ID: 987577243

View in Genome Browser
Species Human (GRCh38)
Location 5:19745635-19745657
Sequence TGATCTCCAAGGAGAGTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987577243_987577246 -2 Left 987577243 5:19745635-19745657 CCCTCGACTCTCCTTGGAGATCA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 987577246 5:19745656-19745678 CAATAAGCCCGACAGTATTCTGG 0: 1
1: 0
2: 0
3: 0
4: 40
987577243_987577250 10 Left 987577243 5:19745635-19745657 CCCTCGACTCTCCTTGGAGATCA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 987577250 5:19745668-19745690 CAGTATTCTGGGCCTCTCTTAGG 0: 1
1: 0
2: 0
3: 14
4: 196
987577243_987577253 24 Left 987577243 5:19745635-19745657 CCCTCGACTCTCCTTGGAGATCA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 987577253 5:19745682-19745704 TCTCTTAGGCTCCTGCAGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
987577243_987577247 -1 Left 987577243 5:19745635-19745657 CCCTCGACTCTCCTTGGAGATCA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 987577247 5:19745657-19745679 AATAAGCCCGACAGTATTCTGGG 0: 1
1: 0
2: 2
3: 7
4: 82
987577243_987577251 20 Left 987577243 5:19745635-19745657 CCCTCGACTCTCCTTGGAGATCA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 987577251 5:19745678-19745700 GGCCTCTCTTAGGCTCCTGCAGG 0: 1
1: 0
2: 2
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987577243 Original CRISPR TGATCTCCAAGGAGAGTCGA GGG (reversed) Intronic
904323868 1:29714488-29714510 TGATGTCCAAGGATAGGAGAAGG - Intergenic
906611590 1:47207810-47207832 GCATCTCCAAGGTGAGTCCAGGG - Intergenic
908828223 1:68153810-68153832 TTATCTCTGAGGAGAGTCCAAGG - Intronic
909791708 1:79687768-79687790 TGATCTCCAGGTAGAGTCTTGGG - Intergenic
912362932 1:109109977-109109999 TGGTCTTCAAGGAGAGTGGGAGG - Intronic
914908765 1:151768177-151768199 GGATATCCAGGAAGAGTCGACGG - Exonic
1064236684 10:13582569-13582591 TGATGTCCAAGGGGAGTAAAAGG - Intergenic
1074688568 10:115981834-115981856 GGATCTCAAAGGAGGGTCTATGG + Intergenic
1075132420 10:119751436-119751458 TGATCTCAAAGGAGAGTAGTAGG + Intronic
1077721951 11:4638445-4638467 TGATCACCAGGGAGAGTAGGTGG + Intergenic
1079666579 11:23113564-23113586 TGAGGTCCAAGGGGAGTGGATGG - Intergenic
1080230491 11:30014398-30014420 TGACCGCCAAGGAGAGAAGATGG - Intronic
1087653270 11:100893087-100893109 TCATTTCCATGGAGAGTTGAGGG + Intronic
1088653837 11:111980219-111980241 TGATCACAAAGGAGAGTACAGGG - Intronic
1089660308 11:119981339-119981361 TGATCTCCCAGGAAAGGCGTAGG + Intergenic
1091363883 11:135001084-135001106 TGAACTCCAATGAGACTGGATGG + Intergenic
1099573551 12:84355928-84355950 TGAGGTCCAAGGGGAGTCGGTGG - Intergenic
1101885821 12:108660810-108660832 TGATTCCCAAGTATAGTCGATGG + Intronic
1104820622 12:131675398-131675420 TGACGTCCAAGGAGAGAGGACGG + Intergenic
1108847243 13:54693197-54693219 TGGTCTCCAAGCAGAGAAGACGG + Intergenic
1116111447 14:40590555-40590577 TGATCTCCAGGGAGGGAAGAAGG + Intergenic
1116804289 14:49476899-49476921 TGATCCCCAAGAAGGGTCAATGG - Intergenic
1117183331 14:53214758-53214780 TGAGGTCCAAAGAGAGTAGATGG - Intergenic
1118591674 14:67406573-67406595 TGATCTTCAAGGGGAGTCCTTGG + Intronic
1122646575 14:103198317-103198339 TGACCTCCAGGGAGAGGAGAGGG - Intergenic
1128376610 15:67080993-67081015 TGAGCTCCAAGGAGAGCAGTTGG + Intronic
1131355083 15:91738242-91738264 TGATCCCTATGGAGAGTCCAAGG + Intergenic
1132538721 16:497218-497240 AGCTCCCCAAGGTGAGTCGAAGG + Intronic
1132768205 16:1545771-1545793 TCAGCTCCAAAGAGAGGCGATGG + Intronic
1134739428 16:16529509-16529531 TGATCTCCAAGGTCAGGAGAAGG + Intergenic
1134928071 16:18182642-18182664 TGATCTCCAAGGTCAGGAGAAGG - Intergenic
1136814872 16:33209536-33209558 AGATCTCCCTGGAGAGTAGATGG + Intronic
1136821348 16:33319616-33319638 AGATCTCCCTGGAGAGTAGATGG + Intergenic
1136827911 16:33376155-33376177 AGATCTCCCTGGAGAGTAGATGG + Intergenic
1136832977 16:33474926-33474948 AGATCTCCCTGGAGAGTAGATGG + Intergenic
1137572244 16:49574507-49574529 GGTTCTCCAAGTAGAGTCCAAGG - Intronic
1138809298 16:60129867-60129889 TGATCTCCAGGGAGGGGAGAGGG + Intergenic
1138935148 16:61710617-61710639 TGCTCTCTAAGGAGAGCCTATGG - Intronic
1141134392 16:81456215-81456237 TCATGTCCAAGGTGAGTGGAGGG + Intronic
1202993449 16_KI270728v1_random:32510-32532 AGATCTCCCTGGAGAGTAGATGG + Intergenic
1142665525 17:1461143-1461165 GGAACTCCAAGGAGAGTCTTGGG + Intronic
1143337793 17:6186399-6186421 TTACCTCCAAGGAGGGTCGGGGG + Intergenic
1143522685 17:7454286-7454308 TGCCCTCCAAGGAGAGAAGATGG + Exonic
1143791168 17:9296811-9296833 TGAGCTCCAAGGTGAGACAAAGG + Intronic
1143930155 17:10414200-10414222 TGATGACCAAGAAGAGTTGATGG - Exonic
1143938487 17:10512689-10512711 TGATGACCAAGAAGAGTTGATGG - Exonic
1147402894 17:40191654-40191676 TCACCTCCCAGGTGAGTCGAAGG - Exonic
1148033203 17:44637311-44637333 TGATCTCCAAAGGGAGTTAAGGG - Intergenic
1153827657 18:8891207-8891229 TGATCTCCAGGGAGGGAAGAGGG + Intergenic
1157177180 18:45462340-45462362 TGGTTTCCATGGAGAGTCCACGG + Intronic
1157593969 18:48852585-48852607 GGATCCCCAAGGAGAGCCAAGGG - Intronic
1158123453 18:54076168-54076190 AACTCTCCAAGGAGAGTAGAAGG - Intergenic
1162439010 19:10681200-10681222 TGAACTGCAAGGAGAGACCAGGG - Exonic
1164818827 19:31228137-31228159 GGAGCTGCAAGGAGAGTAGAGGG + Intergenic
1166787368 19:45376443-45376465 TGATCTCCAGGGAGGCTCCACGG + Intergenic
1167390090 19:49189189-49189211 GGATCTCCAGGGAGAGTGGCTGG - Intronic
925312813 2:2898774-2898796 TGAACTCAAAGGACAGTCCAGGG + Intergenic
926890411 2:17634612-17634634 TGATCTCAGAGGAGAGATGAGGG - Intronic
928854452 2:35788068-35788090 TAAGGTCCGAGGAGAGTCGATGG - Intergenic
935244397 2:101205779-101205801 TGATCTCTAAGGAGTTTCCAAGG - Intronic
936929306 2:117770725-117770747 TGAAGTCCCAGGAGAGTAGATGG - Intergenic
940162831 2:150731859-150731881 AGATCTCCTGTGAGAGTCGAAGG + Intergenic
945317570 2:208387265-208387287 TAAGCTCCAGGGAGAGTCTAGGG + Intronic
946465703 2:219910055-219910077 TGGACTCCAAGGAGGGTGGAAGG + Intergenic
948383328 2:237566648-237566670 GGATCTCCATGGAGTGCCGATGG - Exonic
1169843337 20:9963290-9963312 TGACCTCCAAGGAAAGGAGAGGG - Intergenic
1175594474 20:60219933-60219955 TGATTTCCCAGGGGAGTCGATGG + Intergenic
1178728084 21:35073006-35073028 TGCTCTTCAAGGGGAGTCGCTGG + Intronic
1178967114 21:37131280-37131302 TGACCTCCAAGGAGAGGAGGGGG + Intronic
1179667288 21:42921621-42921643 AGATCATCAAGGAGAGTGGACGG + Intergenic
959446768 3:106450050-106450072 TGATCTCCAGGGAGTGCTGAAGG + Intergenic
967036827 3:185654341-185654363 GGATCTCAAAGTAGAGTCAAGGG - Intronic
970508811 4:16760012-16760034 TAATCTCCAAGGGGAGAAGAAGG + Intronic
971304269 4:25466260-25466282 TGACCTCCAAGTAGAGTCACAGG - Intergenic
971364985 4:25970437-25970459 TGATTTCCCCGGAGAGTCTACGG - Intergenic
972787225 4:42337836-42337858 TGATCCCAAAGGAGAGACCAGGG - Intergenic
975473806 4:74798732-74798754 TGGTCTCTAAAGAGAGTTGAAGG - Intergenic
976342601 4:83962415-83962437 TGAGGTCCAAGGAGAGTTGGTGG + Intergenic
977607136 4:98995211-98995233 TGTTCTCCAAGGAGCGGCGGGGG + Intergenic
981768978 4:148284780-148284802 TGACCTTCAAAGAGAGACGAAGG + Intronic
982269164 4:153569109-153569131 TGACCTCCAAGGAGAGAGGAAGG + Intronic
987577243 5:19745635-19745657 TGATCTCCAAGGAGAGTCGAGGG - Intronic
990343198 5:54845502-54845524 TGATCTCCAAGGTCATTCAATGG - Intergenic
991015410 5:61926641-61926663 TGATGTCCAAGGATAGGAGATGG - Intergenic
994490423 5:100436042-100436064 TGATGTCCAAGGACAGAAGATGG - Intergenic
995857010 5:116603950-116603972 TGAAGTCCAAGGAGACTGGAGGG - Intergenic
1002776557 6:332854-332876 TGGTCTCCAAGGAGCGTGGAGGG + Intronic
1003133615 6:3416458-3416480 TTCTCTCCAAGGAGAGCAGATGG - Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1006601995 6:35232419-35232441 AGATCTACAATGAGAGTGGAGGG - Intronic
1008429728 6:51401456-51401478 TGATCTTAAAGGAGAGTAGATGG - Intergenic
1011360567 6:86519865-86519887 TCATCTCCCAGGAGAGTTGGAGG + Intergenic
1014220285 6:118792611-118792633 AGATTTCCAAGGAGAGACAATGG + Intergenic
1018399496 6:163408450-163408472 TGATCTCCAAAGTCATTCGAAGG - Intergenic
1026301768 7:69104130-69104152 TGACCTCCAGGGAGAGGTGAGGG - Intergenic
1035182219 7:157097696-157097718 TGATCTCCAGGGACAGGCGGTGG + Intergenic
1037700179 8:21266795-21266817 TGATTGCCAAGGAGAGTCCTGGG - Intergenic
1042974839 8:74456885-74456907 TGATCTGTAAGGAGAGGAGAAGG + Intronic
1053411915 9:37921262-37921284 TGAGCTCCAAGCAGACTTGAAGG + Intronic
1059046755 9:110877369-110877391 TTCTCTCCAAGGAAAGTCTAAGG - Intronic
1186290876 X:8097192-8097214 TGATCTCTAAGGTGAGGAGAAGG - Intergenic
1195212362 X:102661783-102661805 TGACCTCCAAGGAGAGGACAGGG - Intergenic
1195218404 X:102722532-102722554 TGACCTCCAAGGAGAAGAGAGGG - Intronic