ID: 987579996

View in Genome Browser
Species Human (GRCh38)
Location 5:19777523-19777545
Sequence CTTCACAAGCACAGTGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987579996_987580000 9 Left 987579996 5:19777523-19777545 CCGGCCACACTGTGCTTGTGAAG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 987580000 5:19777555-19777577 CTACGTTTGAAAAAGAATTAGGG 0: 1
1: 0
2: 0
3: 13
4: 223
987579996_987580001 22 Left 987579996 5:19777523-19777545 CCGGCCACACTGTGCTTGTGAAG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 987580001 5:19777568-19777590 AGAATTAGGGCCTAAATTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 131
987579996_987579999 8 Left 987579996 5:19777523-19777545 CCGGCCACACTGTGCTTGTGAAG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 987579999 5:19777554-19777576 ACTACGTTTGAAAAAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987579996 Original CRISPR CTTCACAAGCACAGTGTGGC CGG (reversed) Intronic
900582950 1:3418357-3418379 CTGCACCAGCAGAGGGTGGCCGG - Intronic
900953594 1:5873478-5873500 CTTCTCTGGCACAGTGAGGCCGG - Intronic
901645984 1:10716985-10717007 CTTCACCAGCACAGGCAGGCGGG + Intronic
902036362 1:13461064-13461086 CTTCACACCCCCAGGGTGGCTGG + Intergenic
906129806 1:43449376-43449398 CTGCACAAGCACTGTGCTGCAGG - Intronic
907326351 1:53640982-53641004 CTTCAAAAGCACAGGGAGACAGG + Intronic
907673475 1:56497390-56497412 CATCATAAGCACATTGAGGCAGG - Intronic
908331858 1:63078967-63078989 CTTAAGAAGCTCTGTGTGGCTGG - Intergenic
908389934 1:63675253-63675275 CTTCAGCAGCGCAGTGTGGGAGG - Intergenic
909668291 1:78160264-78160286 CTTCCCCAACACAGTGAGGCAGG + Intergenic
909889789 1:80990453-80990475 CTTCCCATGCACAGTGAGGGAGG - Intergenic
910865595 1:91785579-91785601 CTTCACCTACACGGTGTGGCTGG - Intronic
912513004 1:110201234-110201256 CATCAAAAGCACAGTGGGGAGGG - Exonic
913233382 1:116760650-116760672 CTTCACAAACACAGCCTGCCAGG + Intronic
916243357 1:162661640-162661662 CTCCACAAACACAGTGAAGCCGG + Intronic
918348268 1:183626089-183626111 CTTAACAAGAACAGTTTGGTAGG - Intronic
918592357 1:186254149-186254171 CCTTACAAGAACAGTGAGGCAGG + Intergenic
920961222 1:210665721-210665743 CATCCCAAGCCCAGGGTGGCAGG - Intronic
921946569 1:220889855-220889877 TTTCGTGAGCACAGTGTGGCTGG - Intergenic
922897734 1:229113525-229113547 CATCACAAGCACACTGCGACAGG + Intergenic
923139446 1:231148638-231148660 CTTCTCAACCATAGTGTCGCTGG - Intergenic
1063953817 10:11247619-11247641 CTTCAGGTGCTCAGTGTGGCAGG - Intronic
1068302554 10:55163123-55163145 CTTTTCAAGGACAGTTTGGCAGG - Intronic
1069829377 10:71273182-71273204 CTTAACAAGCACTGTGGGCCGGG - Intronic
1069935076 10:71909868-71909890 TTTCACTAACACAATGTGGCAGG + Intergenic
1071669666 10:87596860-87596882 CTCCACTATCTCAGTGTGGCAGG + Intergenic
1072518837 10:96212575-96212597 CTTCTCAAGCACAGCGGGGACGG + Intronic
1072569573 10:96646783-96646805 CTTCACAATCACATGGAGGCAGG - Intronic
1074001817 10:109381059-109381081 CCTGGCAAGTACAGTGTGGCTGG + Intergenic
1075484660 10:122812520-122812542 CTTCACAAGTAGAGTGTAGAGGG + Intergenic
1077239474 11:1503028-1503050 CACCAAAAGCACAGTGAGGCGGG + Intergenic
1077355440 11:2114669-2114691 AATCACAAGCAGAGAGTGGCGGG + Intergenic
1077370574 11:2179882-2179904 CCTCAGGAGCACAGGGTGGCAGG - Intergenic
1077918313 11:6625243-6625265 CTCCACAAGCACTGTGAGGTTGG + Exonic
1079400882 11:20105545-20105567 CTTCACAGGCTCCGTGTGGTTGG - Exonic
1082806021 11:57451115-57451137 CTTCCCCAGCAGAGTGAGGCTGG + Intergenic
1084091493 11:66881920-66881942 CATCAGGAGCACAGTGTGACAGG + Intronic
1088910518 11:114187626-114187648 CTTAACACTCACAGTGAGGCAGG + Intronic
1091463429 12:663379-663401 CTTCACACGCACCGGGTGCCGGG + Exonic
1092791400 12:12073678-12073700 CTTCAGCAGCACAGTGTTACTGG + Intronic
1093118212 12:15236502-15236524 CCTCAAAATCACAGTGGGGCTGG - Intronic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096642886 12:53008461-53008483 CTTCACAAAGCCAGTGTGACTGG - Intronic
1099656089 12:85493923-85493945 TTTCTCAAGCACAGTTTTGCTGG + Intergenic
1101013917 12:100479783-100479805 CAACACAAGCCCAGTGAGGCTGG - Intronic
1101229388 12:102724442-102724464 CTTTAGCAACACAGTGTGGCTGG + Intergenic
1101802704 12:108036083-108036105 CTACTCAAGTCCAGTGTGGCTGG - Intergenic
1104000493 12:124856942-124856964 CTGCACCAGCAAAGTTTGGCGGG + Intronic
1107656818 13:42599915-42599937 CTTCACAAGCACCCTGTGATGGG + Intronic
1108277526 13:48826274-48826296 CTTTACTAGGGCAGTGTGGCGGG - Intergenic
1108819066 13:54323780-54323802 CTTCACTAATACTGTGTGGCAGG + Intergenic
1112189518 13:97162698-97162720 CTCCACCAGCACAGACTGGCTGG + Intergenic
1113779034 13:112965512-112965534 ATTCACAAGCTCATTGTGACTGG - Intronic
1113811823 13:113147346-113147368 CGTGACAGGCTCAGTGTGGCTGG - Intronic
1114495251 14:23127510-23127532 CTTCATAAGCAAAGAGTAGCCGG - Intronic
1119331050 14:73793900-73793922 CTCCCCAAACACAGTCTGGCTGG + Intergenic
1120713399 14:87816065-87816087 ATTCAAAATCAAAGTGTGGCAGG + Intergenic
1121791904 14:96705055-96705077 CTCCACATGCCCTGTGTGGCAGG + Intergenic
1123034892 14:105467949-105467971 CCTCACAAGCACTGCATGGCTGG - Intronic
1123161604 14:106283692-106283714 CTTCAAAAGCATGGTGTGGTAGG + Intergenic
1202893660 14_KI270722v1_random:183252-183274 CGTCACCAGCACAGGGCGGCGGG + Intergenic
1124930451 15:34114620-34114642 CTTTATAGGCACAGTATGGCGGG - Intergenic
1125348210 15:38740956-38740978 CTTCCCAAGCACAGTGCCCCAGG - Intergenic
1125432224 15:39607085-39607107 CTTCCCACGGACAGTGTGGAGGG - Intronic
1131023084 15:89116274-89116296 GTTTACAAGCACAGTGAGGACGG - Intronic
1135657528 16:24264175-24264197 CTTCACAAGCATCGTGCAGCCGG - Intronic
1138392394 16:56679664-56679686 CTTCACATTCACTGTGTGTCTGG - Intronic
1138493709 16:57393989-57394011 TTTCAGAAACACAGTGGGGCAGG - Intergenic
1140246249 16:73252615-73252637 CTTCAAAAGCTCAGGGTGGGAGG + Intergenic
1140681270 16:77387235-77387257 TGTTACAAGTACAGTGTGGCAGG + Intronic
1140787565 16:78357491-78357513 CATCACAAAGACAGTGTTGCAGG - Intronic
1141703697 16:85653609-85653631 CTTCACACACACGGTGGGGCAGG - Intronic
1142146667 16:88495692-88495714 CTTCACACACACAGAGTGGTGGG - Intronic
1142663275 17:1446170-1446192 CACAGCAAGCACAGTGTGGCTGG + Intronic
1143017142 17:3896889-3896911 GTTCACATACACAGTGTGGAAGG + Exonic
1144891248 17:18495656-18495678 CTTCACCAGGGCAGTGTGGAAGG + Intergenic
1149235219 17:54581902-54581924 CTTCAGAAGCTTAGTTTGGCTGG - Intergenic
1150355261 17:64478599-64478621 CTTAACAAGAATAGTATGGCTGG + Intronic
1151974171 17:77475185-77475207 CTTCACAAACCCTGTGTGGGGGG + Intronic
1152858568 17:82680473-82680495 CTTCAGAAGCAAAGAGTGTCAGG - Intronic
1154343740 18:13525635-13525657 CTCCTCAAGCCCAGTGAGGCTGG - Intronic
1155468331 18:26164101-26164123 CTTTACAAGAACAGTTTGGATGG + Intronic
1156831018 18:41491305-41491327 CTTCACAAGAACAGTGTTATTGG - Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1160142138 18:76334900-76334922 ATTCAACAGCACAGTGTGGCAGG - Intergenic
1163134080 19:15296685-15296707 CTTCAGAATCTCAGTGTGGCTGG - Intronic
1164911035 19:32012137-32012159 ATTCACTAGCACTGTGAGGCCGG + Intergenic
1165026768 19:32968159-32968181 CTTGACAAATACAGGGTGGCAGG - Intronic
1166521154 19:43481158-43481180 CTTGACACTCAAAGTGTGGCTGG - Intronic
1166851749 19:45764652-45764674 ATTCAGATGCACAGAGTGGCTGG - Intergenic
925987375 2:9227122-9227144 CTTCTCAAGCACAGCAGGGCTGG - Intronic
926098228 2:10096648-10096670 CATCACCAGAACAGGGTGGCCGG - Intergenic
926326088 2:11785968-11785990 CTTCAGAAACACAGTGAGGCTGG - Intronic
926715119 2:15918364-15918386 GTTCTGAAGCACAGTGGGGCAGG + Intergenic
926857498 2:17272775-17272797 CTTTTTAAGCACAGTGTGGGAGG - Intergenic
928406547 2:31019416-31019438 CCTCAAAATGACAGTGTGGCTGG - Intronic
929531837 2:42757487-42757509 CTTCACAAACACAGGCTGGAGGG - Intergenic
930331752 2:49994095-49994117 CTTCACAAGCAGAGTCTCTCAGG + Intronic
933708789 2:85310159-85310181 CTTCACAATCCCAGAGTGGCAGG + Exonic
935140173 2:100345979-100346001 CTGCTCAAGCACAGTGTAGTTGG + Intergenic
937264971 2:120609714-120609736 CTTCAGAACCACAGTGTCCCAGG + Intergenic
937562163 2:123239418-123239440 CTTCAAAATCAAAGTGTAGCAGG - Intergenic
937913843 2:127089371-127089393 CTTCAGGAGCGCAGTGGGGCAGG + Intronic
939389927 2:141554829-141554851 CCTAACAAGCACAGTGATGCAGG - Intronic
945882011 2:215334654-215334676 ATTCACAAAAACAGGGTGGCAGG - Intronic
948688138 2:239684288-239684310 CTTCACAACCACACGCTGGCTGG + Intergenic
948730325 2:239959434-239959456 CTTCACAAACCCATTGTGGAGGG - Exonic
1168994871 20:2125636-2125658 CAGCACAGGCACACTGTGGCAGG + Intronic
1170350857 20:15439455-15439477 CATCACACTCACAGTGTGTCTGG + Intronic
1172631735 20:36383130-36383152 CTTTAGAAGCACAGAGTTGCTGG + Intronic
1174315650 20:49698737-49698759 CAACACAGGCACAGGGTGGCAGG - Intronic
1174315920 20:49701557-49701579 CAACACAGGCACAGGGTGGCAGG - Intronic
1174552933 20:51374634-51374656 CATCATAAGAACAGTGTGGTCGG - Intergenic
1175707116 20:61188017-61188039 CATCAAAACCACAGAGTGGCAGG + Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1178296892 21:31417716-31417738 CTGCACAGGTAGAGTGTGGCAGG - Intronic
1178595463 21:33949057-33949079 GTTCACAAGAACAGTCTGGCTGG + Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179787056 21:43735896-43735918 CCCCAGCAGCACAGTGTGGCAGG - Intronic
1180050104 21:45327184-45327206 CTTCCCAAACAGAGTGGGGCAGG - Intergenic
1184904697 22:47473034-47473056 CATCACAAGCCCAGAGTGCCAGG - Intronic
949444093 3:4115061-4115083 TTTCATAGGCACAGAGTGGCGGG - Intronic
952507952 3:34024645-34024667 CTTCACAAGCCCAGTGTGATTGG - Intergenic
960579686 3:119266455-119266477 TTTAAAAAGCACATTGTGGCTGG + Intergenic
961185967 3:124915293-124915315 ATTACCAAGCACAGTGTGGAAGG - Intronic
961326901 3:126114410-126114432 CATCACAAGCATAGCGTGGCAGG - Intronic
961697073 3:128712756-128712778 CCTCATGAGCTCAGTGTGGCAGG + Intergenic
962712754 3:138101538-138101560 CTTCACAACCACAGTGGCCCTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG + Intergenic
964897493 3:161615447-161615469 CTTCTCAAGCAAAGTGAGGCTGG - Intergenic
965135327 3:164758685-164758707 CTTCACAAGGACTGTATGGTGGG + Intergenic
965916790 3:173858163-173858185 CTTCACATGCACAGTGAGTCTGG + Intronic
967665873 3:192171457-192171479 CTTCACAATCACAGTCTCTCAGG + Intronic
968439197 4:612994-613016 CTGCCCAAGCACAGTGATGCAGG - Intergenic
969217254 4:5732238-5732260 CTTAAGAAGCTCAGTCTGGCGGG + Intronic
969839212 4:9868307-9868329 CTTCACTAGTCCACTGTGGCAGG + Intronic
970024642 4:11610528-11610550 CTCCATAAGTACAGTGTGGCGGG - Intergenic
970968051 4:21949620-21949642 CTTCTAAAGCACAGTAAGGCCGG + Intergenic
971217156 4:24672225-24672247 CTTCACAGGCCCAGTGAGGGAGG + Intergenic
972163638 4:36256276-36256298 GTTCAGAAGCACAGTTTGGAAGG - Intergenic
973089148 4:46110463-46110485 CTTAAAAGGCACAGAGTGGCAGG - Intronic
974011130 4:56608487-56608509 CATCACAAGCCCAGAGTGCCAGG + Intergenic
976785777 4:88818725-88818747 CTCCACAAACACAGTCTGGGAGG - Intronic
977364370 4:96048587-96048609 CTTCAGCAGCACATTCTGGCTGG - Intergenic
978196428 4:105977764-105977786 GGACTCAAGCACAGTGTGGCAGG - Intronic
978712570 4:111802696-111802718 CTTCACATTCACAGGGCGGCAGG + Intergenic
979886322 4:126031834-126031856 CTTCATAAGCTTAGTTTGGCTGG - Intergenic
981115440 4:140984812-140984834 TTTCACTAGCACAGTGAGGGAGG - Intronic
981286988 4:143028864-143028886 CTTAAAAGGCACAGAGTGGCAGG + Intergenic
983490593 4:168384956-168384978 CTTAAAAAATACAGTGTGGCTGG + Intronic
983786671 4:171740543-171740565 CTTCAGCACCCCAGTGTGGCTGG - Intergenic
983872524 4:172838409-172838431 CCCCACAAGAACAGTGTGGCAGG - Intronic
985804528 5:2032530-2032552 GGTCACAAGGACAGGGTGGCAGG - Intergenic
987579996 5:19777523-19777545 CTTCACAAGCACAGTGTGGCCGG - Intronic
989202069 5:38773643-38773665 AGTCAGAGGCACAGTGTGGCTGG + Intergenic
989204223 5:38795685-38795707 CTTCACAAGCACTTTGGGGCAGG + Intergenic
990312943 5:54556810-54556832 TTCCACCAGCACAGTGTGGCAGG + Intergenic
997866719 5:137470409-137470431 ATCCACAGGCACAGTGTGGGAGG + Intronic
998417462 5:141956106-141956128 ATTCACAAGCACGGAGAGGCTGG + Exonic
998522805 5:142816092-142816114 CTACAGAAGCACAGAGGGGCTGG - Intronic
999385137 5:151148791-151148813 CACCACGAGCTCAGTGTGGCTGG + Intronic
1000891333 5:166805759-166805781 CTTTACAAGTCCTGTGTGGCTGG + Intergenic
1001099821 5:168804907-168804929 CTCCAGAAGGCCAGTGTGGCTGG - Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1004313974 6:14570426-14570448 CTTCAAAAGCACACTGTGAGAGG - Intergenic
1005010059 6:21327530-21327552 CTTCTCATCCACACTGTGGCTGG - Intergenic
1005312115 6:24568785-24568807 CTTCACAGCCACAGTGAGGGTGG + Exonic
1006686425 6:35838369-35838391 CCTCGCAAGCTCATTGTGGCAGG - Exonic
1007726261 6:43917648-43917670 TTTCCCAATCACAGTGTGGGGGG - Intergenic
1009221548 6:60990243-60990265 CTTAAAAAGCTCAGTTTGGCAGG + Intergenic
1010594782 6:77750008-77750030 CTTATGAAGCTCAGTGTGGCTGG - Intronic
1014656112 6:124106203-124106225 CTTCACAAGCACTATGTAGTAGG - Intronic
1014684431 6:124478008-124478030 CTTCAAAGGAAAAGTGTGGCAGG - Intronic
1014908727 6:127063345-127063367 CTTCACAAGAACACTTTCGCTGG + Intergenic
1015132694 6:129831912-129831934 CTTCAGAAGCAGAGTGTTGGGGG + Intronic
1018218548 6:161554979-161555001 TTTCACAAGCATACTGTGTCAGG + Intronic
1018702555 6:166438600-166438622 CCGCACAAGCTCAGTGGGGCTGG - Intronic
1021549648 7:21856407-21856429 TCTAACAAGCACAGTGTGGTTGG + Intronic
1022881919 7:34596642-34596664 CTTCTCAGGCACATTGTGACTGG + Intergenic
1023559916 7:41463039-41463061 CTTCCCAAGCTCACTGTGGCTGG - Intergenic
1024302632 7:47899461-47899483 CTTCAGAAAGACAGAGTGGCTGG - Intronic
1024310721 7:47966567-47966589 CCTGACAAGCACAGTGTGAATGG - Intronic
1024585733 7:50840370-50840392 CTGCACAAGGACAGTGGGGTGGG - Intergenic
1024970725 7:55067286-55067308 ATTCAGAAGCACAGTGTGAAGGG + Intronic
1025197521 7:56944307-56944329 CTTGAGGAGCCCAGTGTGGCAGG - Intergenic
1025674426 7:63632632-63632654 CTTGAGGAGCCCAGTGTGGCAGG + Intergenic
1028745709 7:94324038-94324060 CTTCAGAACCACAGTATTGCAGG - Intergenic
1029584484 7:101461727-101461749 CATCACATCCACACTGTGGCTGG + Intronic
1036713916 8:11102422-11102444 CTTGAGAAGCACAGTGCAGCTGG - Intronic
1037662376 8:20939063-20939085 TTTAACAAGCTCAGTGAGGCGGG + Intergenic
1037720773 8:21441943-21441965 CTTCATTCGCACAGTGAGGCAGG - Intergenic
1037762789 8:21752941-21752963 CTTAACAGGCACAGTGTCGGTGG - Intronic
1039255849 8:35718358-35718380 TCTCTCAAGTACAGTGTGGCTGG - Intronic
1040730475 8:50441094-50441116 CTGGACAAGGACAGTGTGGTGGG + Intronic
1041202785 8:55467098-55467120 CTTCCCAAGCTCCCTGTGGCTGG + Intronic
1041878733 8:62721512-62721534 CTTAAGAAGCACAGTTTGGCTGG - Intronic
1051309000 9:15748712-15748734 CTTAAGAAGCATAGTTTGGCTGG - Intronic
1053878619 9:42568665-42568687 CTGCACATGCTCAGTGAGGCCGG + Intergenic
1053894047 9:42725713-42725735 CTGCACATGCTCAGTGAGGCCGG - Intergenic
1054233071 9:62533030-62533052 CTGCACATGCTCAGTGAGGCCGG - Intergenic
1055009089 9:71543981-71544003 CTTCAAAAGCACAATGCGGCCGG + Intergenic
1055194061 9:73565202-73565224 CTTCATAACCACAGTATGACTGG + Intergenic
1055631837 9:78232738-78232760 TTTCACAAGAACAGTATGGGGGG + Intergenic
1061158080 9:128877192-128877214 ATTCAAAAGCAAAGGGTGGCTGG - Intronic
1061566976 9:131447318-131447340 CTTAACCAGCTCAGCGTGGCAGG + Intronic
1061728705 9:132596808-132596830 CTTCAGCAGGACAGTGGGGCAGG + Intronic
1061728863 9:132597810-132597832 CTTCACAAACACCGTGGGTCTGG + Intronic
1186445365 X:9623046-9623068 CTTCAGAAAAACAGTATGGCAGG - Intronic
1187096626 X:16155617-16155639 CTGCCAAAGCAGAGTGTGGCAGG + Intergenic
1191676824 X:63799647-63799669 CTTATGAAGCATAGTGTGGCTGG - Intergenic
1192144766 X:68674545-68674567 GTTCCCAAGCACTCTGTGGCTGG - Intronic
1194735423 X:97507075-97507097 CTTCACAAGGAAAATGTTGCTGG + Intronic
1196173774 X:112617817-112617839 CATCACGAGAACAGTGTGGGGGG - Intergenic
1198384096 X:136111805-136111827 CTGGACAAGGATAGTGTGGCTGG - Intergenic