenic
921772474 1:219058305-219058327 TTTTGAAGTCAGAAAGTGTGAGG - Intergenic
921909807 1:220535925-220535947 TTTTGAAGCCAGTAAGTGTGAGG + Intronic
922396761 1:225210050-225210072 GTTTCAAGCACGAAACTGGGTGG + Intronic
923201104 1:231712272-231712294 GTTTTAAGCCTGTAAGTTTGTGG + Intronic
1063290746 10:4744368-4744390 GTTTCAAGCCATGAAGTTTGTGG + Intergenic
1063325093 10:5091295-5091317 GTTTCAAGCCATAACGTTTGTGG - Intronic
1064381061 10:14842221-14842243 GGTGCAAGTCTGAAGGTGTGGGG - Intronic
1065619720 10:27568716-27568738 GTTTCAAGCCACTAAGTCTGTGG - Intergenic
1067361560 10:45585128-45585150 GTTTTAAGCCTCTAAGTTTGTGG + Intronic
1067815332 10:49471239-49471261 TTTCCAAGGCTGAAAGTTTGGGG - Intronic
1069166205 10:65163622-65163644 GTTTCAAGACTGAAAGAGAATGG + Intergenic
1069168684 10:65197221-65197243 TTTTGAAGGCTGAAAGTCTGGGG - Intergenic
1069553808 10:69383520-69383542 GTTTTAAGCCACTAAGTGTGAGG - Intronic
1070307473 10:75248247-75248269 GGTTCAGGCCTGACAGAGTGGGG + Intergenic
1071661986 10:87513769-87513791 GTTTTAAGCCAGTAAGTTTGTGG - Intronic
1072408919 10:95183305-95183327 GTTTCCAGCCTTACAGTGAGGGG + Intergenic
1072708229 10:97697680-97697702 GTTTTAAGCCAGTAAGTTTGCGG - Intergenic
1072741408 10:97912256-97912278 CTTTGAAGCCTGAAAGTGCTGGG - Intronic
1073055724 10:100699837-100699859 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1074028702 10:109663462-109663484 GTTCCAAGCCTGCAAGGGTAGGG - Intergenic
1074536133 10:114329696-114329718 GTATCAGGGCTGAAAGTGAGGGG + Intronic
1074915220 10:117948790-117948812 GTTTCAAGCCACCAAGTCTGTGG + Intergenic
1075078135 10:119365031-119365053 GTTTCAAGCCTGGCAGTTGGAGG + Intronic
1075579361 10:123605224-123605246 CTTTCAAGGCTTAAAGTGTTTGG - Intergenic
1075662470 10:124207602-124207624 GTTTTAAGCCACCAAGTGTGTGG - Intergenic
1075682759 10:124344141-124344163 GTTTCAAGCCAGTACGTTTGTGG - Intergenic
1078841618 11:15080982-15081004 GTTTTAAGCCACAAAGTTTGTGG + Exonic
1080977119 11:37356621-37356643 GTTTCAAGCATAAAACTGGGTGG + Intergenic
1082727410 11:56752675-56752697 GTTTGAAGCCAGGAAGTTTGTGG + Intergenic
1082756111 11:57078237-57078259 GTTTCAACCCTTAGAGTGTTTGG - Intergenic
1082984544 11:59157239-59157261 GTTTCAAGCCACCAAGTTTGGGG + Intergenic
1084651928 11:70494592-70494614 GTTTGAAGACTAAAAGTGTATGG - Intronic
1084672262 11:70614289-70614311 GTTTTAAGCCAGACAGTCTGTGG + Intronic
1084764655 11:71300328-71300350 GTTTCAAGCCTCCGAGTTTGTGG + Intergenic
1085290957 11:75399199-75399221 GTGTCCACCCTGAAAGTGTAGGG + Intergenic
1086421000 11:86637116-86637138 GTTTCAAGACTAACAGTGTGTGG + Intronic
1087695334 11:101369894-101369916 GTTTCAAGCACAAAAATGTGTGG - Intergenic
1089107001 11:116018942-116018964 GTTTTAAGCCTCTAAGTGTTAGG - Intergenic
1089158458 11:116420182-116420204 GTTTTAAGCCTCTAAATGTGTGG - Intergenic
1089850839 11:121495164-121495186 GATTGAAGCCTGGAAGTTTGAGG - Intronic
1090120544 11:124022666-124022688 GTTTTAAGCCAGTAAGTTTGTGG + Intergenic
1090153963 11:124416852-124416874 CTTTTAATCCTGAAACTGTGTGG - Intergenic
1091336906 11:134777733-134777755 TTTTCAAGTCAGGAAGTGTGAGG - Intergenic
1092120529 12:6040616-6040638 GATTCAAACCTGGAAGTGTGAGG + Intronic
1092936639 12:13369955-13369977 TATTAAAGCCTCAAAGTGTGAGG - Intergenic
1094227751 12:28065236-28065258 TTTTGAGGCCTGAAAGTGTCTGG + Intergenic
1095778103 12:46031805-46031827 GTTTCAAGCATAAAACTGGGAGG + Intergenic
1095906913 12:47388075-47388097 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1096312273 12:50531709-50531731 GTTTCAAGCCTGGCCGTGTGAGG + Intronic
1098113314 12:67147392-67147414 GTTTTAAGCCTCTAAGTTTGTGG - Intergenic
1098209357 12:68147241-68147263 GTTTCAAGCCACCAAGTTTGTGG + Intergenic
1100896229 12:99185792-99185814 GTTTCAAGCATAAAATTGGGCGG + Intronic
1101055341 12:100906757-100906779 GATTCAAGGCTGAAGGTGTTTGG + Intronic
1101749576 12:107572394-107572416 GTTTCAAGCCACCAAGTTTGTGG + Intronic
1101873690 12:108584618-108584640 GTGTCAAACCTTAAAGAGTGGGG - Intergenic
1103005212 12:117415448-117415470 GTTTTAAGCCACAAAGTTTGTGG - Intronic
1103119977 12:118372426-118372448 GGTCCAAGACTGAAAGTCTGAGG - Intronic
1103156982 12:118693971-118693993 CTTTAAGGGCTGAAAGTGTGTGG + Intergenic
1103676461 12:122659931-122659953 GTTTTAAGCCACTAAGTGTGTGG - Intergenic
1103931073 12:124451327-124451349 GCTTCAAGCCTCTAAATGTGGGG + Intronic
1104076996 12:125398758-125398780 GTTTTAAGCCTTTAAGTTTGTGG - Intronic
1104502560 12:129300496-129300518 GTTTCAAGCCACTAAGTTTGTGG - Intronic
1104815732 12:131644491-131644513 GTTTTAAGCCTGCAGGGGTGTGG + Intergenic
1105342540 13:19540923-19540945 GTTTTAAGCCACTAAGTGTGAGG - Intergenic
1105552513 13:21410951-21410973 GTTTCAAGCACAAAAGTGGGTGG - Intronic
1105753693 13:23445452-23445474 GTTTCAAACCTCTAAGTTTGGGG - Intergenic
1106336627 13:28789275-28789297 GTTTCAAGCACAAAAGTGGGCGG - Intergenic
1107215824 13:37917329-37917351 GTTTACAGCGTGACAGTGTGAGG - Intergenic
1107474558 13:40722845-40722867 GTTTTAAGCCACTAAGTGTGAGG - Intergenic
1107632541 13:42356666-42356688 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1108502589 13:51081651-51081673 GTTTTAAGCCTTTAAGTCTGTGG + Intergenic
1108890837 13:55257145-55257167 GTTTCCAGCATGAAATTGTCGGG - Intergenic
1109033815 13:57229995-57230017 GTTTCAAGCATAAAACTGGGTGG + Intergenic
1109087982 13:58000627-58000649 GTTTTTAGCATGAAAGGGTGTGG + Intergenic
1110005367 13:70259819-70259841 GTTTCAAGCCACCAAGTTTGTGG - Intergenic
1110337235 13:74346619-74346641 GTTTCAAGCATAAAACTGGGCGG + Intergenic
1112197025 13:97236165-97236187 TTTTCAGTCCTGAAAATGTGAGG - Intronic
1113511796 13:110862272-110862294 TTTTGAAGTCCGAAAGTGTGAGG + Intergenic
1114596024 14:23912395-23912417 GTTTTAAGCCACTAAGTGTGTGG + Intergenic
1118069302 14:62228348-62228370 GTTTAAAGCCATTAAGTGTGTGG - Intergenic
1118421831 14:65614438-65614460 GTTTTAAGCCATAAAGTTTGTGG - Intronic
1118463335 14:66007412-66007434 GTTTCAAGCATCTAAGTTTGGGG - Intergenic
1118546385 14:66894087-66894109 GTTTGAAGTCTGGTAGTGTGAGG - Intronic
1118956314 14:70485134-70485156 TTTTCAAGCCAGGTAGTGTGAGG - Intergenic
1119152025 14:72369444-72369466 GTTTTAAGCCACAAAGTTTGTGG + Intronic
1120045820 14:79804681-79804703 GTTTCAATCCTTATGGTGTGTGG - Intronic
1120837934 14:89057785-89057807 GTTTTATGCCAGCAAGTGTGTGG - Intergenic
1121284138 14:92721484-92721506 GTTTCAAGCCATGAAGTCTGTGG + Intronic
1121555678 14:94834961-94834983 GTTTCAAGCCACCCAGTGTGTGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1124499798 15:30217689-30217711 GTTTTAAGCCTGTATGTTTGGGG - Intergenic
1124642742 15:31406594-31406616 GTTGCAAGCCATTAAGTGTGTGG - Intronic
1124743781 15:32320975-32320997 GTTTTAAGCCTGTATGTTTGGGG + Intergenic
1125219514 15:37317419-37317441 GTTTCAAGCATAAAACTGGGCGG + Intergenic
1128414206 15:67429119-67429141 GTTTTAAGCCAGGAAGTTTGTGG + Intronic
1129062736 15:72873364-72873386 GTTTTAAGCCTCTAAGTGTGTGG + Intergenic
1129466464 15:75727045-75727067 GGTTCAGGCCTGAAAGGGAGTGG - Exonic
1130015379 15:80181971-80181993 GTTTTAAGCCACAAAGTTTGCGG - Intronic
1130077822 15:80704901-80704923 ATTGCAAGCCTGAAAGTGAAAGG + Intronic
1130892321 15:88143472-88143494 GTTTTAAGCCACCAAGTGTGTGG + Intronic
1132282309 15:100630683-100630705 TTTTAAAGCCTGGAAGTGTCTGG + Intronic
1132978798 16:2724160-2724182 CTTTCAAGCATGAAAATGTCTGG - Intergenic
1133546677 16:6814413-6814435 GTGTCAAGCCTGACATTGGGTGG + Intronic
1133659032 16:7896860-7896882 GTTTTAAGCCACAAAGTTTGTGG - Intergenic
1135922304 16:26662186-26662208 GTTTGAAGTCAGATAGTGTGAGG + Intergenic
1138624728 16:58241648-58241670 GTTTTAAGCCACAAAGTTTGTGG - Intronic
1139340104 16:66262865-66262887 GTTTTAAGCCACTAAGTGTGTGG - Intergenic
1140288470 16:73627420-73627442 TTTGCAAGCCGGAAAGTTTGAGG + Intergenic
1140658099 16:77160820-77160842 GTTTCAAAAGTGAAAGTTTGGGG - Intergenic
1141240294 16:82259672-82259694 GTTTTAAGCCAGCAAGTGTGTGG - Intergenic
1143365252 17:6404062-6404084 GTTTTAAGCCAGTAAGTTTGTGG - Intronic
1143427184 17:6849293-6849315 GTTTCAAGCATAAAAGTGGGTGG - Intergenic
1144076333 17:11722890-11722912 GTTCCAAACCTGAAAGTGTTTGG + Intronic
1144103423 17:11964066-11964088 GTTTCAAGCCATCAAGTTTGTGG + Intronic
1144412116 17:15011462-15011484 ATTTCAAGCCTGAAAATTTTAGG - Intergenic
1147626374 17:41903104-41903126 GTGTCAAACTTGAAAGTCTGAGG - Intronic
1148403286 17:47386723-47386745 GTTTCAAGCATAAAACTGGGCGG - Intronic
1149300641 17:55302094-55302116 GTTTAAAGCCTGGAAGAATGGGG + Intronic
1149556113 17:57574574-57574596 GTTTCCAGCCTGGATGTGTCAGG + Intronic
1150345551 17:64402125-64402147 GTTTTAAGCCAGGAAGTGTGTGG - Intronic
1151315732 17:73321182-73321204 ATTACATGCATGAAAGTGTGTGG + Intergenic
1155745531 18:29352467-29352489 GTTTCAAGCCACTAAGTTTGTGG + Intergenic
1156254875 18:35385429-35385451 GTTTCAAGCCACGAAGTTTGTGG - Intergenic
1156838829 18:41587191-41587213 GTTTCATGCCTGAAACTCTATGG - Intergenic
1157994241 18:52536091-52536113 TTTTCAAGCAACAAAGTGTGTGG + Intronic
1159187863 18:65001848-65001870 GTTCCGAACCTGAAAGTGAGAGG - Intergenic
1159193352 18:65078660-65078682 GTTTCATGAGTGAAAGTGTCGGG + Intergenic
1159719850 18:71875016-71875038 TTTACAAGCATAAAAGTGTGTGG + Intergenic
1160053737 18:75460383-75460405 GTTTCAAGTCTGTAGGTTTGTGG + Intergenic
1161835149 19:6640876-6640898 GTTTTAAGCCATTAAGTGTGTGG - Intergenic
1164966392 19:32488620-32488642 GTTTCAAGCTGCAAAGTTTGTGG - Intergenic
1167767447 19:51492886-51492908 GTTTGAAGCCAGGAAATGTGTGG + Intronic
925118187 2:1398013-1398035 GTTGCATGCCTGAAAATGTGCGG - Intronic
927140937 2:20130312-20130334 GTTTCGAACCTGTAAGTCTGTGG - Intergenic
929138869 2:38650074-38650096 GTTTCCTGCCTGAAAGGCTGAGG + Intergenic
929365877 2:41156195-41156217 GTTTTCATCCAGAAAGTGTGTGG + Intergenic
930160369 2:48149233-48149255 GTTTCAAGCCAGTAAGTTTTTGG - Intergenic
930323295 2:49882233-49882255 GTTTCAAGCATAAAACTGCGTGG + Intergenic
931066469 2:58593587-58593609 GTTTCAAGCCAGAAGGTGCTGGG + Intergenic
931800209 2:65750673-65750695 GTTTCAACCCACTAAGTGTGTGG - Intergenic
933352155 2:81167859-81167881 GTGTTAAGCCTCTAAGTGTGTGG - Intergenic
933595141 2:84275757-84275779 GTTGCAAGAATGAAAGTGTATGG - Intergenic
934871416 2:97869820-97869842 GCTTTAAGCCTCAAAGTTTGTGG - Intronic
935019196 2:99214061-99214083 GGTTGAAGCCTGAGATTGTGGGG - Intronic
935567989 2:104629799-104629821 GTTTCAAGCATAAAACTGAGGGG - Intergenic
936801714 2:116276998-116277020 GTTTTAAACCTGGCAGTGTGGGG + Intergenic
937562682 2:123244808-123244830 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
938421094 2:131147465-131147487 GATTTAAGCCTGAGAGTTTGAGG + Exonic
938637941 2:133249492-133249514 GTCTCAAGCCAGTAAGTTTGTGG + Intronic
939652766 2:144785327-144785349 GTTTCAAGCATAAAACTGGGCGG + Intergenic
941468492 2:165857318-165857340 GTTTGAAGCCTCAAGGTTTGTGG + Intergenic
944922382 2:204428997-204429019 GTTTTAAGCCAGTAAGTTTGTGG + Intergenic
946697131 2:222371314-222371336 GTTTCAGGACTGAAAGACTGGGG - Intergenic
947154359 2:227146553-227146575 GTTTTAAGCCTCTGAGTGTGTGG - Intronic
1168815731 20:735471-735493 GTTTTAAGCCTCTCAGTGTGTGG + Intergenic
1169442114 20:5641247-5641269 GTTTCAAGCCACTAAGTTTGGGG - Intergenic
1169594252 20:7179949-7179971 GGCTCAAGCATGAGAGTGTGTGG - Intergenic
1170294195 20:14806489-14806511 GTTTCAAGCCCTAAACTGGGCGG + Intronic
1170873867 20:20232993-20233015 GTGTCTAGGCTGAAAGTCTGAGG - Intronic
1171513440 20:25706795-25706817 GTTTCAAGCATAAAACTGGGCGG - Intergenic
1172923030 20:38503067-38503089 GCTTCAAGCCTACAAGTGTCTGG + Intronic
1173009860 20:39172153-39172175 GTTTCAATCCCGAAATTTTGGGG + Intergenic
1173127805 20:40356119-40356141 GTTTTAAGCCACTAAGTGTGTGG + Intergenic
1174990180 20:55500665-55500687 GTTTCAAGCACAAAACTGTGTGG - Intergenic
1177710038 21:24762332-24762354 GCTTTAAGCCACAAAGTGTGTGG - Intergenic
1179016137 21:37595747-37595769 ATTTGAAGCCTTGAAGTGTGGGG + Intergenic
1179385165 21:40934462-40934484 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1180557814 22:16591939-16591961 GCTTCAAGCCTGAGCGTGTTGGG - Exonic
1183146083 22:35993640-35993662 GTTTGAAGCCAGTAAGTGTAGGG + Intronic
1183281138 22:36933366-36933388 ATTTCTAGACTGAAGGTGTGGGG - Intronic
1183973801 22:41498384-41498406 GTTTTAAGCCTTTAAGTTTGGGG - Intronic
1184464870 22:44662937-44662959 GTTTTAAGCCTCTAAGTTTGTGG - Intergenic
949350363 3:3119469-3119491 GTTTTAAGCCTTGAAGTCTGTGG + Intronic
949583327 3:5412570-5412592 GTTTCAAGCATAAAACTGGGCGG + Intergenic
949594628 3:5531065-5531087 GTTTCAAGCATAAAACTGGGCGG - Intergenic
951350146 3:21596923-21596945 TTTTCAGGCCTGAAAGTGAAGGG - Intronic
952756738 3:36875595-36875617 GTTTCAAGCCACTAAGTGTATGG + Intronic
953392749 3:42543371-42543393 CTGTCAAGCCTGGAAGAGTGAGG - Intergenic
955151664 3:56373557-56373579 GTTTCCAGCATGAAATTGGGAGG - Intronic
955251782 3:57290110-57290132 GTTTTAAGCCACTAAGTGTGTGG - Intronic
955648488 3:61166846-61166868 CTTTCCATCCTGGAAGTGTGAGG + Intronic
959074512 3:101735748-101735770 GTTTCAAGCACAAAAGTGGGTGG + Intronic
959345618 3:105191266-105191288 GTTTCAAGCATGAAATTGGATGG - Intergenic
959848041 3:111056707-111056729 GTTTCAAGCCCAAAACTGGGCGG + Intergenic
959881240 3:111447204-111447226 GTTTCAAGCATAAAACTGGGGGG - Intronic
960666869 3:120117778-120117800 GTTTCCGGCCTGAAAGTCAGAGG - Intergenic
962051100 3:131816543-131816565 GTTTCAATCCTAAAAGTGGTGGG - Intronic
962930028 3:140027537-140027559 GTTTCAAGCCTCCCAGTTTGTGG + Intronic
962979392 3:140474085-140474107 GTTTTAAGCCACAAAGTTTGTGG + Intronic
963246883 3:143072019-143072041 GTTTCAAGCCATTAAGTTTGTGG - Intergenic
963481472 3:145879786-145879808 GTTTCAAGCACAAAAGTGGGAGG - Intergenic
964875687 3:161366063-161366085 GTTTGAAGAGTGAAAGTGTTGGG - Intronic
965346860 3:167561818-167561840 GATTCAAACCTGTAAGTTTGGGG - Intronic
966083087 3:176029691-176029713 TTTTTAAGCCAGAAAGTTTGTGG - Intergenic
966572499 3:181461317-181461339 GTTTTAAGCCAGTAAGTTTGTGG - Intergenic
967714473 3:192746786-192746808 GCTTGAAGCCTAAAAGGGTGGGG - Intronic
968700254 4:2053142-2053164 TTTTACAGCCTGAAAATGTGAGG - Intergenic
969397607 4:6932843-6932865 GTTTCAAGCCACCAAATGTGTGG - Intronic
969461154 4:7329662-7329684 GTCTCAAGCCAGTAAGTTTGCGG - Intronic
969964777 4:10982995-10983017 GTCCCCAGGCTGAAAGTGTGGGG + Intergenic
970354147 4:15235749-15235771 GTTTGGAGCCTCAAAGTCTGGGG + Intergenic
970679331 4:18489215-18489237 GTTTCAAGCACAAAACTGTGCGG + Intergenic
971969609 4:33604666-33604688 GTGTCAAGCCTGCAGGTGTGCGG - Intergenic
972430480 4:38976610-38976632 GTTTTAAGCCACTAAGTGTGTGG + Intronic
972733257 4:41815519-41815541 TGCTCAAGCTTGAAAGTGTGGGG - Intergenic
973562609 4:52151549-52151571 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
974332604 4:60499476-60499498 GTTTCAAGCCACCAAGTTTGTGG - Intergenic
975190464 4:71454776-71454798 GTTTCAAGCCTCTAAGTTTTGGG - Intronic
975785185 4:77880111-77880133 GTTTTAAGCCTCAAAGTTTGTGG - Intronic
976196594 4:82537938-82537960 GTTTTAAGCCACAAAGTCTGTGG + Intronic
976903556 4:90208594-90208616 GTTTCAAGCATAAAACTGGGTGG - Intronic
977302930 4:95288528-95288550 GTTTTAAGCCAGGAAGTTTGTGG - Intronic
977533191 4:98224677-98224699 GTTTTAAGCCAGTAAGTCTGTGG + Intergenic
977706831 4:100080864-100080886 GATTAAAGGCTGTAAGTGTGGGG + Intergenic
977724491 4:100279734-100279756 GTTTCATGCCAGTAAGTCTGGGG - Intergenic
977986133 4:103385445-103385467 GTTTCAAGCCTAAAACTGGGTGG + Intergenic
977994416 4:103484785-103484807 GTTTCAAGACTAAAACTGGGTGG + Intergenic
978144725 4:105359049-105359071 GTTTCAAACATGGAAGTGAGAGG + Intergenic
979502736 4:121458580-121458602 GTTTTAAGCCACTAAGTGTGTGG + Intergenic
980148712 4:129021275-129021297 GTTTCAAGCACAAAACTGTGTGG + Intronic
980537447 4:134146899-134146921 GTTTAAAGCCTGAAAAACTGAGG - Intergenic
980795742 4:137680322-137680344 GTTTTAAGCCATCAAGTGTGTGG + Intergenic
980832812 4:138152295-138152317 GTTTTAAGCCACTAAGTGTGTGG + Intergenic
981434218 4:144700819-144700841 ATTTCAAGCCACAAAGTTTGTGG + Intronic
984354164 4:178637031-178637053 GTTTCAAGCCCAAAACTGGGCGG + Intergenic
986086000 5:4447640-4447662 GTTTTAAGCCTCTAAGTTTGTGG + Intergenic
986091075 5:4507440-4507462 GTTTCAAGCCACTAAGTTTGTGG + Intergenic
986296916 5:6446885-6446907 GTTTCAGGCCTGAAAGGTTTGGG - Intergenic
986541299 5:8847025-8847047 GTTTTAAGCCTCCAAGTGTGTGG - Intergenic
986808742 5:11333593-11333615 GTTTCCAGCCTTTAAGTTTGTGG - Intronic
987571125 5:19660906-19660928 GTTTCAAGCCTGAAAGTGTGTGG + Intronic
987651906 5:20752172-20752194 GTTTTAAGCCACAAAGTTTGTGG - Intergenic
988713655 5:33803416-33803438 GTTACATGCCTTGAAGTGTGGGG + Intronic
988743657 5:34109306-34109328 GTTTTAAGCCACAAAGTTTGTGG + Intronic
988970749 5:36465285-36465307 GTTTCAAGCATAAAACTGGGCGG + Intergenic
991256048 5:64616200-64616222 CTCTCAAGGCTGAAAGTGTTTGG + Intergenic
992072114 5:73157786-73157808 GTTTTAAGCCTCTAAGTGTGTGG + Intergenic
993483255 5:88450734-88450756 GTTTTAAGCCAGTAAATGTGTGG - Intergenic
993784668 5:92114994-92115016 CTTTCAAGGGGGAAAGTGTGAGG - Intergenic
995576463 5:113541019-113541041 GTTTCAAGCCTGAATCTCAGAGG + Exonic
995795094 5:115932608-115932630 GTTTTAAGCCTGTAAGTTTATGG + Intergenic
995811183 5:116108785-116108807 GTTTCAAGCATAAAACTGGGTGG - Intronic
996817677 5:127591780-127591802 GGTACAAGCCTGAATGTGTGTGG + Intergenic
996891159 5:128422209-128422231 GTTTTAAGCCACAAAGTTTGTGG + Intronic
1000657978 5:163904956-163904978 GTTTCAAGCCACCAACTGTGTGG + Intergenic
1001776656 5:174334024-174334046 GTTTCAAGCCACTAAGTGTTGGG - Intergenic
1001847077 5:174931721-174931743 TTTTTAAGCCTGAAAATCTGAGG + Intergenic
1003306976 6:4937998-4938020 GTTTAAACCCTGCAAGTGTTCGG + Intronic
1003367639 6:5490999-5491021 GTTTTAAGCTTCAAAGTTTGGGG + Intronic
1003765229 6:9229221-9229243 GTTTTAAGCCTTTAAGTTTGTGG - Intergenic
1004202206 6:13559330-13559352 GCTTCAAAACTGAATGTGTGTGG + Intergenic
1004364131 6:14997890-14997912 GTTTTAAGCCACAGAGTGTGTGG - Intergenic
1005048935 6:21666250-21666272 GTTTCGAGCCTGGCAGTGGGAGG + Intergenic
1005378237 6:25207284-25207306 GTTTCAAGCCCAAAATTGGGTGG + Intergenic
1006917058 6:37601543-37601565 GATTCCAGACTGAAAGTCTGTGG - Intergenic
1008878815 6:56359554-56359576 ATTTCAAACCTGAAAATATGAGG + Intronic
1010082584 6:71881533-71881555 GTTTTAAGCCACACAGTGTGGGG - Intergenic
1010349310 6:74853171-74853193 ATTTCTAGCCTTAAAGTGTCAGG - Intergenic
1010522097 6:76850056-76850078 GTTTCAAGCATAAAACTGGGCGG - Intergenic
1011575349 6:88791443-88791465 GTTTTAAGCCATCAAGTGTGTGG + Intronic
1012209987 6:96508060-96508082 GTTTTAAGCCACCAAGTGTGTGG - Intergenic
1013287385 6:108693052-108693074 GTTTTAAGCCTCTAAGTTTGTGG + Intergenic
1014189249 6:118474061-118474083 GCTTCTAGCATGACAGTGTGAGG + Intronic
1015394986 6:132723199-132723221 GTTTCAAGTCTGAAAGTAGAGGG + Intronic
1017955419 6:159173698-159173720 GTTTCAAGTCATTAAGTGTGTGG - Intronic
1018100891 6:160438738-160438760 GTTTCAAGCCGGTGAGTTTGTGG - Intronic
1019756964 7:2777744-2777766 TTTTCAAGCCACACAGTGTGTGG + Intronic
1019798462 7:3070001-3070023 GTTTCAAGCCACCAAGTTTGTGG - Intergenic
1020358317 7:7301397-7301419 GTTTCAAGCACAAAACTGTGTGG - Intergenic
1020509336 7:9033410-9033432 CTTTCAAGCCTGAATGTAAGTGG - Intergenic
1022634449 7:32118979-32119001 GTATCAAGCCAGATAATGTGTGG + Intronic
1023284191 7:38602321-38602343 GTTTCCAGCCACAAAGTTTGTGG - Intronic
1023551562 7:41375322-41375344 GTTTCAAGGCTGAAGGAGAGGGG + Intergenic
1024052010 7:45630382-45630404 GTTTCAAGCCACCAAGTTTGTGG - Intronic
1024614448 7:51098343-51098365 TTTTGAAACCAGAAAGTGTGAGG - Intronic
1024800343 7:53070173-53070195 GTTTCAAGCCACTAAGTCTGAGG + Intergenic
1024814558 7:53253958-53253980 GTTGCAAGCCAGAAAATGTTGGG - Intergenic
1025173140 7:56779675-56779697 CTTCTAAGCCTGAAGGTGTGAGG - Intergenic
1025698967 7:63798501-63798523 CTTCTAAGCCTGAAGGTGTGAGG + Intergenic
1025990111 7:66491271-66491293 GTTTTAAGCCACTAAGTGTGTGG + Intergenic
1026038631 7:66847300-66847322 GTTTTAAGCCACTAAGTGTGTGG - Intergenic
1026146079 7:67747904-67747926 GTCTTAAGCTTCAAAGTGTGTGG + Intergenic
1027212753 7:76164251-76164273 GTTTTAAGCCACTAAGTGTGTGG + Intergenic
1027552728 7:79619192-79619214 GTTTTAAGCCACAAAGTCTGTGG + Intergenic
1028367516 7:90050841-90050863 GTTTTAAGCCCCAAAGTTTGTGG + Intergenic
1028953552 7:96664159-96664181 GTTTCAAGCCAGCAGGTTTGTGG - Intronic
1030629128 7:111875847-111875869 GTTTTAAGCCAGTAAGTTTGTGG + Intronic
1031440483 7:121788636-121788658 GTTTTAAGCCTTTAAGTTTGTGG - Intergenic
1033189675 7:139265920-139265942 TTTTCAAGCCAAAAAGTTTGTGG + Intronic
1034619501 7:152446066-152446088 GCTTCAAGCCTGAGCGTGTTGGG + Intergenic
1034756203 7:153622800-153622822 GTTTTGAGCCTGTAAGTTTGTGG - Intergenic
1035321290 7:158030809-158030831 GTTCTAAGCCTGCCAGTGTGCGG + Intronic
1035550649 8:521647-521669 TTTTCAAGTTGGAAAGTGTGAGG + Intronic
1037425420 8:18750065-18750087 GTTTCAAGCCACTAAGTTTGTGG + Intronic
1037626006 8:20607725-20607747 GTTTCAAGCATAAAACTGGGTGG - Intergenic
1038966575 8:32579751-32579773 GCTTTAAGCCTCAAAGTTTGTGG - Intronic
1039239415 8:35538852-35538874 GTTTGAAGCATAAAAGTTTGAGG + Intronic
1039902250 8:41761604-41761626 GTGTCAAGCCACTAAGTGTGTGG + Intronic
1040557433 8:48493326-48493348 GTTTTAAGCCACAAAGTATGTGG + Intergenic
1040916087 8:52567134-52567156 TTTTCAAGCCTGACAGTTTGGGG + Intergenic
1041417673 8:57630249-57630271 GTTTGAAGCCACCAAGTGTGTGG + Intergenic
1041455306 8:58052734-58052756 GTTATAAGCCTGATAGAGTGTGG + Intronic
1041571032 8:59337045-59337067 GTTTTAAGCCACCAAGTGTGTGG + Intergenic
1041699367 8:60771526-60771548 GTTTTAAGCCATAAAGTTTGTGG - Intronic
1042382048 8:68128380-68128402 GTTTTATGCCAGAAAGTTTGGGG - Intronic
1042479530 8:69287813-69287835 GTTTTAAGCCTCCAAGTTTGTGG - Intergenic
1043565075 8:81538727-81538749 GTTTTAAGCCTCTAAGTTTGTGG + Intergenic
1043645731 8:82516422-82516444 GTTTGAAGCCTCTAAGTCTGTGG - Intergenic
1044846082 8:96383219-96383241 GTTTTAAGCCTCTAAGTTTGTGG - Intergenic
1044940296 8:97335229-97335251 GTTTCAAGCATGAAACTGGGTGG - Intergenic
1045176935 8:99735652-99735674 GTTTTAAGCCAGTAAGTGTGTGG + Intronic
1045250052 8:100475546-100475568 GTTTTAAGCCACAAAGTCTGTGG + Intergenic
1045412592 8:101933535-101933557 GTTTGAAGCCTCTAAGTTTGTGG + Intronic
1045869863 8:106913296-106913318 GTTTAAAGCCTCTAAGTTTGGGG - Intergenic
1046266290 8:111835222-111835244 GTTTTAAGCCACTAAGTGTGAGG + Intergenic
1046628942 8:116604373-116604395 GTTTTAAGCCAGTAAGTCTGGGG + Intergenic
1046631196 8:116624660-116624682 GTTTGAAGCCTCTAAGTCTGTGG - Intergenic
1046711753 8:117518646-117518668 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1047195371 8:122716137-122716159 GTTTTAAGCCTCTAAGTTTGTGG + Intergenic
1047640454 8:126814519-126814541 GTTTTAAGCCAGCAAGTTTGTGG - Intergenic
1047821359 8:128524868-128524890 GTTACCAGCCTGAAAATGTGTGG - Intergenic
1048378539 8:133844094-133844116 TTTTCTAGTCTGCAAGTGTGAGG + Intergenic
1049534601 8:143172651-143172673 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1049712044 8:144069274-144069296 GTTTTAAACCTGCAAGTCTGTGG - Intergenic
1050125513 9:2352829-2352851 GTTTCAAGCCACTAAGTTTGTGG - Intergenic
1050654212 9:7807913-7807935 GTTTCAAGCCACCAAGTTTGTGG + Intronic
1050794012 9:9513963-9513985 GTTTCAGGCCAGAAAGGCTGTGG + Intronic
1050817753 9:9836924-9836946 CTTTCAAGATTGAATGTGTGGGG + Intronic
1051137569 9:13939802-13939824 GTTGCAGGTGTGAAAGTGTGTGG + Intergenic
1051317585 9:15858333-15858355 TTTTGAAGTCAGAAAGTGTGAGG + Intronic
1051543595 9:18249118-18249140 GTTTCGTGTCTGAAAGTGAGGGG - Intergenic
1052052845 9:23867260-23867282 GTTTTAAGCCAGAAAGTTTATGG - Intergenic
1055519848 9:77069981-77070003 GTTTTAAGCCAAAAAGTCTGTGG + Intergenic
1056271139 9:84949100-84949122 GAGTCAAGGCTGAAAGGGTGGGG + Intronic
1056456252 9:86763824-86763846 GTTTCAAGCCAGCCAGTTTGAGG + Intergenic
1056493902 9:87136702-87136724 GTTTTATGCCAGAAAGTCTGTGG + Intergenic
1057195696 9:93114772-93114794 GGTTCCAGCCTCAAAGGGTGGGG - Intergenic
1057533339 9:95874846-95874868 GTTTCAAGCTACAAAGTTTGTGG + Intergenic
1057558511 9:96108566-96108588 GTTTCTAGCATGACAGTATGAGG - Exonic
1057665698 9:97043809-97043831 GTTTCAAGCCACCAAGTTTGTGG - Intergenic
1057744970 9:97743959-97743981 GTTTCAAGCCACCAAGTTTGTGG + Intergenic
1058964212 9:110021414-110021436 GTTTTAAGCCACCAAGTGTGTGG + Intronic
1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG + Intronic
1061661425 9:132132746-132132768 GTTTCAAGCCACTAAGTGTATGG - Intergenic
1062185691 9:135217165-135217187 TTTACAAGCCTGGAAGTGTAGGG - Intergenic
1186148972 X:6654218-6654240 GTTTTAAGCCTCAATGTTTGTGG + Intergenic
1186370429 X:8940972-8940994 GTCTCAAGGCAGAGAGTGTGAGG + Intergenic
1187307872 X:18113513-18113535 GTTTCAACTCTGTAAGTGTGAGG + Intergenic
1188408605 X:29843505-29843527 GTTTTAAGCCTCTAAGTCTGTGG - Intronic
1188446305 X:30256494-30256516 GTTACCAGCCTGAAATTGTAGGG + Intergenic
1189395316 X:40617374-40617396 GTTTTAAGCCTCTAAGTTTGGGG - Intergenic
1190315847 X:49150390-49150412 GTTTCAAGCCAGTAAATGTATGG - Intergenic
1190544261 X:51508832-51508854 GTTTTAAGCCACTAAGTGTGTGG - Intergenic
1191005033 X:55702472-55702494 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
1191135448 X:57059040-57059062 GTTTCAAGCTTGAAACTGGGTGG - Intergenic
1191657413 X:63613518-63613540 GTTTCAAGCATAAAACTGGGTGG + Intergenic
1191766767 X:64706170-64706192 GTCTCAAGCATGAAACTGGGTGG - Intergenic
1191809964 X:65175939-65175961 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
1192977322 X:76300117-76300139 GTTTCAAGCACAAAACTGTGCGG - Intergenic
1193034439 X:76934277-76934299 GTTTCAAGCATAAAACTGGGTGG + Intergenic
1193398538 X:81014224-81014246 GTTTCAAGCATAAAACTGGGCGG + Intergenic
1194315330 X:92369602-92369624 GTTTCAAGCCAAAAATTGGGTGG - Intronic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1194419886 X:93660761-93660783 GTTTCAAGCACAAAAGTGGGCGG + Intergenic
1194963966 X:100266878-100266900 GTTTCAAGCACGAAACTGTATGG + Intergenic
1196078684 X:111606994-111607016 GTTTTAAGCCTCGAAGTTTGTGG - Intergenic
1196408000 X:115385918-115385940 GTTTTAAGCCACAAAGTTTGTGG + Intergenic
1197798770 X:130327721-130327743 GTTTCAAGTCTCAAGGTCTGAGG + Intergenic
1197805344 X:130393421-130393443 GTTTTAAGCCACAAAGTTTGGGG + Intergenic
1197847013 X:130813799-130813821 ATTTCAAGCATAAAAGTGGGCGG + Intronic
1199293429 X:146130774-146130796 GTTTTAAGCCATTAAGTGTGTGG + Intergenic
1199903687 X:152203519-152203541 GTTTGAAGCCAACAAGTGTGGGG - Intronic
1200623379 Y:5481137-5481159 GTTTCAAGCCAAAAATTGGGTGG - Intronic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1200797897 Y:7358532-7358554 TTTTCATGCCTGAAAGTATCTGG + Intergenic
1201500893 Y:14641573-14641595 GTTTCAAGTCAGCAAGTTTGTGG + Intronic
1202096327 Y:21251407-21251429 GTTTCAAGCATAAAACTGGGTGG - Intergenic
1202342285 Y:23882380-23882402 ATTTCAAGCATGAAACTGGGTGG - Intergenic
1202528484 Y:25787705-25787727 ATTTCAAGCATGAAACTGGGTGG + Intergenic
1202589801 Y:26470744-26470766 GTTTTAAGCCACGAAGTGTGAGG + Intergenic