ID: 987578637

View in Genome Browser
Species Human (GRCh38)
Location 5:19760520-19760542
Sequence CTGCTTTTAATGTTCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987578637 Original CRISPR CTGCTTTTAATGTTCAACTC TGG (reversed) Intronic
900403717 1:2483428-2483450 CTGCCTGAAATGTTGAACTCTGG + Intronic
900488883 1:2936432-2936454 CTCCATTTAATCTTCAATTCTGG - Intergenic
900769610 1:4530144-4530166 CTGCCTTTAGTTTTCTACTCAGG - Intergenic
902525894 1:17057196-17057218 CTGGTTTTAATTTTCAATTCTGG - Intergenic
906268457 1:44454302-44454324 CTACAGTTAATGTTCTACTCAGG + Intronic
909349259 1:74630416-74630438 ATGCTTTTAAGGTTCCACTCAGG - Intronic
910358112 1:86385193-86385215 CTGATTTTCTAGTTCAACTCCGG + Intronic
910747037 1:90585152-90585174 CTGCTTTCAAAGTCCATCTCAGG + Intergenic
913019486 1:114774025-114774047 CTACTTTTAATTTTCATTTCTGG - Exonic
914372373 1:147039474-147039496 CTGCTATTAAGATTCAGCTCCGG - Intergenic
914950978 1:152113374-152113396 CTGTTTTGAATCTTCACCTCAGG - Intronic
917243671 1:172976595-172976617 CTACTTTTATTGTATAACTCAGG - Intergenic
921478134 1:215634141-215634163 CTGATTTTAATGTGTAACTAGGG - Intronic
923373938 1:233341195-233341217 CTGATTTTAATGTACAAACCAGG - Intronic
1063018094 10:2098143-2098165 CTGATTTAAACGTTCATCTCGGG + Intergenic
1063068268 10:2632212-2632234 CTGCCTTTTAATTTCAACTCTGG + Intergenic
1063874104 10:10453860-10453882 CTGGTTTTATTGTTCATGTCAGG + Intergenic
1067300726 10:45006366-45006388 CTGCTTTTTTTGTGCATCTCTGG + Intergenic
1069690052 10:70345037-70345059 ATGGTTTTAAAGTTCAACTAGGG + Intronic
1070911098 10:80119171-80119193 CTGGTATTAACCTTCAACTCTGG + Intergenic
1071731514 10:88253323-88253345 CTGCTTCTAATGTTTCCCTCAGG - Intergenic
1072560462 10:96568880-96568902 ATGCTTTTAATTCTTAACTCTGG - Intronic
1073036964 10:100570618-100570640 CTGCTGTTCATGTTCGACTTCGG + Intergenic
1078333209 11:10442932-10442954 CAGCCTGTAATGTCCAACTCTGG + Intronic
1078747101 11:14126071-14126093 CTGCCTTTTATGTTCTATTCAGG + Intronic
1082219687 11:49619234-49619256 ATGCCTTTAATGTTGAATTCTGG - Intergenic
1083413675 11:62511593-62511615 CTGCTTTCAGTGGTCACCTCGGG - Intronic
1086138313 11:83465238-83465260 CTGCTTTCAAGGTACATCTCTGG + Intronic
1086629944 11:89005546-89005568 ATGCCTTTAATGTTGAATTCTGG + Intronic
1087413302 11:97820381-97820403 CTGATTTTACAGTTTAACTCAGG - Intergenic
1087982189 11:104629213-104629235 TTGCTTTTAATGTTCCATGCAGG - Intergenic
1091027793 11:132157606-132157628 GCGATTTTAATCTTCAACTCTGG - Intronic
1091957567 12:4660179-4660201 GTGGTTTTAATGTGCAACTAAGG - Intronic
1093063240 12:14629439-14629461 CTTCTTTTAATCTACAACTAAGG - Intronic
1093090533 12:14915181-14915203 CAGCTTGTAATGATCAAATCAGG + Intronic
1093113181 12:15177592-15177614 CTGCTTTTCATGCTCAAATGTGG - Intronic
1098194338 12:67983824-67983846 CTGATTTTAAAGGCCAACTCTGG + Intergenic
1098522200 12:71445860-71445882 CTCTTTTTAATGTTTAAGTCTGG + Intronic
1100650191 12:96578373-96578395 CTGGTTTTAAAGTTAAACTTTGG + Intronic
1101026934 12:100618007-100618029 CTTCTTTTACTGTTAAACTATGG + Intronic
1101716410 12:107317239-107317261 TTGCTTTGAATGTTCAACAATGG - Intergenic
1105510309 13:21046462-21046484 TTGCTATAAATATTCAACTCAGG + Intronic
1107030330 13:35844694-35844716 CTACATTTTATGTTAAACTCTGG + Intronic
1107920489 13:45201940-45201962 GTGCTTGAAATGTTCAACTAAGG - Intronic
1109155851 13:58907808-58907830 CTGCTTTATTTGTTCAAATCAGG + Intergenic
1110680138 13:78300705-78300727 CCCCTTTTCATATTCAACTCTGG + Intergenic
1110807717 13:79776899-79776921 CTGCTTTTAATATTGACCTTTGG + Intergenic
1111440814 13:88280985-88281007 CTGCATTTAATGTTCAGCTCAGG + Intergenic
1113116603 13:106880534-106880556 CTCCTTTTTATGTGAAACTCTGG + Intergenic
1113833132 13:113312627-113312649 CTGCCTTTAATCCTCAACACAGG + Intronic
1116018767 14:39436322-39436344 CTGCTTTTAGTTTTCCATTCCGG - Intergenic
1119818105 14:77589248-77589270 CTGTTTTTAATGTTAAAAACAGG + Intronic
1120847644 14:89139968-89139990 CTGTATTTACTTTTCAACTCAGG + Intronic
1125101846 15:35922800-35922822 CTAATTTTAATGTTCAACCAAGG - Intergenic
1125471436 15:40008346-40008368 TTGCTTTTGAGGTTCAGCTCAGG + Intronic
1125739195 15:41950104-41950126 CTCCTTTTATTGTTCAAGTATGG + Intronic
1126317292 15:47383655-47383677 GTGATTTTAATATTTAACTCAGG - Intronic
1132232541 15:100194623-100194645 CTGCTTTTCAGGCTCAACTCTGG - Intronic
1133648962 16:7791461-7791483 CTCCTTTCAAGGTTCAACTGGGG - Intergenic
1133841515 16:9414077-9414099 GTGCTTTTAATGTGCAACTAAGG + Intergenic
1137725362 16:50653286-50653308 CTGGTTTTAATCAGCAACTCGGG + Intergenic
1139307676 16:66001295-66001317 CTCCTTTTAACGTTCAAATCAGG - Intergenic
1143626465 17:8113045-8113067 CTTCATTTAATCTTCACCTCTGG + Intronic
1143804624 17:9416137-9416159 ATGCTTTTAATGTGCAACCAGGG - Intronic
1144358100 17:14465095-14465117 CTGCTCTTAATGTGGAAATCAGG + Intergenic
1144956708 17:19022260-19022282 CTGGACTTAAAGTTCAACTCCGG - Intronic
1145125822 17:20299251-20299273 CTGCTTTAAATGTTAAACTTGGG + Intronic
1150516802 17:65821013-65821035 CTGTTTTTAATATTCATCTATGG - Intronic
1150912689 17:69405429-69405451 CTGTTGCTAATATTCAACTCTGG + Intergenic
1155849146 18:30749026-30749048 ATGCTCTTGATGTTCAAGTCTGG - Intergenic
1156323499 18:36050882-36050904 CTGCTTTTAATGTGCACATTAGG + Intronic
1157461672 18:47902750-47902772 CTGCTTTGTATCCTCAACTCTGG - Intronic
1158285251 18:55873708-55873730 CTGCTTTCAATGTTCCCTTCTGG + Intergenic
1160588841 18:79928509-79928531 CTGTTTGTAATGTTCACCACTGG - Intronic
927523472 2:23717040-23717062 CTGTTTTTAATGGGCAATTCTGG - Intergenic
929298984 2:40280113-40280135 CTGCTTTTAAAGATTATCTCTGG + Intronic
929411504 2:41702130-41702152 ATGCTTAGAATGTCCAACTCTGG - Intergenic
932868788 2:75375242-75375264 CTGCTTTGATTTTTCAATTCTGG - Intergenic
935220258 2:101005778-101005800 CAGCATTTAATGTTCACCTGGGG + Intronic
936078218 2:109415316-109415338 CTGCTTATTATTTTGAACTCAGG - Intronic
936555509 2:113495063-113495085 CTGCTTTTAAGTTTGAACTGAGG + Intronic
936913097 2:117613082-117613104 GTGATTTTAATGCTCAAGTCTGG - Intergenic
936933882 2:117819076-117819098 CTCTTTTCAATGTTCGACTCTGG - Intronic
937270336 2:120646377-120646399 CTGCTTTTGCTGTTTATCTCAGG + Intergenic
939232630 2:139449589-139449611 CTGCTTTTTTTGTTCAGCTTTGG - Intergenic
939235368 2:139485497-139485519 CTGATTTCAATTTTCAGCTCAGG + Intergenic
939505387 2:143039728-143039750 CTTCTTTTAATCTACAACTAAGG + Intronic
939619223 2:144398019-144398041 CTGCTTTTAAAATTAAACTTTGG - Intronic
940689734 2:156900782-156900804 ATGCTTCTAATGTGCAACTAGGG - Intergenic
941271545 2:163435563-163435585 CAGCTTTTATACTTCAACTCAGG - Intergenic
942890860 2:180985922-180985944 CTACTTTACATGTTTAACTCCGG + Intronic
944360202 2:198845339-198845361 ATGATTTTAATCTCCAACTCTGG - Intergenic
1169693677 20:8362543-8362565 CTGCATTTAACTTTCAACTTTGG + Intronic
1173419227 20:42886016-42886038 CAGCTTTGAATTTTAAACTCTGG + Intronic
951053322 3:18119162-18119184 CTATTTTTGATGTTCAACTTTGG - Intronic
957879582 3:86194022-86194044 TTGCTTTTAATATTAGACTCAGG - Intergenic
958609321 3:96403709-96403731 CAGCCTTTATTGTTCTACTCAGG + Intergenic
960515320 3:118596353-118596375 CTGTTTTTATTGTTCAAACCTGG - Intergenic
960624736 3:119671134-119671156 CTGCTATTCATCTTCAACTTAGG + Intronic
960631161 3:119732137-119732159 CTGTTTTTAATGTTACATTCTGG + Intronic
961619490 3:128212472-128212494 CTGCTTTTGATCTTCACCTCAGG + Intronic
963465656 3:145678278-145678300 TTGCTCTTAATGTTCAAAACTGG - Intergenic
963647291 3:147930703-147930725 CTGCTTTTAGAGTTTAACTTTGG + Intergenic
965784645 3:172322949-172322971 CTGCTTTTCAAGTACAACTGAGG - Intronic
966238762 3:177731290-177731312 CTGCTTTTAACGCCCAACTCAGG + Intergenic
966576006 3:181503377-181503399 CTGATTTTAATGTTCAGCCAGGG + Intergenic
967784872 3:193481619-193481641 CTGTTTTTAATGTTCATCTATGG + Intronic
972032808 4:34483470-34483492 ATGCTTTTAACCTTGAACTCAGG - Intergenic
974671743 4:65039056-65039078 CTGCGTTGCATCTTCAACTCAGG + Intergenic
974695411 4:65362421-65362443 TAGCTCTTAATGTTCAACTTAGG - Intronic
975793476 4:77982705-77982727 CTGCTTTTAATGGTTAATTTAGG - Intergenic
976768453 4:88623280-88623302 CTGCTTTAAAGATTCCACTCTGG + Intronic
976889265 4:90025773-90025795 CTGCTTTTGATATTCAATTCTGG + Intergenic
977256274 4:94743613-94743635 CTTCTCTTAATGTTCGACTTAGG - Intergenic
977655036 4:99511251-99511273 CTGCTTTTAATATTGTCCTCAGG + Exonic
977768346 4:100827468-100827490 CTGCACTTAATGTTCAATTAGGG - Intronic
978882557 4:113723619-113723641 TTGCTTATAATTTTCAACACTGG - Intronic
979675717 4:123408585-123408607 CTGCTTTTAATGTGCGGCTAAGG - Intergenic
979937994 4:126721832-126721854 TTACTTTTAATGTTTCACTCTGG - Intergenic
980771153 4:137374861-137374883 ATACTTTTAATGTGCAACTGTGG + Intergenic
984330867 4:178316134-178316156 CTGCTTTTATTTTTCAATTAAGG + Intergenic
987120354 5:14761349-14761371 CTTATTTTCATGTTAAACTCTGG + Intronic
987131869 5:14867844-14867866 CTGCTTTTAATATTAAACATAGG - Intronic
987578637 5:19760520-19760542 CTGCTTTTAATGTTCAACTCTGG - Intronic
990051137 5:51503213-51503235 GTGCTTTTATTGTTGAAATCTGG + Intergenic
990438449 5:55819511-55819533 ATGCTTTTGATTTTCAATTCTGG - Intergenic
990868728 5:60407945-60407967 CTGCTTTTCATGTCCAACCTTGG - Intronic
997666268 5:135631922-135631944 CTGCTTTTGAAGTCCAACCCAGG + Intergenic
998676993 5:144420645-144420667 CTGCTTTTAATTTTCATTTTGGG + Intronic
998821069 5:146058509-146058531 CTGCTTTTCATGTACACATCTGG + Intronic
1001266117 5:170275732-170275754 TCCCTTTTAAGGTTCAACTCGGG + Intronic
1002076828 5:176713251-176713273 CTGCTCTCAAATTTCAACTCTGG + Intergenic
1003574804 6:7282966-7282988 CTGCTTTGAATCTTCCACTGTGG + Exonic
1005659430 6:27980462-27980484 CTGGTTTTAATGTTTAACAATGG - Intergenic
1007588703 6:43008489-43008511 CTCCTTATAATGTCCAACTCAGG + Intronic
1008043905 6:46832328-46832350 CTTCTTATACTGTTCAACCCAGG + Intronic
1008384538 6:50873416-50873438 CTGCATTTAATATTGACCTCAGG - Intergenic
1009331518 6:62427325-62427347 CTGCTTTTTTTTTTTAACTCTGG + Intergenic
1009484524 6:64203263-64203285 CTTCATTTAATGTTGAAATCAGG - Intronic
1011592577 6:88984836-88984858 CTATTTTTAATGTACAACTTAGG - Intergenic
1015375129 6:132501464-132501486 CTGCCATAAATATTCAACTCTGG + Intronic
1018223351 6:161604204-161604226 CTCTTTTTAAGGTTCAACCCTGG - Intronic
1018543666 6:164912615-164912637 CTGGTTTTTCTGTTCAACTCAGG - Intergenic
1020808516 7:12821831-12821853 GTGCTTTTAATCTTCTGCTCTGG - Intergenic
1021783441 7:24129471-24129493 CCAGTTATAATGTTCAACTCTGG - Intergenic
1025100348 7:56129497-56129519 TTGCTTTTGAGGTTCTACTCAGG - Intergenic
1025147695 7:56519009-56519031 TTGCTTTTGAGGTTCTACTCAGG - Intergenic
1026318657 7:69250019-69250041 TTGCTTTTGAGGTTCTACTCAGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1029871941 7:103703623-103703645 CTGGTTTTAAATTTCAACTTTGG - Intronic
1033686214 7:143643556-143643578 CCTCTTTTCATTTTCAACTCTGG + Intronic
1033689524 7:143723759-143723781 CCTCTTTTCATTTTCAACTCTGG - Intronic
1033698399 7:143814065-143814087 CCTCTTTTCATTTTCAACTCTGG - Intergenic
1034598537 7:152223833-152223855 CTGTTTTGAATTCTCAACTCCGG - Intronic
1034828554 7:154289189-154289211 CTGCTTTTTATTTTCAACCTAGG - Intronic
1044756176 8:95463792-95463814 GTGCTTTTTGTGTTCAACTAAGG + Intergenic
1044966353 8:97577475-97577497 TGGCTTTTAATGGTCAGCTCGGG + Intergenic
1045659144 8:104418372-104418394 CTGCATTTAATGTTAAAATCAGG + Intronic
1046316582 8:112510629-112510651 TTGTTTTTAATATTCCACTCAGG + Intronic
1046438904 8:114232947-114232969 CTGTTTTTAATATTCACTTCAGG + Intergenic
1047537945 8:125736543-125736565 CTGATTTGAATGTTAATCTCTGG - Intergenic
1048369176 8:133762417-133762439 CTGCTTTTAATTTTTAATTTGGG - Intergenic
1049316291 8:141970389-141970411 CTGCTCTTCCTGTTGAACTCAGG + Intergenic
1049897484 9:122125-122147 CTGCTTTTAAGTTTGAACTGAGG - Intronic
1053740577 9:41132392-41132414 CTGCTTTTAAGTTTGAACTGAGG - Intronic
1054443568 9:65288567-65288589 CTGCTTTTAAGTTTGAACTGAGG - Intergenic
1054486706 9:65732936-65732958 CTGCTTTTAAGTTTGAACTGAGG + Intronic
1054687772 9:68298907-68298929 CTGCTTTTAAGTTTGAACTGAGG + Intronic
1058899218 9:109427443-109427465 CTCCTTTTAAATTTTAACTCTGG + Intronic
1060092844 9:120759686-120759708 GTGTTTTTAATATTCAACCCTGG - Exonic
1060127279 9:121060307-121060329 CAGCTTTTCATGGTAAACTCTGG + Intergenic
1061222078 9:129258162-129258184 CTGCTGTTACTGGTCACCTCTGG + Intergenic
1188192449 X:27188619-27188641 CTGCTTTTTAAGTTCTACTCAGG + Intergenic
1188237193 X:27744863-27744885 CTGCTTTTAGTGAGGAACTCAGG - Intronic
1189103348 X:38213065-38213087 GTGCTTTCAAGGTTCAACTGTGG - Intronic
1189106470 X:38240864-38240886 TTGCTTTTATTGTACAACTCTGG - Intronic
1189399402 X:40652554-40652576 TTGATTTTAATGTTGAACTCTGG - Intronic
1192193495 X:69013269-69013291 GTGCATTTAATGTTCAAGTGTGG - Intergenic
1192318933 X:70073426-70073448 CTGCTTTTAATCTATAACTAAGG - Intergenic
1192354111 X:70383825-70383847 CAGATTTTAATGTCCTACTCTGG - Intronic
1196065496 X:111459711-111459733 CTGATATTAATGTACCACTCCGG + Intergenic