ID: 987578345

View in Genome Browser
Species Human (GRCh38)
Location 5:19758341-19758363
Sequence AATTATATGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 811
Summary {0: 1, 1: 10, 2: 207, 3: 218, 4: 375}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987578340_987578345 15 Left 987578340 5:19758303-19758325 CCAGTAACAGGCCAAGAGCTGCC 0: 9
1: 173
2: 187
3: 147
4: 210
Right 987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG 0: 1
1: 10
2: 207
3: 218
4: 375
987578343_987578345 -6 Left 987578343 5:19758324-19758346 CCTCTCAAAAGGACAGTAATTAT 0: 1
1: 2
2: 7
3: 33
4: 246
Right 987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG 0: 1
1: 10
2: 207
3: 218
4: 375
987578338_987578345 25 Left 987578338 5:19758293-19758315 CCACCAAAGTCCAGTAACAGGCC 0: 8
1: 152
2: 160
3: 95
4: 183
Right 987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG 0: 1
1: 10
2: 207
3: 218
4: 375
987578339_987578345 22 Left 987578339 5:19758296-19758318 CCAAAGTCCAGTAACAGGCCAAG 0: 8
1: 181
2: 166
3: 110
4: 213
Right 987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG 0: 1
1: 10
2: 207
3: 218
4: 375
987578342_987578345 4 Left 987578342 5:19758314-19758336 CCAAGAGCTGCCTCTCAAAAGGA 0: 8
1: 195
2: 195
3: 180
4: 295
Right 987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG 0: 1
1: 10
2: 207
3: 218
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987578345 Original CRISPR AATTATATGCAGAAGATGGC AGG Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
908355142 1:63321018-63321040 AAATATTTGCAGAAGATGCTGGG - Intergenic
908389713 1:63673515-63673537 AATTATCTGGACATGATGGCGGG - Intergenic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909324617 1:74334689-74334711 AGTTAAATGGAGAAGATGCCAGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910069427 1:83193873-83193895 AAGGCTATGCAGAAAATGGCAGG + Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG + Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916382344 1:164225883-164225905 AATTGTATTAAAAAGATGGCCGG - Intergenic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917610652 1:176685697-176685719 ACTTAAATGCTGATGATGGCAGG + Intronic
917986851 1:180329034-180329056 AATTATATGCAAAAGTTTACAGG - Intronic
918094802 1:181325794-181325816 AAATATTTGCAGAAGATGCTGGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920947665 1:210544847-210544869 CATTACATGCACCAGATGGCAGG + Intronic
921367706 1:214389446-214389468 AAATATAGACAGAAGAGGGCAGG + Intronic
921429706 1:215051253-215051275 AATTTTATGTGGAAGATGGAAGG + Intronic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924356341 1:243180611-243180633 AAATCTATGTAGAAGAAGGCAGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063030542 10:2229923-2229945 ATTAAAATGCAGAAGATGGGTGG - Intergenic
1063100428 10:2945446-2945468 AATCACATGCAGAGGCTGGCTGG - Intergenic
1063567845 10:7187480-7187502 GTTTATTTGCAGAAAATGGCAGG - Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1066567784 10:36738272-36738294 AATTTTATGTTAAAGATGGCCGG + Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067221467 10:44347158-44347180 AAACATATGCAAAACATGGCGGG - Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069516888 10:69084902-69084924 AATTATCTGGACATGATGGCGGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069891624 10:71655941-71655963 AAGCATATGCAGAAGACTGCTGG + Intronic
1071005608 10:80881237-80881259 AATTTTATTCATAAGATTGCAGG + Intergenic
1071214394 10:83382962-83382984 AATTAAATTCAGAAGCAGGCTGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1072554920 10:96507319-96507341 AAGTAAATGCAGATGAGGGCAGG - Intronic
1073165791 10:101449485-101449507 AACTATATGCAGAGGATCTCTGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074622560 10:115140482-115140504 AATTGTATGCTGAAGCTTGCTGG - Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1079063198 11:17267492-17267514 AATTAAATGCAGAAATTAGCCGG - Intronic
1079927859 11:26518291-26518313 AATAATATGCTGATAATGGCAGG + Intronic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083081484 11:60098712-60098734 AATTATTGACAAAAGATGGCTGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1083222856 11:61264828-61264850 AATTAAAGGCGGAGGATGGCAGG + Intronic
1084407889 11:68988168-68988190 AAAATTAGGCAGAAGATGGCCGG - Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088269982 11:108024190-108024212 AATTATAGGCAGTAAGTGGCAGG - Intronic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090564206 11:127968961-127968983 AATTATATGCAACTGATGGGGGG - Intergenic
1090937518 11:131357250-131357272 AATTAAATGAATAAGATGGATGG - Intergenic
1091033730 11:132214478-132214500 AGTTATAGGCATAAAATGGCAGG - Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091511967 12:1136336-1136358 AAAGATGAGCAGAAGATGGCTGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093268437 12:17027931-17027953 AATTCTAGACAGAAGAGGGCAGG + Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096544140 12:52325680-52325702 AAATATATGGAAAATATGGCTGG + Intergenic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1098889326 12:75992805-75992827 AATTATATGCACATGATGGAAGG - Intergenic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099578071 12:84405367-84405389 AGGCATATACAGAAGATGGCAGG - Intergenic
1099647552 12:85378738-85378760 AATTATATGGAAAAGCTGGCAGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103659971 12:122506397-122506419 CATAATATGTAGAAGATGTCAGG + Intronic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107476844 13:40745216-40745238 AATAAAATGCAAAATATGGCCGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108565203 13:51689963-51689985 AATTGTATGCAGAAGCAGGATGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110483462 13:76010900-76010922 AATTATATCCAGAAGATTCCTGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112456081 13:99565335-99565357 AAATATATGAAGAAAAAGGCCGG - Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG + Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118408570 14:65452005-65452027 AATTCTAGGCAGAAAATGGTGGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120746496 14:88157106-88157128 AATGGTATCCAGAAGATGCCAGG - Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1124183637 15:27501538-27501560 ACTTAAATGCAGTAGATTGCAGG - Intronic
1124390076 15:29246946-29246968 AAATATGTGCAGATGATGACTGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126812537 15:52422434-52422456 ATTGAGATGTAGAAGATGGCAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1130663661 15:85851379-85851401 AAATAAATGCAGACTATGGCTGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132380993 15:101366658-101366680 AATTTCCTGCAGAAGGTGGCTGG + Intronic
1135256978 16:20948771-20948793 AATTCCGGGCAGAAGATGGCGGG + Intronic
1135643060 16:24137648-24137670 ATGGATATGCAGAGGATGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142701332 17:1663253-1663275 AACTAAATTCAGAAGAAGGCAGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145032427 17:19515058-19515080 AATTATCTGCGCACGATGGCAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1148453754 17:47799142-47799164 AATTATATGGAGAAGATAAATGG + Intergenic
1149069022 17:52517779-52517801 AAACAAATACAGAAGATGGCAGG + Intergenic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1149727132 17:58907492-58907514 AATTATATTCAGTTGATGGATGG + Intronic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1150300498 17:64043685-64043707 AAGTTTATCCAGTAGATGGCTGG + Exonic
1150475889 17:65474605-65474627 AATGAGATGCAGAAAATGACAGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151261801 17:72921588-72921610 AATCATATGCAGAATTTTGCAGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153184388 18:2470716-2470738 AATTATTTGTGGAGGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153434799 18:5057927-5057949 ATTTATATCCACAAGATGGCAGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156127351 18:33922015-33922037 AATCATATGGGGAAGATGGAAGG + Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156870655 18:41941288-41941310 AATTTTATGCTTAAGAAGGCTGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159843167 18:73424950-73424972 ACTGACATTCAGAAGATGGCTGG - Intergenic
1159971893 18:74665617-74665639 CATTACATTAAGAAGATGGCAGG - Intronic
1160439291 18:78876682-78876704 AATTGTTTCCAGAATATGGCAGG + Intergenic
1161996610 19:7716759-7716781 ACTTATATTAAGATGATGGCAGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1166593117 19:44018917-44018939 AAGTATATGTAGAGGATGACTGG - Intergenic
1167304658 19:48700685-48700707 AATTATCTGCATGTGATGGCTGG - Intronic
1167305267 19:48704639-48704661 AATTATCTGCATGTGATGGCTGG - Exonic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925631442 2:5897703-5897725 AAGTATTTGCAGCTGATGGCAGG + Intergenic
925984160 2:9201839-9201861 AATTATACTCAGAAGTGGGCTGG + Intergenic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928301861 2:30132157-30132179 AAATACTTGCAGAAGATTGCAGG - Intergenic
929343108 2:40847247-40847269 AATTAAAAGCTGAAGTTGGCCGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934525824 2:95050903-95050925 AATTGTGTGAAGAAGATGGAGGG - Intronic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935740342 2:106141743-106141765 AAATAAATGGAAAAGATGGCCGG - Intronic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
937060200 2:118975126-118975148 ATTTATATTAATAAGATGGCTGG - Intronic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
945142777 2:206704912-206704934 AACTCTATGCAGAAAATAGCAGG - Exonic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946350464 2:219147961-219147983 AAATATATTAAGAAGGTGGCTGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946645079 2:221824578-221824600 AATTATATGCAGCCTTTGGCAGG - Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947775433 2:232705153-232705175 AAAAATATCCAGAAGTTGGCCGG - Intronic
948246708 2:236492429-236492451 AAGTGTATGCTGAGGATGGCAGG - Intronic
1168911359 20:1449808-1449830 ATTTTTGTGGAGAAGATGGCTGG - Intronic
1172325334 20:34030064-34030086 AAGTATATGGAGAGGATGTCAGG + Intronic
1172377958 20:34461412-34461434 CAAAAAATGCAGAAGATGGCTGG + Intronic
1173461842 20:43249097-43249119 AATTAAATGCATAGTATGGCTGG - Intergenic
1174915128 20:54645650-54645672 CATAAGATGCAGATGATGGCCGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177216973 21:18142786-18142808 AAATATATGCAGACAATAGCTGG + Intronic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179680531 21:43017911-43017933 AAGTATATCAAGAAGAGGGCTGG + Intronic
1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181336021 22:22129591-22129613 ATTTAGATTCAGAAGATGGTGGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182004830 22:26951151-26951173 AATTATCTGGATAAGATGGTGGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949868262 3:8564910-8564932 AATGACTTGCAGAAGATTGCTGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952062222 3:29524587-29524609 AATAAAATGCAAAAGTTGGCTGG - Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
954966021 3:54611756-54611778 AATTATATTCAGATTTTGGCAGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959174001 3:102881827-102881849 AATAATCTGCAGAGGTTGGCTGG - Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959711625 3:109391422-109391444 AATTAGATGGACATGATGGCGGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG + Intergenic
960510685 3:118545381-118545403 ATCTATATGTAGATGATGGCAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965028869 3:163337071-163337093 AGTGATATTCAGAAGAAGGCTGG - Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966001829 3:174958224-174958246 AATTATATATATAATATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970116706 4:12705232-12705254 AAATAGATACAGAAGCTGGCAGG - Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
970764708 4:19533493-19533515 AATTATATTCAAAAGATGCAAGG - Intergenic
970924959 4:21441059-21441081 AATTTGATACAGAAGATGACAGG - Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971521554 4:27558106-27558128 AACTACATGAAGAAGCTGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972770561 4:42193463-42193485 AATCCTATTCAGAAGATGGGAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973026945 4:45284483-45284505 GATTATATGTAGATGGTGGCAGG - Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974371790 4:61026235-61026257 AATAAGATCCAAAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975675010 4:76818663-76818685 TCTTATAGGCAGGAGATGGCTGG + Intergenic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978432505 4:108647698-108647720 AATTATATGCAAGTAATGGCTGG - Intergenic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
978658165 4:111091425-111091447 AATTATATCCAGTTGATTGCTGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979596565 4:122541472-122541494 AATTCTGTGCAGAAGAGGGTGGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
979811783 4:125045200-125045222 AATTAAATGAACTAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981384499 4:144112958-144112980 AATTGTATGAAAAAAATGGCAGG + Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981469204 4:145110756-145110778 AAATATATACACAAAATGGCCGG - Intronic
981762416 4:148208944-148208966 AAGAATATGCAAAAAATGGCCGG + Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
981978502 4:150761816-150761838 AATTCTATTCAGAAGAATGCAGG - Exonic
982305347 4:153924566-153924588 TAAGAGATGCAGAAGATGGCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982602604 4:157470446-157470468 AATTACAGACTGAAGATGGCTGG - Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982643379 4:157990715-157990737 ACTTATATGCAGGAGACTGCTGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983287523 4:165758775-165758797 AAAATGATGCAGAAGATGGCTGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984434093 4:179685792-179685814 AATGATATCAATAAGATGGCTGG - Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986216383 5:5723209-5723231 AATTCTATGCACAAGTTAGCTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986934299 5:12864099-12864121 ATTTATATCATGAAGATGGCTGG - Intergenic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987520921 5:18982432-18982454 AACTATATGCAGAAGATTAAAGG - Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991480349 5:67071454-67071476 AAAGATATACAGAAGATGGCTGG + Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993204224 5:84860129-84860151 AATTCAATGCAAAAGAAGGCAGG + Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993370125 5:87082982-87083004 AATTTTATGAAGAAGATAGAAGG - Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993583819 5:89698563-89698585 AATCAAATGATGAAGATGGCAGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996138562 5:119875689-119875711 ATTTTTATGAAGAAGATAGCTGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
997718941 5:136062754-136062776 ATCTATATACAGCAGATGGCAGG - Intronic
998064417 5:139146138-139146160 AAATATATACAGCAGAAGGCTGG - Intronic
998199031 5:140103929-140103951 AATTAGATGAAGAAGATCGGTGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998297280 5:140983713-140983735 ACTTATATTCATAACATGGCTGG + Intronic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006188466 6:32193201-32193223 AAATCTATTCAGGAGATGGCCGG + Intronic
1007844655 6:44743160-44743182 ATTTATATGAAGATGATTGCAGG - Intergenic
1007952601 6:45885640-45885662 AATGAGATTCAGAAGATGTCCGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008371570 6:50737800-50737822 AATGATATTCAGAAGAGGACTGG - Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008447701 6:51611898-51611920 AATTATATTAAAAAGATGGTAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010526746 6:76909390-76909412 AGTAATATGCAGAAGAAAGCTGG + Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013497799 6:110715781-110715803 AAGTTTCTGCCGAAGATGGCAGG - Intronic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015416503 6:132955072-132955094 AATTATATTCAGATTTTGGCAGG - Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1015866096 6:137728211-137728233 AATTATATGGAAAGGATGTCAGG + Intergenic
1016088658 6:139947334-139947356 CATAAAATGCAAAAGATGGCCGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017289556 6:152720222-152720244 ATTTATATGCTGACAATGGCAGG + Intronic
1017317340 6:153047040-153047062 TATTAGATGCTGAAGATGGTGGG + Intronic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020049962 7:5074956-5074978 AATTATATGCAGTATTTGGCAGG - Intergenic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020382514 7:7562505-7562527 AATTATAAGCAAAACAGGGCTGG - Intergenic
1020414053 7:7925433-7925455 AATAATATTCAGTACATGGCAGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021839443 7:24710511-24710533 AATTTTATGGGGAAGATGGATGG - Intronic
1022004706 7:26256818-26256840 AATTAAATGCAAAAAATGCCTGG + Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1023658538 7:42450344-42450366 AATTAAATGTAGAAGAGGGAGGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1025060285 7:55799569-55799591 AATTATAGGCAAAAGAGGACAGG + Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1027287207 7:76659052-76659074 AAGGCTATGCAGAAAATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029312228 7:99678041-99678063 AATTACATGCAATAGATGACTGG - Intronic
1029320021 7:99750626-99750648 AATTACATGCAATAGATGACGGG - Intergenic
1030243673 7:107358977-107358999 AACTATATGCTGGCGATGGCAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030714007 7:112788026-112788048 AAGAATATGCAGGATATGGCCGG - Intronic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032744552 7:134772552-134772574 AATTAGATTCAGAGGATAGCAGG - Intronic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1036708690 8:11063609-11063631 ATGTATATGCAAAACATGGCTGG + Intronic
1036815095 8:11896411-11896433 AATTATATGGACATGGTGGCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037904949 8:22710785-22710807 AATTAAAAGCAGAAGAGGGGAGG + Intergenic
1038239466 8:25795372-25795394 ATTTACATGCAGAAGTGGGCAGG + Intergenic
1038369114 8:26970042-26970064 AATTATGGGCAGAAGAGGGTGGG - Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1038752621 8:30311223-30311245 AATTATATTCAGATGATTGATGG + Intergenic
1038815923 8:30903966-30903988 AATTATATGCAAAAGAAGTTGGG + Intergenic
1038922999 8:32106288-32106310 AGTTATATGCACAAGCTGTCTGG - Intronic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041734599 8:61096380-61096402 AATCATATGGAGAAGAGGGTAGG - Intronic
1041878598 8:62719718-62719740 AAATGTATGCAGAAGATTACAGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042356044 8:67828819-67828841 AACTATAAGCAGAAAATGACAGG - Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043060726 8:75498615-75498637 ACTTATATTCATAAGATTGCTGG - Intronic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045725712 8:105170864-105170886 AATTAAATGCTTAAGATAGCTGG + Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047372588 8:124268119-124268141 AAGTTTCTGCAGCAGATGGCAGG - Intergenic
1047666760 8:127100274-127100296 AAGTAGATGCAGAATATGCCAGG + Intergenic
1049227981 8:141466757-141466779 AATGCCATGCAGAACATGGCAGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052462438 9:28783309-28783331 GATTATATGAAGAATATGGGAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054702315 9:68425288-68425310 AATTGTTTTCAAAAGATGGCAGG + Intronic
1054834657 9:69664113-69664135 AACTATTTGGAGAAGATAGCCGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058345395 9:103955026-103955048 AATTATATGTAGAAGATTTCTGG + Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1058788903 9:108421547-108421569 AATTATATGCAGTTGATTGATGG - Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059819542 9:117956806-117956828 AATTAGTTGCAGAAGTAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187228711 X:17399744-17399766 AATAAGATGGGGAAGATGGCTGG + Intronic
1187415182 X:19087021-19087043 AGTTATATGCAGGAGAAGGTTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1188706045 X:33331860-33331882 AATTATATGCCTAACATGACTGG - Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG + Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193137676 X:77991140-77991162 AATTATATAGTGATGATGGCTGG - Intronic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195461404 X:105129666-105129688 ATTTATATATTGAAGATGGCTGG + Intronic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198016761 X:132619330-132619352 AAATATATACAGATGATGTCCGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199089026 X:143669438-143669460 AATATTATGCAGAAGATACCAGG + Intergenic
1199219947 X:145306252-145306274 AATTCTAGGCAGAAAATGGTGGG - Intergenic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1200982772 Y:9277431-9277453 AACTATATGCTGAAGATACCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202078909 Y:21064072-21064094 AATTATATCCCCAACATGGCTGG + Intergenic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic