ID: 987581419

View in Genome Browser
Species Human (GRCh38)
Location 5:19798289-19798311
Sequence GTGAAAAATATTGCCAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987581417_987581419 11 Left 987581417 5:19798255-19798277 CCTGGTTCTAATATCAAACTCTT 0: 1
1: 0
2: 3
3: 14
4: 160
Right 987581419 5:19798289-19798311 GTGAAAAATATTGCCAATGAGGG 0: 1
1: 0
2: 4
3: 30
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987581419 Original CRISPR GTGAAAAATATTGCCAATGA GGG Intronic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
907821248 1:57971808-57971830 ATGAAAGATATTGCCATTGGTGG - Intronic
907917446 1:58883914-58883936 GTCAAAAAGATAGCCAAAGAAGG + Intergenic
909097219 1:71302610-71302632 GTGAATAAGAGTTCCAATGATGG - Intergenic
909138382 1:71831320-71831342 GAGAAAAAAATTGCAAATAAAGG + Intronic
910218869 1:84869447-84869469 GTGAAAAAGATTGCACAGGATGG + Intronic
910559147 1:88571525-88571547 GTGAAAGAAATTGCCAAAGAAGG - Intergenic
912005913 1:104901730-104901752 GTGAAAGATATTGATAATGGAGG + Intergenic
913024784 1:114826673-114826695 TTGGAAAATATTACCATTGAAGG + Intergenic
913548647 1:119895269-119895291 ATGAACAATACTGCCAATGTAGG - Exonic
914396762 1:147276985-147277007 GTGAGAAACATTGCAAAAGAAGG + Intronic
914449090 1:147774773-147774795 ATGAAAAATATAGCCCATTAAGG - Intergenic
914857598 1:151363915-151363937 GTGTAATATATTTCCACTGATGG - Intergenic
917665875 1:177224940-177224962 TTGAAAATTATTGCCAAGGAGGG - Intronic
917919673 1:179740867-179740889 TTGCAAGATATTACCAATGAGGG + Intergenic
918454261 1:184691255-184691277 GGGAAAAGTATTGCAAATAAGGG + Exonic
918859568 1:189805147-189805169 ATTAAGAACATTGCCAATGATGG + Intergenic
919264382 1:195242727-195242749 GTAAAAAATATAGTCACTGAAGG - Intergenic
920278433 1:204825811-204825833 ATGCAAAATATTGCTAATCAGGG + Intergenic
920727746 1:208452341-208452363 ATGAAAGATATTGCCAATGTGGG - Intergenic
921430318 1:215057929-215057951 GTGAATAGTAGTGACAATGAGGG + Intronic
921552069 1:216549333-216549355 GAGAAAAATATTGGAAAGGAGGG + Intronic
922004375 1:221514569-221514591 ATGAAATATATTCCCAATAATGG + Intergenic
922534337 1:226368766-226368788 GTAAAAACTAATTCCAATGAAGG - Intronic
923136313 1:231123209-231123231 GTGAAGAATGTTCCCAGTGAAGG - Intergenic
923175780 1:231463509-231463531 TATAAAAATATTCCCAATGAAGG + Intergenic
923199763 1:231699979-231700001 GAGAAAAATATTCCCACAGAGGG - Intronic
924406972 1:243758254-243758276 GAGAAAAATATAGCAAAGGAGGG + Intronic
924720537 1:246618934-246618956 TTGAAGACTATTGCCAAAGAAGG - Intronic
1063723640 10:8612361-8612383 ATGAAAATTATTGTCAATAAAGG + Intergenic
1066691756 10:38035618-38035640 GTAAAAAATAGTATCAATGAAGG - Intronic
1067042737 10:42963636-42963658 GTGAAAAAAAAAGCCAATGCCGG - Intergenic
1067795867 10:49321459-49321481 GTGAACAAAATTTCCATTGATGG - Intronic
1067915801 10:50396770-50396792 GTGAAAAATAATGCCACTTGTGG - Intronic
1068314933 10:55328548-55328570 CTGAATAATGATGCCAATGATGG - Intronic
1068367566 10:56069987-56070009 GTAAAAAAGATTTCCAAGGATGG - Intergenic
1068831718 10:61503747-61503769 CTGACAAATATTGCGAATGTTGG + Intergenic
1069063313 10:63916525-63916547 GAGGAAATAATTGCCAATGATGG - Intergenic
1070047921 10:72857733-72857755 GTGAAAATTATTCCAAAAGAGGG + Intronic
1071119852 10:82264652-82264674 TTTAACAATGTTGCCAATGAAGG + Intronic
1071252449 10:83834303-83834325 GTGCAAAGTATTGCCAATGAGGG - Intergenic
1071592584 10:86888846-86888868 GTGAAAATTATTGAAACTGAAGG + Intronic
1071887835 10:89970103-89970125 GTGAAACAAATTGCCATTTAGGG + Intergenic
1074626099 10:115188136-115188158 GGGAAAAATATTGACAATTAGGG + Intronic
1075434162 10:122420163-122420185 GTGAAAAATATGGACATTGGTGG + Intronic
1076210446 10:128638274-128638296 TTGAAAAATATTCCAAATGTGGG - Intergenic
1079639117 11:22782086-22782108 GTGAAAAATAATGCAAATATTGG + Intronic
1079679171 11:23272100-23272122 GTGAAGAACATTGGCAATGGTGG - Intergenic
1082761306 11:57129745-57129767 GTGAAAATCATATCCAATGATGG - Intergenic
1083925931 11:65806585-65806607 GTGAAAATTCTTGCCAATTTAGG + Intergenic
1084737623 11:71115921-71115943 GGGAAAAAAATTGTCATTGAGGG - Intronic
1085616428 11:78002991-78003013 GTGGAAAATATAGGCAATTAAGG - Intergenic
1085719039 11:78897169-78897191 GTGTGAAATGTTGCCAATCAGGG - Intronic
1088051663 11:105523622-105523644 GTGAAAAATGTTGTCAGAGATGG + Intergenic
1088170841 11:106994748-106994770 GTGAAATAAATTACCAATGGAGG - Intronic
1089316144 11:117592713-117592735 CTGAAAAATGAGGCCAATGATGG - Intronic
1091668997 12:2439003-2439025 GTGACAGATATTACCAATCAGGG - Intronic
1093160031 12:15735816-15735838 TTTAAAAATATTGCCAATTATGG - Intronic
1094804817 12:34079238-34079260 GTAAAAAATTATTCCAATGAAGG + Intergenic
1095596161 12:43960536-43960558 GTGAAAAACATAGTCAATGTTGG + Intronic
1096429282 12:51530018-51530040 GTGCAAAATATTACCAACCAGGG - Intergenic
1097698054 12:62793816-62793838 GAGAAAAATATTGCCCGGGATGG + Intronic
1097909396 12:64953087-64953109 AAGAAAAATATTGCAAATGTGGG + Intergenic
1097936527 12:65258219-65258241 GTGAAATATATTGAGAATGATGG + Intergenic
1098536252 12:71596783-71596805 GAGAATAATAGTGCAAATGATGG + Intergenic
1099552486 12:84065354-84065376 GTGACAAGTACTGCCAATGACGG - Intergenic
1099701868 12:86094061-86094083 GTGTAAAATATGTTCAATGAGGG + Intronic
1099945104 12:89234983-89235005 GAGAAAAATAAAGCAAATGAGGG - Intergenic
1100240485 12:92706426-92706448 GTGAAATATGTAGCAAATGAGGG - Intronic
1100702126 12:97160251-97160273 GTGTGAAGTATTACCAATGAGGG + Intergenic
1101636028 12:106542124-106542146 GATAGAAATATTGACAATGAAGG - Intronic
1103563926 12:121806064-121806086 GTGGATAATGTTGCCCATGACGG - Exonic
1106888278 13:34214383-34214405 CTGAAAAATGTTGCTAAAGAAGG - Intergenic
1107951911 13:45470616-45470638 GTGCAAAATGTTACCATTGAGGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109048081 13:57438661-57438683 GTTAAAAATAATACCAAGGAAGG + Intergenic
1109702163 13:66040358-66040380 ATGAACAATTTTGCCAAAGACGG + Intergenic
1109825874 13:67721490-67721512 GTGAAAAACACTGGCGATGATGG + Intergenic
1109953995 13:69541494-69541516 GTGACAAATATTATCCATGAAGG - Intergenic
1109961819 13:69640937-69640959 GTGAAAATTACTGCCAAAGAAGG + Intergenic
1110888186 13:80665293-80665315 GTGAAAAATATTTCCAAATTTGG - Intergenic
1112209249 13:97358620-97358642 GTGAAAAACATGGTCAATTATGG - Intronic
1115746278 14:36441013-36441035 ATGAAAAATATTTGCAATGATGG - Intergenic
1117197117 14:53351810-53351832 GTGAAATATATTTTCAAAGATGG + Intergenic
1117556372 14:56889351-56889373 GTTAAAAATATTTCCAATAAAGG - Intergenic
1118279733 14:64417733-64417755 GAGAATATTATTGCCAAAGAAGG + Intronic
1118794359 14:69127703-69127725 GTGGAAGATGTTGACAATGAAGG + Intronic
1120254480 14:82101705-82101727 GTAAAAAAGATTGCCAAAAATGG - Intergenic
1120389733 14:83890185-83890207 GAGAAAAATCTTGCCAAAAAGGG + Intergenic
1122053569 14:99076923-99076945 GTGAAAAATGTTTCCATAGAAGG + Intergenic
1122767718 14:104083299-104083321 GTGAGGATTATTGCCAGTGAAGG + Intergenic
1126176308 15:45739013-45739035 GTGAAAAATACGGCAAATTATGG + Intergenic
1126928500 15:53619563-53619585 GTGAAAAATATTGCTCATCTTGG + Intronic
1129549396 15:76431347-76431369 TTGAAAAATATTTCCAAGAATGG + Intronic
1129567456 15:76638047-76638069 GTAAAAGATATTGGTAATGAAGG - Intronic
1129666828 15:77583979-77584001 GTCAACAATCTTGCCAAAGAAGG + Intergenic
1136683286 16:31980142-31980164 GGGAGAAATATGGCCAGTGAAGG + Intergenic
1136783919 16:32923698-32923720 GGGAAAAATATGGCCAGAGAAGG + Intergenic
1136885864 16:33930108-33930130 GGGAAAAATATGGCCAGAGAAGG - Intergenic
1137243730 16:46684369-46684391 TTGTTAAATATTGCCAAGGAGGG - Intronic
1137784815 16:51129766-51129788 ATGATAAATATTTCAAATGATGG - Intergenic
1137830623 16:51539853-51539875 ATGAAAAATATTGAGAATGCAGG - Intergenic
1138996842 16:62465378-62465400 GTGAAGAATATTTTCAATAAAGG + Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1147144195 17:38475854-38475876 GGGAAAAATATGGCCAGAGAAGG + Intronic
1147300010 17:39518858-39518880 GTAAAAAATATGGCCAATTCTGG - Intronic
1148082314 17:44974180-44974202 GTGAAGAATATGGCCACTGGAGG + Intergenic
1149316511 17:55443884-55443906 CTAAAAAATATTCCCAATGGAGG - Intergenic
1149364751 17:55931982-55932004 GTGTAAAATGTTCTCAATGAAGG - Intergenic
1149799471 17:59553573-59553595 GTGAAAATTTTAGCCAAGGAAGG - Intergenic
1151144908 17:72031514-72031536 GTGAAATTGATTGGCAATGAGGG - Intergenic
1153241478 18:3035062-3035084 TTGAAAGATGTTGCCTATGATGG - Intergenic
1155747436 18:29376299-29376321 GTGAATGATATTGCCTGTGATGG - Intergenic
1156068907 18:33180353-33180375 GTGAAAAAAATTACTAATAAAGG - Intronic
1157031677 18:43917894-43917916 GTGAAAAATATTTCTACTAAAGG - Intergenic
1157637491 18:49173552-49173574 TTGAAAAATAATGCCATTTACGG - Intronic
1157745537 18:50131980-50132002 GGAAAAAATAGTGCCAATGGGGG - Intronic
1159069417 18:63606428-63606450 TTGAAAACTATTACCAAAGAAGG - Intergenic
1159343917 18:67173634-67173656 GTGAAAAATATTGTTATTGCAGG - Intergenic
1159369683 18:67515262-67515284 CTGAAAAATATTTGAAATGAAGG - Exonic
1159669912 18:71210611-71210633 ATGACAAGTATTGCCAAGGAAGG - Intergenic
1159769535 18:72532518-72532540 TGTAAAAATATTGCAAATGAGGG + Intergenic
1159846589 18:73468427-73468449 GTAAAAAATATTTCAAATGAAGG - Intergenic
1160233114 18:77063700-77063722 GTGAAAACTACTGGAAATGATGG - Intronic
1162987740 19:14282102-14282124 GTGTAAAATATTGCCCAGGCTGG + Intergenic
1168431227 19:56282421-56282443 GGGAACCATATTGCCAATGAAGG - Intronic
928669656 2:33588850-33588872 GTTAAAAATTTTGCAAAAGAAGG + Intronic
929001827 2:37354339-37354361 GTGAAGAATAATAGCAATGATGG + Intronic
930367450 2:50458463-50458485 GTGATAAATATTTTAAATGATGG + Intronic
930559326 2:52940826-52940848 GTGAAAATTGTTGACAATAATGG + Intergenic
931126239 2:59280646-59280668 GGAGAAAATATTGTCAATGATGG + Intergenic
933061101 2:77737581-77737603 CTGACAAATGTTGCCAAGGAAGG + Intergenic
933561685 2:83895132-83895154 ATGAAAAACATTGCAAAAGAAGG - Intergenic
935776083 2:106473058-106473080 GAGAAAAAAATTGCCAAGGTTGG + Intergenic
936753201 2:115672425-115672447 GTAAAAAATATTGAAAATGAAGG + Intronic
936929250 2:117770104-117770126 CTGAGTAATATTGCCAGTGAGGG + Intergenic
937706380 2:124925555-124925577 GAGAAAAATATTGCCCCTGATGG - Intergenic
938815117 2:134895005-134895027 GTGAAAAATATAGCCAAAAAAGG + Intronic
939028723 2:137044976-137044998 GAGAAACATGTTGCCATTGATGG - Intronic
940837389 2:158538345-158538367 GAGAACAATATGGCCAATCATGG + Intronic
943300615 2:186193367-186193389 GTAATAAATATTGAGAATGAAGG + Intergenic
943374947 2:187065104-187065126 TACAAAAATATTGCCAATTAAGG + Intergenic
943499873 2:188674417-188674439 CTGAAAAATAGAGTCAATGAAGG - Intergenic
943579468 2:189668212-189668234 GTGAAAAATACTGTCAAAGTAGG + Intronic
944277594 2:197856794-197856816 GTCACAAATATTGCAAATAATGG - Intronic
944297368 2:198081875-198081897 TTTTAAAATATTTCCAATGAAGG + Intronic
1169621043 20:7506891-7506913 GTGCAAAACATTGCTGATGATGG + Intergenic
1171215222 20:23347606-23347628 GAGAACAACATTGACAATGAGGG + Intergenic
1171482230 20:25462611-25462633 AATAAAAATATAGCCAATGATGG - Intronic
1171960340 20:31488988-31489010 GTTAAAAATAATACGAATGATGG + Intergenic
1172972196 20:38881749-38881771 GTCAAGAACATTGCCAATAAAGG - Intronic
1173071479 20:39772113-39772135 ATGAAAAATATTTGCAATAAGGG - Intergenic
1173299636 20:41790373-41790395 GCAAAAAATATTTCCATTGATGG - Intergenic
1175620243 20:60438733-60438755 TTGCAAAATGTTACCAATGAAGG - Intergenic
1177373953 21:20243182-20243204 GGGAAAAATATTGCCAGTTAAGG - Intergenic
1178343846 21:31808359-31808381 ATGAGAAATATTCCCAGTGATGG + Intergenic
1179119803 21:38532661-38532683 CTTGAAAATATTGCAAATGATGG - Intronic
1184456315 22:44611827-44611849 TTGCAAAATATTGCCATCGAAGG + Intergenic
949699893 3:6744660-6744682 GTGGAAATAATTGCCAGTGAAGG + Intergenic
950915461 3:16640548-16640570 CTGAAAAATGTTTGCAATGAAGG - Intronic
951344789 3:21534733-21534755 GGGAAAACTGTTGCCAGTGATGG + Intronic
951500852 3:23385097-23385119 ATGAAAAATACTTCTAATGATGG + Intronic
954343167 3:49972283-49972305 GTGCAAAATATTAACACTGAGGG - Intronic
954419757 3:50412574-50412596 AAGAAAAACATGGCCAATGAGGG - Intronic
954484047 3:50829513-50829535 GAGAAAAATGTTGACATTGAGGG - Intronic
955490152 3:59473610-59473632 GTGAAAAATCTTCCTAATGAAGG + Intergenic
955546226 3:60033543-60033565 GATAATAATATTGCCAATTAGGG + Intronic
959297979 3:104561646-104561668 GGGAAGAATTTGGCCAATGAAGG + Intergenic
959563469 3:107809599-107809621 GTGGAAAATAGTGGCACTGAAGG - Intronic
959985163 3:112563512-112563534 GTGAAGTATTCTGCCAATGAAGG + Exonic
962536331 3:136332490-136332512 GTGAAATATATTGAGAATAATGG - Intronic
965798919 3:172471160-172471182 GTGAAAAATTCTTACAATGAAGG + Intergenic
965839439 3:172886922-172886944 GTGATAAATATTTGCAGTGAGGG - Intergenic
965860025 3:173137330-173137352 ATAAAAAATATTGCGAATTAGGG + Intronic
965952958 3:174333209-174333231 GTGATAAATATTTAAAATGATGG + Intergenic
966669613 3:182512598-182512620 CTTAAAGATATTGCCACTGAAGG + Intergenic
969144754 4:5112798-5112820 GTGAAGAACATTTCCAAAGAAGG + Intronic
969903368 4:10370611-10370633 TTGAAATATATTCCCATTGAAGG - Intergenic
970570814 4:17380676-17380698 GTCAAAATTAATGCTAATGACGG + Intergenic
971717626 4:30199837-30199859 GTAAACCATATTGCTAATGAGGG - Intergenic
975591977 4:76010154-76010176 GTTAAAATTAATGCCAAGGACGG + Intergenic
975842471 4:78489585-78489607 ATTAAAAATATTGTCAATTATGG - Intronic
976783334 4:88786832-88786854 GTGAAAAAGAATGCGAATGAGGG + Intronic
976960249 4:90962564-90962586 GTTAAAAATATTACCTATGTGGG - Intronic
977188820 4:93974778-93974800 GTAAAATATATTACCAATAATGG - Intergenic
978250318 4:106622996-106623018 GAGAAAATTTTTGCCAGTGATGG - Intergenic
978704228 4:111686234-111686256 GTGACAACTATTCCCAATTATGG + Intergenic
980609217 4:135135757-135135779 TTTAAAAATAATTCCAATGAAGG + Intergenic
980741690 4:136958061-136958083 CTGAAAAACATTGACAAAGATGG + Intergenic
981108777 4:140911664-140911686 GTGAAATTTATTTACAATGAAGG + Intronic
983670262 4:170228997-170229019 CTGAAAAATATTCCCAAAGCTGG - Intergenic
984229820 4:177081442-177081464 ATGAAGAATATTGCCAGTGAGGG - Intergenic
985205252 4:187528988-187529010 ATGAAAAATAATGGCTATGAAGG - Intergenic
985334729 4:188879469-188879491 GTGAAAAATTGTGACAAGGAAGG + Intergenic
985885410 5:2673601-2673623 GTGTAAAATATTGTCAACCAGGG + Intergenic
986263076 5:6165809-6165831 GTGAGAAACATGGCCAAGGAAGG - Intergenic
987509790 5:18822697-18822719 GAGAAACAAATTGCCACTGATGG + Intergenic
987518037 5:18940336-18940358 GTGAAAAATATTGATAATGAAGG + Intergenic
987581419 5:19798289-19798311 GTGAAAAATATTGCCAATGAGGG + Intronic
988080891 5:26413975-26413997 GTTAAAAATATTTCCATTTAAGG + Intergenic
988825930 5:34934608-34934630 GTGACAGATATTACTAATGATGG + Intronic
989965663 5:50463779-50463801 GTTAAAAAAATTGAAAATGAAGG - Intergenic
990766288 5:59187028-59187050 GTTAAAAATTTTGCCTAGGAAGG - Intronic
990920733 5:60963387-60963409 TTCAAAAATCTTGCCAGTGAGGG - Intronic
991042142 5:62187359-62187381 GTGAAAATTATTATCAATGCAGG + Intergenic
991438389 5:66619364-66619386 GAGAAAAATATTCCTAACGAAGG - Intronic
991903993 5:71489403-71489425 GTGAAAAAAGTTGCCTGTGAAGG + Exonic
992319778 5:75602128-75602150 GTGCAAAATATTGCCAACCAAGG + Intergenic
992621357 5:78596557-78596579 GTCACAAAGATTGCCAAGGAAGG - Intronic
995054879 5:107747854-107747876 GGGGAAAATATTGCCAATAATGG - Intergenic
995865969 5:116691348-116691370 GTTTAAAATATTGTTAATGAGGG - Intergenic
996096038 5:119400310-119400332 GTACAAAATATTGCCAACCAGGG + Intergenic
996287805 5:121815413-121815435 GTGAAAACTATTGACTATAAGGG - Intergenic
996300741 5:121981248-121981270 CTGAAAAATGTAGCCAGTGAAGG + Intronic
996577222 5:124988633-124988655 GTCAAAAATATTGCCAAGGTAGG + Intergenic
997429604 5:133828365-133828387 GTGAAAAATCCTGTCACTGAGGG - Intergenic
1001233617 5:170010888-170010910 GTGCAAAACAATGGCAATGAAGG - Intronic
1003211988 6:4077024-4077046 GTGAAAAATATTGGTAAGGCAGG - Intronic
1005774518 6:29116259-29116281 ATTAAAAATATTGCCAAACAGGG - Intergenic
1008448488 6:51621516-51621538 GGGGAAAAGATTTCCAATGAAGG - Intronic
1009404259 6:63292642-63292664 GTGAGGAATATTGCCAACCAAGG - Intronic
1009922848 6:70084373-70084395 TTGAAAAATATGGCTATTGAGGG - Intronic
1010410166 6:75552383-75552405 GGGAAAAATATTGCAACTCATGG + Intergenic
1010540811 6:77089820-77089842 GTGAAATAGAATGCCAATGGAGG - Intergenic
1010574160 6:77511449-77511471 GTGAGAAATTTTGGCAATGGTGG + Intergenic
1010627425 6:78155379-78155401 GTATAAAATATTGCCAACCAGGG - Intergenic
1010776189 6:79888775-79888797 GTAAAAAATATTTACAATGCTGG + Intergenic
1011525767 6:88263361-88263383 GTGACAATGATAGCCAATGAAGG + Intergenic
1014196660 6:118567845-118567867 GGGAAAAACATTACAAATGAAGG + Intronic
1014433313 6:121394681-121394703 TTCAAAAATATTCCCAATAAAGG - Intergenic
1014845246 6:126268003-126268025 ATGAAAAATTGTGCAAATGATGG + Intergenic
1014863709 6:126503454-126503476 GTGCAAAATATGGCAAATAAGGG - Intergenic
1015066726 6:129038979-129039001 GAGAAAAATATGGCAAATGAAGG - Intronic
1016157847 6:140835244-140835266 GTGAATAATATAGCAAATGATGG + Intergenic
1016233134 6:141830467-141830489 GTAACAAGTATTGCCAAAGAAGG + Intergenic
1016782818 6:147978580-147978602 GTGAAAAATATTCCTTATCAAGG - Intergenic
1017568880 6:155720378-155720400 GTGATAAATATTTACAGTGATGG + Intergenic
1019812414 7:3174448-3174470 GTGAAAAATAATGCCAACGTTGG + Intronic
1022070842 7:26912280-26912302 GTGAAGCATTTTGCCACTGATGG + Intronic
1022859518 7:34352794-34352816 ATGCAAAATATTGTCATTGAGGG + Intergenic
1023726146 7:43144181-43144203 GAGAAAAAAAGTCCCAATGAAGG - Intronic
1024268914 7:47627587-47627609 ATGACAAGTATTGCCAAGGAAGG + Intergenic
1024509161 7:50189624-50189646 GGGAAAAAAATTGTTAATGAAGG + Intergenic
1028239123 7:88398018-88398040 GTGATAACTTTTTCCAATGATGG + Intergenic
1028918115 7:96282055-96282077 GTGAAAAATATTCCCAAAGAAGG - Intronic
1029676568 7:102073789-102073811 GTGAAGAATATTACCAATATAGG - Intronic
1030981730 7:116193520-116193542 GTGAAAAATATGCCAAATAAGGG - Intergenic
1031285511 7:119861455-119861477 GTGGAAAATAGTGCCAATAGTGG - Intergenic
1033380234 7:140809755-140809777 GTGGAGAATATGGCCATTGAGGG - Intronic
1035005396 7:155654041-155654063 TTAAAAAATATTGCAAAAGATGG + Intronic
1037517367 8:19646111-19646133 GTGAAGAAGATTGGCAGTGATGG + Intronic
1039333352 8:36563145-36563167 GTGAACCCTAATGCCAATGATGG + Intergenic
1041447890 8:57973192-57973214 TTGAAAAAGATGGCCAATGTTGG - Intergenic
1042400848 8:68344522-68344544 TTGCAAAATATTACCAATGGAGG + Intronic
1042652259 8:71056202-71056224 GTTATAAATATTAACAATGAAGG + Intergenic
1043406631 8:79941850-79941872 GTGACAAATATTGTAAATTAGGG + Intronic
1043539805 8:81248033-81248055 GTCAAAAAAATTGCCATGGATGG - Intergenic
1044009855 8:86981312-86981334 GGGGAAAATATAGCAAATGAAGG - Intronic
1044787607 8:95811173-95811195 GTGATAAATATTTGAAATGACGG + Intergenic
1046159307 8:110339246-110339268 GTGAAACACTTTCCCAATGAAGG - Intergenic
1046766858 8:118079063-118079085 ATGAAAAATCTTGTCTATGAGGG - Intronic
1046952497 8:120031728-120031750 AAGAAAAATGTTGGCAATGATGG - Intronic
1047088774 8:121550117-121550139 GTGCAAGATATTGCCATTGGCGG - Intergenic
1048828161 8:138449750-138449772 GTGAGAAATATTGATAATGGGGG - Intronic
1048880624 8:138869626-138869648 GTGAAAATTACTGAAAATGATGG - Intronic
1050620200 9:7444204-7444226 GAGAAAAATGTTTTCAATGAAGG + Intergenic
1052422483 9:28261054-28261076 GTAAAAAATAATGGCAATTAAGG - Intronic
1052503676 9:29325390-29325412 GTTAAAAATTTTCTCAATGATGG - Intergenic
1054855061 9:69890355-69890377 GTGAACAAAATTGCAAATAAAGG - Intronic
1055104467 9:72498323-72498345 TTGAGAAATATTGCCAATGAAGG - Intergenic
1055216309 9:73867154-73867176 ATCAAAAATATCTCCAATGATGG - Intergenic
1057385286 9:94601146-94601168 GTTAAAAATATTGCCAAGCTTGG + Intergenic
1058303246 9:103403022-103403044 GTAACAAATATTGCCAAGGATGG + Intergenic
1058924757 9:109652054-109652076 GTGAAAAAGATTACACATGATGG - Intronic
1061462267 9:130749875-130749897 TTAAAAAATATTGCCAAGGCCGG + Intronic
1061920543 9:133780100-133780122 GTGAAATATATTGCCAGGGTGGG - Intronic
1186575911 X:10765591-10765613 GCCAAAAATGTTGCCAATGTGGG + Intronic
1187493199 X:19772196-19772218 ATTTAAATTATTGCCAATGATGG + Intronic
1188442089 X:30222845-30222867 GTGAAAAATATTAACAAAGTGGG + Intergenic
1189616219 X:42787114-42787136 GTGAAAAATGAGGCCTATGAAGG - Intergenic
1190179538 X:48180361-48180383 GTGAAAAATATAGACATTAAGGG - Intergenic
1192475660 X:71439851-71439873 ATGTAAGATATTGCCATTGAAGG - Intronic
1193272816 X:79548681-79548703 GTTAAAAATATTCCAAATGATGG + Intergenic
1193545841 X:82827707-82827729 CTGCAAAATATTGCCAATTATGG + Intergenic
1193752727 X:85366162-85366184 TTGAAAAATAATGCTGATGAAGG + Intronic
1194567730 X:95513914-95513936 GTGAAAAATATATTCAATCATGG + Intergenic
1194599379 X:95901639-95901661 GGAAAAAATATTGCCAGTGGAGG + Intergenic
1195268146 X:103203756-103203778 GTGAAAAATGTTGCCACAAAAGG - Intergenic
1195558917 X:106261142-106261164 GTGAAAAATCTTGCAACTGCTGG - Intergenic
1195804197 X:108744556-108744578 GTGAAAAATTTTGTCAAAGAGGG - Intergenic
1196553310 X:117056716-117056738 GGGAAAGACAATGCCAATGATGG + Intergenic
1196630385 X:117932145-117932167 ATGATAAATATTGCAGATGATGG - Intronic
1197857781 X:130935153-130935175 GTTAAAAATATTGACAATTCAGG + Intergenic
1198624424 X:138553701-138553723 GTGCAAGATCTTTCCAATGAGGG + Intergenic
1200934021 Y:8722590-8722612 GTGTCCAGTATTGCCAATGAGGG + Intergenic
1201624203 Y:15996226-15996248 GTGAATAATGTTGCTAATCAAGG - Intergenic