ID: 987576464

View in Genome Browser
Species Human (GRCh38)
Location 5:19734654-19734676
Sequence ATGTTCTCCTTTAATGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987576460_987576464 18 Left 987576460 5:19734613-19734635 CCAGGTGTCTTGTATTTACAAGG 0: 1
1: 0
2: 1
3: 16
4: 120
Right 987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG 0: 1
1: 0
2: 0
3: 31
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987576464 Original CRISPR ATGTTCTCCTTTAATGTTTA GGG Intronic
904191086 1:28744309-28744331 ATCTTCTGCTTTAATTTCTATGG - Intronic
906447255 1:45913020-45913042 ATTTCATCCATTAATGTTTAAGG - Intronic
907902490 1:58753662-58753684 GTCTTCTCCTTTGATGTTGAGGG + Intergenic
909279439 1:73730347-73730369 TTGTTCTACTCTATTGTTTAGGG + Intergenic
909338877 1:74509502-74509524 AAATTGTCCTTTATTGTTTAGGG + Intronic
909357314 1:74724958-74724980 CTGATCTCATTTCATGTTTAAGG + Intronic
909483827 1:76152675-76152697 ATTTTCTATTTAAATGTTTACGG - Intronic
910007359 1:82414974-82414996 ATGTTCTCCATGGATGTTTTTGG + Intergenic
910568346 1:88671694-88671716 TTGTTATACTATAATGTTTAGGG - Intergenic
911224489 1:95290220-95290242 AAGTACTCCATAAATGTTTATGG + Intergenic
912080039 1:105924958-105924980 GTGTTCACCTTTTTTGTTTAAGG - Intergenic
912093507 1:106112168-106112190 ACGTTCTCTTTTACAGTTTATGG + Intergenic
912621896 1:111169062-111169084 TTGTTATACTATAATGTTTAGGG + Intronic
913008487 1:114659075-114659097 ATATTTTTCTTTAATGTTTCAGG + Intronic
913465465 1:119137638-119137660 ATGTTCTGTTTAAATGTTGATGG - Intronic
913617022 1:120571043-120571065 ATCTTCTCATTTTATGTATATGG + Intergenic
913707677 1:121443288-121443310 CTCTTTTCTTTTAATGTTTATGG + Intergenic
914495296 1:148191176-148191198 ATTTTGTCCTTCAATTTTTAAGG - Intergenic
914573254 1:148939872-148939894 ATCTTCTCATTTTATGTATATGG - Intronic
915759238 1:158294042-158294064 ATTTTCTCCTTAAACATTTAAGG + Intergenic
918675680 1:187282217-187282239 ATGATCTCCTTTCTTTTTTATGG - Intergenic
921037987 1:211400726-211400748 CTTTTTTCCTTTAATGTGTATGG - Intergenic
921186036 1:212670278-212670300 TTGTTATACTTTATTGTTTAGGG - Intergenic
921210282 1:212890253-212890275 CTGTTATACTATAATGTTTAGGG - Intronic
921536603 1:216357010-216357032 ATATTTTCCTTTAGTGTTTCTGG + Intronic
922010310 1:221577028-221577050 ATGCTTTCCTTTAATTATTAGGG - Intergenic
922052858 1:222010900-222010922 ATGGTATCCTTGAATATTTAGGG - Intergenic
922382806 1:225049647-225049669 ATTTTCTCCTTGAAGATTTATGG + Intronic
923453882 1:234145636-234145658 ATGTTGTACTGTATTGTTTAGGG - Intronic
923747413 1:236715168-236715190 TTATTCTACTTTAAGGTTTAGGG + Intronic
923847286 1:237748882-237748904 TTGTTCTGCTGTATTGTTTAGGG - Intronic
924079459 1:240378847-240378869 ATGTTTTTCTTTAATATTTGAGG + Intronic
924114636 1:240733138-240733160 ATGTTCTCTCTGAATATTTAAGG - Intergenic
1063040793 10:2335325-2335347 TTATTCACCTTTAATGTTAAAGG - Intergenic
1065664900 10:28048479-28048501 TTGTTCTTCCTTAATGTTTTTGG - Intergenic
1065758120 10:28953590-28953612 ATGTTCTCAGTTCTTGTTTAGGG + Intergenic
1066211018 10:33238337-33238359 AACTTCTCCTTAAATGTTTGAGG - Intronic
1066305245 10:34133991-34134013 CTGTTCACCTTTAATGTTCCAGG - Intronic
1066661743 10:37743113-37743135 ATGTCCTCAATAAATGTTTACGG - Intergenic
1068036104 10:51761718-51761740 AAATTTTTCTTTAATGTTTAGGG - Intronic
1068107608 10:52638565-52638587 ATCTTTTCCTTTTATTTTTAAGG + Intergenic
1068877627 10:62013821-62013843 ATTTTCTCTTTTAATTTTTATGG + Intronic
1068933322 10:62613128-62613150 ATGTTCACTTTTAAGGTTTGTGG - Intronic
1069303180 10:66934262-66934284 ATGTTTTCTTTTTATTTTTAAGG + Intronic
1070033635 10:72700872-72700894 ATTTTCCACTTTATTGTTTAGGG + Intronic
1071138122 10:82475574-82475596 ATTTTCTCATTTAATGGTTTTGG - Intronic
1071219543 10:83448089-83448111 ATATTGTTCTTGAATGTTTATGG + Intergenic
1071456482 10:85855186-85855208 ATTTTCTCCTTTAGTCTTTGTGG - Intronic
1071731296 10:88251484-88251506 AGGTTCTCATTTAATCTCTATGG + Intergenic
1071864291 10:89709145-89709167 TTTTTCTCCTTTATTTTTTAAGG + Exonic
1074035295 10:109732654-109732676 ATGTTTGCCTTTAATCGTTAGGG - Intergenic
1074104724 10:110380575-110380597 ATGTACTCCATTTATTTTTATGG + Intergenic
1075190812 10:120306798-120306820 TTGTTATACTTTATTGTTTAGGG - Intergenic
1075508583 10:123049054-123049076 ATGTACTTCATAAATGTTTATGG - Intronic
1078324882 11:10371388-10371410 ATGTTCTCCTTTAATAACTTAGG - Intronic
1078702999 11:13707663-13707685 AATTTCTACTTTAATTTTTAAGG + Intronic
1079018618 11:16890308-16890330 ATTTACTCCATTTATGTTTAAGG - Intronic
1079428751 11:20368264-20368286 ATATGCTCCCTTAATGTTTCAGG - Intronic
1079521765 11:21336163-21336185 AGGTTCTAGTTTAATGTCTAAGG - Intronic
1079850388 11:25526216-25526238 TTTTTCTCCTTTAAGGGTTAGGG - Intergenic
1079984509 11:27186669-27186691 ATTTTCTTCTAAAATGTTTAAGG + Intergenic
1080080497 11:28212661-28212683 TTGTTATACTTTATTGTTTAGGG + Intronic
1082180745 11:49116179-49116201 ATGCTCTTCTTTATTGTTTTTGG - Intergenic
1082641556 11:55667234-55667256 ATGTTCTCCTTTGATAAGTAAGG + Intergenic
1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG + Intronic
1083034336 11:59622814-59622836 TTGTTATCCTATATTGTTTAGGG + Intergenic
1083375871 11:62220541-62220563 ATATTTTCATTTAATGTCTAGGG - Intergenic
1084843543 11:71879248-71879270 ATGATATCATTTAATGTATATGG + Intronic
1086302848 11:85447710-85447732 AATTTTTACTTTAATGTTTAGGG - Intronic
1086881007 11:92153137-92153159 ATGTTTTCCAGTAATGTCTATGG - Intergenic
1086964243 11:93011193-93011215 TTGTTCTCCTTAAATGCTTTGGG - Intergenic
1087588253 11:100150405-100150427 ATTTTTTTCTTTAATGTGTATGG + Intronic
1088696343 11:112369455-112369477 ATGATCTCATTTAATCTTCATGG + Intergenic
1088972054 11:114782117-114782139 CTGTTATCCTCTAATGTTTTGGG + Intergenic
1090180942 11:124698900-124698922 AAGTTCTCTTTTAAACTTTATGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090420890 11:126574179-126574201 GTGTCCTCCATAAATGTTTAGGG - Intronic
1090552156 11:127832871-127832893 TTATTATCCTTTAATGTCTATGG - Intergenic
1091946264 12:4546873-4546895 ATTTTCTCCTTTGATTTTTCTGG + Intronic
1095545415 12:43362462-43362484 ATGTTCTCATTCAATCTTTGAGG - Intronic
1096361058 12:50987442-50987464 ATGTTCTCGTGAAATGTTGAGGG - Exonic
1097097984 12:56565145-56565167 ATGTTATACTGTATTGTTTAGGG + Intronic
1098621223 12:72602107-72602129 TTGTTCTGCTTTGATTTTTAAGG + Intronic
1098759960 12:74410947-74410969 ATGTCCTCCTTTAACTTTTTAGG - Intergenic
1098925676 12:76347862-76347884 ATATTCTCATTTTATGCTTATGG - Intronic
1099000197 12:77170390-77170412 ATTTCCTTATTTAATGTTTACGG + Intergenic
1099428788 12:82555574-82555596 ATGTTCACATTTAATGTTAGAGG + Intergenic
1099442853 12:82718743-82718765 ATGTTTTACTTTTATGTTTGTGG + Intronic
1099963111 12:89415756-89415778 ATTTTCACCTTTTATGGTTAAGG + Intergenic
1100071554 12:90726239-90726261 ATGTTCTGCTTTCCTGTCTAGGG - Intergenic
1100359927 12:93867328-93867350 ATGTTTTCCTGTACTTTTTATGG - Intronic
1101066407 12:101026774-101026796 ATTTTCTCCTAGAATTTTTATGG - Intronic
1102030885 12:109739537-109739559 TTGCGCTCCTTGAATGTTTATGG + Intronic
1102736581 12:115166662-115166684 ATCCTCTGTTTTAATGTTTATGG + Intergenic
1103069041 12:117925486-117925508 ATCTTCTCCTTTAAAGAGTAAGG - Intronic
1104793719 12:131500979-131501001 TTGTTATACTTTATTGTTTAGGG - Intergenic
1105253034 13:18717960-18717982 ATGTTCTCCTATAACATTAAAGG + Intergenic
1105798983 13:23886802-23886824 ATGATCTCATTTAATCTTTGCGG - Intronic
1106683117 13:32028610-32028632 ATGTTCTCCTAATATTTTTAAGG + Intergenic
1107211862 13:37868304-37868326 ACATCCTCCTTAAATGTTTAAGG - Intronic
1107921578 13:45213539-45213561 TTATTCTTCTTTAATGTTTTGGG + Intronic
1108643358 13:52403898-52403920 ATGTACTTTCTTAATGTTTAAGG + Intronic
1109621241 13:64909122-64909144 ATATTTTCCTTCAATGTTTGTGG + Intergenic
1110189349 13:72713548-72713570 TTGTTATCCTGTATTGTTTAGGG + Intronic
1110286343 13:73754074-73754096 ATGTTTTCCTTTAATGCTCCTGG + Intronic
1112205946 13:97323463-97323485 CTGTTATACTTTACTGTTTAGGG - Intronic
1112551384 13:100424117-100424139 TTGTTATCCTCTATTGTTTAGGG - Intronic
1112749735 13:102569909-102569931 AGGTACTCCATAAATGTTTATGG - Intergenic
1113084133 13:106550073-106550095 AAGTTTTCCTTAAATGCTTAGGG + Intronic
1113287347 13:108866685-108866707 AATTTCTCTTTTAATTTTTAGGG - Intronic
1113308650 13:109107268-109107290 ATCTTCTAATGTAATGTTTACGG + Intronic
1115018882 14:28650526-28650548 TTGTTATCCTGTATTGTTTAGGG - Intergenic
1117665637 14:58053232-58053254 ATGTTCTCCTTGAATTTTAAAGG - Intronic
1118149807 14:63177792-63177814 ATGTTGTTCTTTAGAGTTTATGG - Intergenic
1119054616 14:71406751-71406773 CTATTCTCCTTTAATTTTCAAGG + Intronic
1119344038 14:73907058-73907080 ATTATCTCATTTAATCTTTAAGG + Intronic
1122184443 14:99979957-99979979 TTGTTATACTTTATTGTTTAGGG - Intronic
1125196319 15:37051042-37051064 ATGATTTCATTTAATTTTTATGG - Intronic
1125656474 15:41361777-41361799 CTGTTCACCCTGAATGTTTAAGG + Intronic
1125770391 15:42161578-42161600 ATGTTCTCCTTCTCTGTTAAAGG + Intronic
1125955995 15:43791691-43791713 ATGTTCACATTTAAAGTTTCTGG + Intronic
1126606774 15:50485925-50485947 ATGTTATCCTGTATTGTTTAGGG + Intronic
1126838311 15:52690584-52690606 ATGTTCTACTTAACAGTTTATGG - Intronic
1127013285 15:54653893-54653915 CTGTTCTCCTTTCCTGTTAATGG - Intergenic
1127652882 15:61026034-61026056 ATATTCCACTTTAATGTTCATGG - Intronic
1129877370 15:78984431-78984453 ATGTTCATGTTTTATGTTTATGG + Intronic
1130847236 15:87758790-87758812 ATGTTCTCTTTTAGTGTGAAGGG + Intergenic
1131350352 15:91694012-91694034 ACTTTCTATTTTAATGTTTAAGG - Intergenic
1131899287 15:97070014-97070036 ATGAACTCATTTAATCTTTAAGG - Intergenic
1133066063 16:3207998-3208020 ATTTTCTTCTTTATGGTTTATGG - Intergenic
1133534364 16:6686673-6686695 ATTTTCTTCTTTAATGCTAAGGG + Intronic
1134321228 16:13166250-13166272 ATGTTATCCTTTTCTGTTTCTGG + Intronic
1138175639 16:54895916-54895938 ATGTTTGCCTTTAATGTCTACGG + Intergenic
1138665533 16:58564620-58564642 ATATTCACCTTTACTATTTAGGG + Intronic
1138673750 16:58636085-58636107 ATGATCTCATTTACTTTTTATGG - Intergenic
1140198255 16:72873828-72873850 ATGTTCTTGATTAATATTTAAGG - Intronic
1140713823 16:77703667-77703689 ATGCTCTGCTTCAATGTCTAGGG + Intergenic
1141419179 16:83900835-83900857 ATGTTCTCCTTTACTGTAAAAGG - Intronic
1141504690 16:84468124-84468146 TTGGTCTCCTTTAATGCTTTTGG - Intergenic
1141672486 16:85499794-85499816 ATGTTATCTTTTTATGTTTGGGG - Intergenic
1144815787 17:18033697-18033719 AATTTCACCTTTAAGGTTTAAGG - Intronic
1146086454 17:29834609-29834631 ATGTTTTCTTTTATTGTTTCTGG + Intronic
1146314019 17:31793138-31793160 CTGTTCTCCTTTAGTGTTTTAGG + Intergenic
1149388754 17:56169149-56169171 ATGTTCTCCTTTGAAGCTAAAGG + Intronic
1149614075 17:57983239-57983261 ATGGCATCCTTTAATGTTTCTGG + Exonic
1149997782 17:61413883-61413905 ATGTTCCCATTTAATGCTTGAGG + Intergenic
1150182754 17:63142602-63142624 GAGTTCTGCTTTAATCTTTATGG + Intronic
1150529761 17:65964781-65964803 ATGTTCCTCTTTAATTTTTGAGG + Intronic
1153633018 18:7089750-7089772 ATGTTCTCCGTGAATGCTGAGGG + Intronic
1155013143 18:21803150-21803172 ATGTTCTCCCTTTATCTTTATGG + Intronic
1155191120 18:23431517-23431539 TTGTTGTCCTTCAATTTTTAGGG + Intronic
1155503409 18:26509689-26509711 ATGTTTTCCTTTACTGTTTTGGG - Intronic
1155793788 18:30007694-30007716 ATGTTCCAATTTAATGTTTAGGG - Intergenic
1156147056 18:34195581-34195603 ATGTTTTCCTTTAAGTTTCAAGG + Intronic
1158267234 18:55673187-55673209 ATGTGCTCTTTTAAAGGTTAAGG - Intergenic
1158270873 18:55714910-55714932 ATGTTCTCCTGTAATGAATGAGG + Intergenic
1158879071 18:61759090-61759112 ATGTTCTCCTTTATTTTACAGGG - Intergenic
1158906995 18:62022989-62023011 ATGTTCTACTGTATTGTTCAGGG + Intergenic
1159103305 18:63978651-63978673 ATCATCTCCTCTGATGTTTATGG + Intronic
1159427814 18:68311805-68311827 GTGTTCTCATGTAATGTGTAAGG + Intergenic
1159799982 18:72886609-72886631 ATTTTCTTTTTTAATTTTTAAGG - Intergenic
1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG + Intergenic
1160468882 18:79108390-79108412 ATGTTCACCATTAATATTTTTGG - Intronic
1164388567 19:27796569-27796591 AGGTTCTTCTTTAATTTTCAAGG - Intergenic
1165842870 19:38799176-38799198 ATGTACTTCTGAAATGTTTAGGG - Intergenic
1167615937 19:50533738-50533760 ATGATCTCATTTAATCTTTGTGG + Intronic
1167682152 19:50930380-50930402 ATTCTCTCCTTTAATGCTCAAGG + Intergenic
1168569214 19:57451097-57451119 ATATTCTCCAGTATTGTTTAGGG + Intronic
925270544 2:2603841-2603863 ATGTTATCCTGTATTGTTTAGGG + Intergenic
926650396 2:15337783-15337805 ATTTTCTTCATTAATGTTTCTGG - Intronic
928980227 2:37129446-37129468 ATTTCCTCCTGTAATGTTTGGGG - Intronic
929181505 2:39045045-39045067 TTGTTATACTTTATTGTTTAGGG + Intronic
929953024 2:46431360-46431382 ATGATCTAATTTACTGTTTAAGG + Intronic
930442188 2:51423238-51423260 ATATTCTGCATTACTGTTTAGGG - Intergenic
930759075 2:55012370-55012392 ATCTACTTCTTTAATTTTTATGG + Intronic
930794151 2:55369978-55370000 TTTTTTTCTTTTAATGTTTATGG - Intronic
933239766 2:79907152-79907174 ATGTTCTGCTTTAAGATTTCAGG - Intronic
933889644 2:86755807-86755829 ATTTTCTCATTTCATGTTTCTGG + Intronic
934487512 2:94729964-94729986 ACATTCTCCTATAATGTTGAAGG + Intergenic
935741909 2:106156719-106156741 ATGTTATACTGTATTGTTTAGGG + Intronic
936841866 2:116779164-116779186 ATCTTTTCCTTTCATCTTTACGG - Intergenic
937002258 2:118478494-118478516 ATGTTATACTATATTGTTTAGGG + Intergenic
938198691 2:129355378-129355400 ATGTACTCAGTAAATGTTTATGG - Intergenic
938508234 2:131909650-131909672 ATGCTCTCCTTTCAATTTTAAGG - Intergenic
938696467 2:133839853-133839875 ATTTTCTCCTTCTATGCTTAAGG - Intergenic
939537682 2:143452422-143452444 AAGATCCCCTTTAATGTTTCGGG - Intronic
939760109 2:146165186-146165208 TTGTTCCTCTTTACTGTTTAAGG - Intergenic
940212701 2:151272522-151272544 ATGTTCTATTTTAATATTTTGGG - Intronic
940233493 2:151484029-151484051 ATGTTATACTGTATTGTTTAAGG + Intronic
940390211 2:153123713-153123735 ATGTTAGCCATTAATTTTTAAGG + Intergenic
940965251 2:159830176-159830198 ATGTTTTCCTGAAATGTTTATGG - Intronic
941486975 2:166094188-166094210 GTTTTCTCATTTAATATTTAAGG - Intronic
941832949 2:169982295-169982317 ATGTTTTGCTTTCATGTTTGTGG - Intronic
943453041 2:188069764-188069786 ATGGTCTCATTTAATTTTTATGG + Intergenic
943834057 2:192496666-192496688 ATGTTTTCCAATAATGTTTTGGG + Intergenic
944605387 2:201347487-201347509 ATGCAGTCCTTTAATGGTTAGGG - Intronic
945855404 2:215063524-215063546 ATGTTCTACTTTATGGTGTAAGG - Intronic
946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG + Intergenic
947320604 2:228913839-228913861 AAGTATTACTTTAATGTTTAGGG - Intronic
947778385 2:232733810-232733832 TTGTTCTGCTGTATTGTTTAGGG + Intronic
948885686 2:240882653-240882675 TTATTATCCTTTAATGCTTACGG + Intergenic
1169103289 20:2971465-2971487 ATTTTCTTCATTAATTTTTATGG + Intronic
1175343678 20:58253326-58253348 ATTTTCTTCTATAATGTTTATGG - Intergenic
1175774888 20:61646845-61646867 ATGTTCTAATCAAATGTTTAAGG - Intronic
1176838541 21:13817842-13817864 ATGTTCTCCTATAACGTTAAAGG + Intergenic
1177766078 21:25458991-25459013 ATTTTCTCCTAAAATTTTTAAGG - Intergenic
1178009999 21:28273784-28273806 ATGTTCTCCTTTACTCTTAGTGG - Intergenic
1179387015 21:40953211-40953233 ATGTCCTCCTTTGATGCTGATGG - Intergenic
1182562725 22:31173698-31173720 ATTATCTCATTTAATCTTTATGG - Intronic
1182644431 22:31796632-31796654 ATCTTCTACTTTAATGGTTTTGG - Intronic
1183940355 22:41291231-41291253 AAATTCTGCTCTAATGTTTATGG + Intergenic
949165819 3:939529-939551 ATGTTCTGCTTTTAGCTTTATGG - Intergenic
949205072 3:1428242-1428264 ATGTTCTGCTTTATTATTTTAGG - Intergenic
950316743 3:12008027-12008049 ATGTCCTCTTTTAAGGTTCATGG + Intronic
950598111 3:14003665-14003687 ATGTTCTTCTAAAATGTTTAGGG + Intronic
951953306 3:28225605-28225627 CTGTTTTACTTTAATGTATATGG + Intergenic
952190882 3:31022107-31022129 TTGGTCTCCTTTAATCTTAAAGG - Intergenic
952355762 3:32582439-32582461 ATGTTTGCATTTAATGTTTGTGG + Intergenic
952730502 3:36633206-36633228 ATGTTTTATTTTAATGTTTGTGG - Intergenic
956376353 3:68617418-68617440 AGGCTCTCCATAAATGTTTAAGG + Intergenic
957682542 3:83455896-83455918 ATGTTCTCATATTATGTTTGTGG - Intergenic
958069936 3:88597216-88597238 ATATTCACCCTTAATGTTCATGG - Intergenic
958672543 3:97223086-97223108 AAGATCTCCTTTAATTTCTATGG - Intronic
960659513 3:120042737-120042759 ATATTTTCATTTAATGTTTAGGG - Intronic
961307147 3:125966229-125966251 ATGTTCTACTGTGGTGTTTAGGG + Intergenic
962016149 3:131442493-131442515 ATTTTCTCATTTAATGCTCATGG - Intergenic
962304039 3:134270248-134270270 ATGCTCTCCTTAAATGTGTAAGG + Intergenic
962359830 3:134729537-134729559 TTTTTGTCCTTTAATCTTTATGG + Intronic
962595783 3:136942211-136942233 ATGTTCTCCTTCATTTTTGAAGG + Intronic
963136975 3:141915157-141915179 ATGGTCTCCTTGAATGATAATGG + Intronic
964684583 3:159381511-159381533 ATATTCTCCATAAATCTTTAAGG - Intronic
965023012 3:163259468-163259490 ATGTTAACCTTTAAAGGTTAGGG + Intergenic
965345550 3:167544728-167544750 ATGTTCTTCTAGAATTTTTATGG - Intronic
966064616 3:175803807-175803829 ATTTTCTCCTGGAATGCTTATGG - Exonic
966101445 3:176273934-176273956 ATGTGCTGCTTTAATAATTAGGG - Intergenic
966186915 3:177235587-177235609 TTGGTCTTTTTTAATGTTTAGGG + Intergenic
966578130 3:181527004-181527026 ATGTACACCTTAAATGTATACGG + Intergenic
967494263 3:190125172-190125194 AGAATCTCCTTTAATGTTTTTGG - Intergenic
967754787 3:193156809-193156831 ATGGCATCCTTTAATGTTTCTGG + Intergenic
968522819 4:1041814-1041836 ATGTTCTCCTTGAATGCTCTGGG + Intergenic
969784641 4:9445328-9445350 ATGATATCATTTAATGTATATGG + Intronic
970081906 4:12296803-12296825 ATGCTCTCTCCTAATGTTTAGGG - Intergenic
970168091 4:13261334-13261356 ATTTTCTCCTTAAATGATTAAGG - Intergenic
970370430 4:15400545-15400567 ATGGTCTCCTTGAATGTTGGAGG - Intronic
970618783 4:17795737-17795759 ATGTTCATCTTTCATGTTGAAGG + Intergenic
971286363 4:25293735-25293757 ATGACCTCCTTTAATTTTAAAGG + Intergenic
971849182 4:31961128-31961150 ATCTTCTCCTTTAATCCATAGGG + Intergenic
971918341 4:32904844-32904866 ATGTTTTCTTTTACTGTTTCAGG - Intergenic
972653827 4:41047234-41047256 CTGTTCTCCTATAAGGTCTAAGG + Intronic
974601263 4:64083605-64083627 ATGTTCTCTTTTGTTGTTTTTGG + Intergenic
974795580 4:66744788-66744810 TTGCTCTCCCTTAATGTTTGAGG - Intergenic
974986420 4:69032509-69032531 ATGTGCACATTTAATATTTATGG + Intronic
975105121 4:70559168-70559190 ATTTTCTCCTTTAAACTTTCTGG + Intergenic
975228759 4:71906517-71906539 ATATTCTCCTTTTGTGTTTGTGG - Intergenic
975354203 4:73381415-73381437 ATGCTCTTGTTTAATGTGTATGG + Intergenic
975738088 4:77401313-77401335 ATGTTCTCCTTGAGTATGTAGGG + Intronic
976562101 4:86513555-86513577 GTTTTCTCCTTTTGTGTTTATGG - Intronic
976856637 4:89611516-89611538 AGGTTTTCCTTTATAGTTTATGG - Intergenic
977398877 4:96506842-96506864 ATTTTCTTCTTGAATTTTTAGGG + Intergenic
978483903 4:109228140-109228162 ATGGTATCCATTAATGTTGAGGG + Intronic
978623422 4:110657412-110657434 ATGTTCTCATTTCATCTTTCAGG - Intergenic
979110266 4:116744942-116744964 AGGTCTTGCTTTAATGTTTATGG + Intergenic
979902013 4:126233002-126233024 ATGTTGACCTTTAATTGTTATGG + Intergenic
980129430 4:128804598-128804620 ATGTATTCCTTTCATGATTAGGG + Intergenic
980159533 4:129143127-129143149 ATGTTCCCCTTTCATCTATAAGG - Intergenic
980226653 4:129996199-129996221 ATGTTTTTCTTTATTGATTATGG + Intergenic
980797651 4:137705578-137705600 ATGTTCTCTTTTTATGTTGTTGG + Intergenic
981826412 4:148947024-148947046 ATGTTTTACTTTAATCTTTATGG - Intergenic
982271161 4:153590302-153590324 ATGTTCTGGTTAAATGTTTCTGG + Intronic
983031080 4:162802671-162802693 ATGTTTTCCTATAATGTCCATGG + Intergenic
983963392 4:173781087-173781109 ATGTTATACTTTAAGTTTTAGGG - Intergenic
983973227 4:173899917-173899939 ATGTTTTCCTTTAGAGTGTAAGG + Intergenic
984912730 4:184689421-184689443 TTGTTCTCCATTGATGTTAATGG + Intronic
985080142 4:186256422-186256444 ATGTTCTCCCTTGATGCTAATGG + Intronic
986483796 5:8215196-8215218 ATGTTTTCCTTTAAAAGTTAAGG + Intergenic
986498144 5:8367914-8367936 ATGTTTTCCTTCAGTGTTTTTGG - Intergenic
986934382 5:12865348-12865370 CTGTTGTCATTTAATGTTTTGGG - Intergenic
987157616 5:15106503-15106525 ATTTTCTTCTTTGATTTTTAAGG - Intergenic
987287203 5:16468330-16468352 ATCTTCTGCTTTACTTTTTAGGG - Intergenic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
987706465 5:21466386-21466408 ATGATCTCCTTTGATTTTTGTGG + Intergenic
989023105 5:37033599-37033621 AAGTTCTCCTTTAATCTATATGG - Intronic
989058529 5:37387441-37387463 ATGATCTCCTTTGATTTTTGTGG + Intronic
989268108 5:39500873-39500895 ATGTTCTCATTTCATGTCTATGG - Intergenic
989406660 5:41068680-41068702 AAATTCTCCTTCAATGTTTCTGG + Intronic
989704682 5:44314871-44314893 ACTTTCTCCTTTTGTGTTTATGG - Intronic
990075437 5:51840979-51841001 ATGTTCTACTTATTTGTTTATGG - Intergenic
990919041 5:60942761-60942783 ATATTCTCATTTAATGTGCAGGG + Intronic
991251938 5:64572571-64572593 ATATTGTCCTTTAATGTCTTGGG - Intronic
991585703 5:68199796-68199818 ATGTTCTCCTTTATTTCTAAAGG - Intergenic
992403690 5:76435303-76435325 GTTTTCTCCTATAATTTTTATGG + Intronic
992874423 5:81039293-81039315 ATGTTCTCTTTTTATATTTTAGG - Intronic
993838580 5:92847173-92847195 ATTTTCTCCATCAATGTTGATGG + Intergenic
994613964 5:102079858-102079880 ATGTTCTGCTTTTAGCTTTATGG - Intergenic
994835219 5:104843494-104843516 ATGTTATCTTTTAATTTCTATGG - Intergenic
995860654 5:116636998-116637020 ATGTACTCATTTAAATTTTACGG + Intergenic
996091988 5:119360457-119360479 ATGTATATCTTTAATGTTTAAGG + Intronic
996406423 5:123109979-123110001 TTGTTGTCATTTAATATTTATGG - Intronic
996924678 5:128810545-128810567 TTTTTTTCCTTTAATATTTATGG - Intronic
996972098 5:129383601-129383623 TTGTTATACTTTATTGTTTAGGG + Intergenic
997054633 5:130426895-130426917 TTGTTATCCTATACTGTTTAGGG - Intergenic
998408977 5:141893674-141893696 ATGTTCTCATATAATGTTTTCGG + Intergenic
999935012 5:156477141-156477163 ATGTTCTGTTGTTATGTTTAAGG + Intronic
1000626849 5:163548494-163548516 AAGTTCTCATTTCATATTTAGGG + Intergenic
1000785101 5:165533438-165533460 TTGTTCTACTGTATTGTTTAGGG - Intergenic
1000959525 5:167583633-167583655 AAGTGCTCCATTAATTTTTATGG - Intronic
1001663665 5:173414956-173414978 ATGTCCTCCCTTAATGCTCACGG + Intergenic
1002040952 5:176513872-176513894 ATGTGCTACTGTAATATTTATGG - Intergenic
1002051620 5:176574718-176574740 ATGTTATGCTATATTGTTTAGGG + Intronic
1002996332 6:2288680-2288702 ATGTTAACCTTAAATGTTAATGG + Intergenic
1004180119 6:13373874-13373896 ATGGCCTCTTTTAATGTATATGG - Intronic
1004961001 6:20788412-20788434 ATGTTCTTCTGTAAGCTTTATGG + Intronic
1005194998 6:23272034-23272056 ATGATCTCATTTATTGTTTCAGG + Intergenic
1005235353 6:23755432-23755454 TTGTTCTACTTGTATGTTTATGG - Intergenic
1006694812 6:35921784-35921806 ATTATCTCATTTGATGTTTATGG + Intergenic
1006767507 6:36521162-36521184 AAATTCTCCTTTAATGATAAAGG - Intronic
1008504108 6:52212363-52212385 CTGCTCTCCATTAATGTTTGAGG - Intergenic
1008920600 6:56840994-56841016 ATGTTCTCATTTAAACTTAAAGG - Intronic
1009021652 6:57953258-57953280 ATGATCTCCTTTGATTTTTGTGG - Intergenic
1009579872 6:65518458-65518480 ATTTCCTTCTTTAATGTTCATGG - Intronic
1010112477 6:72255022-72255044 ATGCTCTCCTTTAATTTATGAGG - Intronic
1011104180 6:83760583-83760605 ATGTTCTCATTTAGTATTAAAGG - Intergenic
1011262709 6:85485502-85485524 TTTTTTTCCTTTAATGTTTCAGG + Intronic
1011327729 6:86168848-86168870 ATGTTTTCAGTTAATTTTTAGGG + Intergenic
1011801791 6:91024502-91024524 ATGTTATGCTGTATTGTTTAGGG - Intergenic
1012314367 6:97767383-97767405 ATGATCTCCTTCCATTTTTATGG + Intergenic
1012383661 6:98651765-98651787 ATAGTCTGCTTTAATATTTATGG + Intergenic
1012925746 6:105265513-105265535 ATATTTTCCTTAAATGTTTGTGG - Intergenic
1013932201 6:115547173-115547195 ATGTTAACCTTAAATGTTAATGG + Intergenic
1014400471 6:120983490-120983512 TTGGTCTACTTTAATGTTTCTGG + Intergenic
1015456415 6:133431780-133431802 GTGTTCCCCTTAAATGTTCATGG + Intronic
1015626704 6:135186401-135186423 ATGTTCTACTTTATTGTTGCTGG + Intronic
1016144880 6:140657366-140657388 ATATTATCATTTGATGTTTATGG - Intergenic
1017911556 6:158797213-158797235 TTGCTCTCCTGTAATGTTTGTGG - Intronic
1018332427 6:162744776-162744798 ATGATATCATGTAATGTTTATGG + Intronic
1018381485 6:163261745-163261767 TTGTTATACTTTATTGTTTAGGG - Intronic
1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG + Intronic
1018590106 6:165410225-165410247 AAGTTCACCTTTAATATTTTAGG - Intronic
1020617709 7:10479736-10479758 ATATTTTTCTTTAATGTTTAAGG + Intergenic
1021244752 7:18247313-18247335 ATATTCTCCTTTAGTGGTGAGGG + Intronic
1021250619 7:18320873-18320895 AAGTTCTCCTAAAAAGTTTATGG - Intronic
1022303518 7:29124500-29124522 ATTTTCAACTTTAATATTTAAGG - Intronic
1022783531 7:33611876-33611898 ATTTTATCCTTTAATATTAAAGG - Intergenic
1023457248 7:40353898-40353920 ATTTTCTGCTTTCATTTTTATGG + Intronic
1023785070 7:43698119-43698141 AGGTTATGCTTTAATGTTTCTGG - Intronic
1027733096 7:81901172-81901194 AGGTTGTCCTTTAAGGTTAATGG + Intergenic
1027807431 7:82846633-82846655 ATGTTTTGTTTTAATTTTTAGGG - Exonic
1027943896 7:84721950-84721972 ATTTTCTCCTTTTATGTTCAAGG + Intergenic
1027969519 7:85060782-85060804 ATGTTCTCCTTTCATGTGGAAGG + Intronic
1028305686 7:89260920-89260942 ATGTTGTTCTTCAAGGTTTATGG + Intronic
1028942797 7:96543213-96543235 TTGTTATACTTTATTGTTTAGGG - Intronic
1029827192 7:103210409-103210431 AAGTATTCTTTTAATGTTTAAGG + Intergenic
1030684509 7:112470808-112470830 TTGTTATACTTTATTGTTTAGGG + Intronic
1030775451 7:113529548-113529570 ATGTTCTCCTTTAGTTATTTTGG - Intergenic
1030875800 7:114811716-114811738 TTGTTCTACTGTATTGTTTAAGG - Intergenic
1032212077 7:129924974-129924996 TTGTTTTCCTTTAATGCTCAAGG + Intronic
1033509659 7:142046876-142046898 ATTTTTTCCTATAATATTTAAGG + Intronic
1034377091 7:150655669-150655691 ATGATCCCCTTGAATCTTTATGG + Intergenic
1035217337 7:157377953-157377975 ACGTTCTCCTGTGATGTTTACGG + Intronic
1035840565 8:2808474-2808496 ATTTTTTCCTTTAATTTCTAAGG + Intergenic
1035898481 8:3431650-3431672 ATGTTCTCCCTTCATGTTTCCGG + Intronic
1036796690 8:11761178-11761200 ATGCTCTCCTTAATTGTTAAAGG - Intergenic
1036834394 8:12048804-12048826 ATGATATCATTTAATGTATATGG - Intergenic
1036856238 8:12295368-12295390 ATGATATCATTTAATGTATATGG - Intergenic
1037118676 8:15256875-15256897 ATTTCCTCCTGTAATGTTTTTGG + Intergenic
1039090475 8:33823255-33823277 ATTTTCTTCTGAAATGTTTATGG - Intergenic
1039179375 8:34847938-34847960 AAGGTCTCATTTATTGTTTAGGG + Intergenic
1042516047 8:69660584-69660606 ATGTTTTCTTTAAGTGTTTATGG + Exonic
1042769458 8:72363939-72363961 ATGTTATACTGTATTGTTTATGG - Intergenic
1043120765 8:76320183-76320205 CTGTACTCCATTAGTGTTTAGGG - Intergenic
1043723195 8:83574294-83574316 ATGTTGTCCTATAATATTTGTGG + Intergenic
1046429141 8:114100095-114100117 AAATTCTCTTTGAATGTTTATGG + Intergenic
1046738573 8:117804486-117804508 AAGCTCTCCTATAATCTTTAAGG - Intronic
1046819000 8:118616254-118616276 AAGTTCTCATTAAATGTGTATGG + Intronic
1047127867 8:121982627-121982649 ATTTTCTCTTTTAATCTTTTTGG + Intergenic
1047983683 8:130210840-130210862 ATCTTCTCATTTTATTTTTAAGG - Intronic
1048628304 8:136211862-136211884 ATATTCTTCTTTAATGTCTATGG + Intergenic
1048704052 8:137130556-137130578 GTTTTCTCCTGGAATGTTTAGGG - Intergenic
1049387459 8:142350515-142350537 ATGTATTCCTTGAATGTTTCTGG - Intronic
1049976769 9:867529-867551 ATATTTTCATTTAATCTTTACGG + Intronic
1050826335 9:9951140-9951162 ATGTAGCCCTTTAATGTTTCAGG + Intronic
1050911609 9:11078646-11078668 ATGTTCTAATTAAAAGTTTATGG + Intergenic
1051459691 9:17297169-17297191 ATGTTATACTGTATTGTTTAGGG - Intronic
1051580738 9:18671030-18671052 TTGTTATACTATAATGTTTAGGG + Intronic
1051897197 9:21999783-21999805 ATGTGCTTCATTATTGTTTATGG - Intronic
1052238413 9:26241639-26241661 AAGCTTTCCTTCAATGTTTAGGG + Intergenic
1052755802 9:32539437-32539459 TTGTTTTCATTAAATGTTTAAGG + Intergenic
1053178884 9:35950621-35950643 TTATTCTCCTTTAAGTTTTAGGG + Intergenic
1053670295 9:40354471-40354493 ACATTCTCCTATAATGTTGAAGG - Intergenic
1053920082 9:42980729-42980751 ACATTCTCCTATAATGTTGAAGG - Intergenic
1054381414 9:64494457-64494479 ACATTCTCCTATAATGTTGAAGG - Intergenic
1054514318 9:66021829-66021851 ACATTCTCCTATAATGTTGAAGG + Intergenic
1056745532 9:89298161-89298183 ATATTCACATTTAATGTTTATGG + Intergenic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1059556212 9:115282976-115282998 ATGTATTCCTTTAATGTATTAGG + Intronic
1059647552 9:116282272-116282294 TTGTTATACTGTAATGTTTAGGG + Intronic
1060702637 9:125771772-125771794 TTCCTTTCCTTTAATGTTTAAGG + Intronic
1186122422 X:6378191-6378213 ATTTTCTTTTTTAATTTTTATGG - Intergenic
1188783652 X:34316400-34316422 ATGTTTTTCTTTACTGTTTGTGG + Intergenic
1189736511 X:44075328-44075350 ATTTTCTCCTATAAATTTTAAGG + Intergenic
1193293945 X:79810947-79810969 ATTTTCTCCTTTTATTTTTTAGG + Intergenic
1193558610 X:82988301-82988323 ATGATCTCATTTTATGTTTCAGG - Intergenic
1193860448 X:86659649-86659671 TTATTCTCATTTAATGTTTCTGG + Intronic
1194706036 X:97176996-97177018 TTGTTGTACTTTATTGTTTAGGG + Intronic
1194718562 X:97314062-97314084 ATGTTTTACTTTCACGTTTATGG - Intronic
1194754260 X:97718975-97718997 ATGTTCTGCTTAATTCTTTAAGG - Intergenic
1195726339 X:107921081-107921103 ATATTGTCCTTTATAGTTTAGGG + Intronic
1196232665 X:113241997-113242019 GTGTTTTCCTTTAATGCTTAGGG - Intergenic
1196963804 X:121033214-121033236 GTTTTCTCCTTTACTGTTTTTGG + Intergenic
1197002871 X:121459525-121459547 GTGTTCTTTTTTAATTTTTATGG + Intergenic
1197318856 X:125003232-125003254 AAGTTCTTCCCTAATGTTTATGG - Intergenic
1197543530 X:127794872-127794894 TTGTTATACTTTAAGGTTTAGGG - Intergenic
1199109898 X:143919281-143919303 ATATTGTACTTTAAAGTTTATGG - Intergenic
1199406506 X:147467927-147467949 TTGTTATACTTTAATGTCTAGGG + Intergenic
1199867072 X:151861479-151861501 ATTGTCTCCTTTAATACTTACGG + Intergenic
1199897837 X:152140126-152140148 CTGTTCTCCATTAATGGATATGG + Intergenic
1200842579 Y:7798212-7798234 ATTTTCTCCTTTTTTGTTAAGGG + Intergenic
1201339568 Y:12918866-12918888 AATTTCTCATGTAATGTTTAGGG + Intronic
1201513182 Y:14787887-14787909 ATTTTCTCCTTAGATGATTATGG + Intronic