ID: 987582043

View in Genome Browser
Species Human (GRCh38)
Location 5:19806527-19806549
Sequence ACGATATAAATCTTTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987582043_987582044 15 Left 987582043 5:19806527-19806549 CCAATGTCAAAGATTTATATCGT 0: 1
1: 0
2: 2
3: 8
4: 131
Right 987582044 5:19806565-19806587 CTAGTTCAATATTCCTTCTTCGG 0: 1
1: 0
2: 0
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987582043 Original CRISPR ACGATATAAATCTTTGACAT TGG (reversed) Intronic
909274861 1:73670580-73670602 ACAATATAACTCATTGTCATTGG + Intergenic
909688213 1:78374979-78375001 ACTCTATATATCTTTGTCATTGG - Intronic
909970867 1:81987313-81987335 ATGATATAAATCTTGAAGATGGG - Intronic
912750934 1:112286882-112286904 ATGATCTAAATATTTGAAATGGG - Intergenic
914885208 1:151578923-151578945 TAGCTATAAATGTTTGACATGGG - Intronic
922064090 1:222119374-222119396 AGGAAAAAGATCTTTGACATTGG + Intergenic
1063193179 10:3717217-3717239 ACGGTATTAATCTGAGACATAGG + Intergenic
1065563231 10:26984319-26984341 ACAATATCAACCTTTGACTTGGG - Intergenic
1068438963 10:57027119-57027141 AAGATAAAAATATTTGATATGGG + Intergenic
1074995258 10:118751693-118751715 ACCATATAAATTTTAGACTTAGG + Intronic
1075605986 10:123808834-123808856 ACTATATAAATCTTTGCTAAAGG - Intronic
1078886408 11:15504412-15504434 ATGATAAAAATCTTTCACCTGGG + Intergenic
1080336260 11:31200470-31200492 ACGATATAAATTTTTGAGTAAGG + Intronic
1081650786 11:44822799-44822821 ATGACATAAATCATTGACCTGGG + Intronic
1083079773 11:60078699-60078721 AAGTTATAAATGTTTGGCATAGG + Intergenic
1084655567 11:70515044-70515066 ACAAAATAAATTTTTGACACAGG + Intronic
1085361410 11:75891135-75891157 ACTATGTATACCTTTGACATAGG + Intronic
1086764537 11:90678099-90678121 ATGATATAAATCATTGAGATAGG - Intergenic
1087282748 11:96230287-96230309 AACATATAAATCTTTGAAAGAGG - Intronic
1089065879 11:115661605-115661627 ATCATATAGATATTTGACATTGG + Intergenic
1089142476 11:116297058-116297080 ACCATATAAATTTTTGATGTTGG - Intergenic
1092669837 12:10850568-10850590 AAGATATAAAACATAGACATAGG - Intronic
1095263689 12:40128468-40128490 AAGACAGAAATCATTGACATTGG - Intergenic
1098103981 12:67049996-67050018 AAGATGTAAACATTTGACATAGG - Intergenic
1101652149 12:106687051-106687073 CAGATTTAGATCTTTGACATTGG - Exonic
1105422765 13:20267486-20267508 AAGAAATAAACCTTTAACATTGG + Intergenic
1106620797 13:31368608-31368630 ATGGTATAAATCTTTGATTTTGG + Intergenic
1108515450 13:51198098-51198120 ACAATAAAAATAATTGACATAGG + Intergenic
1109449850 13:62497617-62497639 ACCATATAATGCTTTCACATTGG + Intergenic
1109451655 13:62522316-62522338 AAGAAATAAATATTTGACAGAGG + Intergenic
1109550989 13:63899956-63899978 ACCAGATTTATCTTTGACATAGG + Intergenic
1109703916 13:66063539-66063561 ACAATATAAATATTTGACATAGG - Intergenic
1112334322 13:98501444-98501466 ATGTTCTAAAACTTTGACATAGG - Intronic
1113480810 13:110619294-110619316 AAGATATGAATCTTGGATATTGG + Intronic
1115714754 14:36090811-36090833 ATGATAGAAATCTTGGACACTGG + Intergenic
1116124803 14:40770515-40770537 ACTAAGTAAATCTTAGACATTGG + Intergenic
1116652517 14:47611447-47611469 ACTATATATATATTTGACAAGGG + Intronic
1118178477 14:63466661-63466683 AGGAAATAAAGCTTTGAAATGGG - Intronic
1118237536 14:64022646-64022668 ACGATGTATATCTATGGCATGGG + Intronic
1121043351 14:90769011-90769033 AAGATATAATTTTGTGACATCGG + Intronic
1122720639 14:103720259-103720281 ATGAGGTAAATCTTTGACGTGGG + Intronic
1125323225 15:38510616-38510638 AGGATATAAATGTATGGCATGGG - Intronic
1146177077 17:30672419-30672441 ACTATATAACTCTTTGCCGTGGG + Intergenic
1146222728 17:31038934-31038956 ACTATATAACTCTTTGCCGTGGG + Intergenic
1146342267 17:32031076-32031098 ACTATATAACTCTTTGCCGTGGG - Intronic
1146350541 17:32088520-32088542 ACTATATAACTCTTTGCCGTGGG + Intergenic
1147233928 17:39042895-39042917 ACTATATAATTCTTTGCCGTGGG - Intergenic
1148173049 17:45539524-45539546 ACTATATAACTCTTTGCCATGGG + Intergenic
1148276217 17:46305926-46305948 ACTATATAACTCTTTGCCATGGG - Intronic
1148298334 17:46523501-46523523 ACTATATAACTCTTTGCCATGGG - Intronic
1148362875 17:47027974-47027996 ACTATATAACTCTTTGCCATGGG - Intronic
1150404257 17:64886447-64886469 ACTATATAACTCTTTGCCATGGG + Intronic
1156107806 18:33686980-33687002 ATGAGATAAATGTTTGACCTTGG + Intronic
1157397493 18:47355060-47355082 AAGATTTAAATGTTTGACATTGG - Intergenic
1158885449 18:61822907-61822929 AAAATATAAATATTTGAAATGGG + Intronic
925339082 2:3122248-3122270 ACGACATAAAAATTTGACAAAGG + Intergenic
925686377 2:6478025-6478047 ACGATATGGATTTTGGACATTGG - Intergenic
926817326 2:16812654-16812676 ACTATATATATGTTTGAAATGGG - Intergenic
929630034 2:43450326-43450348 AAGATATAAATCTGTGACATCGG + Intronic
931503664 2:62899701-62899723 ATCATGAAAATCTTTGACATAGG + Intronic
931635376 2:64336687-64336709 CAGATATAATTCTTTGTCATGGG + Intergenic
938431370 2:131243579-131243601 ACTTTAAAAATGTTTGACATGGG + Intronic
939100013 2:137884965-137884987 AAGATTTAAACCTATGACATAGG + Intergenic
939326060 2:140689997-140690019 AAAATATACATCATTGACATAGG + Intronic
939384008 2:141472913-141472935 AAGATGTAAATCTATGACAAAGG + Intronic
940246565 2:151624786-151624808 ACCATATACATTTTTGACTTTGG + Intronic
940364353 2:152830492-152830514 ACAATACATATCTTTGACAAAGG - Intergenic
941036730 2:160576883-160576905 ACTATAAAAACCTTGGACATAGG + Intergenic
942521617 2:176809781-176809803 GAGATTTACATCTTTGACATAGG + Intergenic
943942493 2:194017635-194017657 ACAATATAAATCTTCTACTTAGG + Intergenic
944998649 2:205323674-205323696 AGGATACAAATCTCTGTCATGGG + Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
1169934663 20:10870711-10870733 AGGATATATTTATTTGACATTGG + Intergenic
1174688922 20:52483441-52483463 ACAATATCCATCTTAGACATTGG - Intergenic
1175015755 20:55788288-55788310 ACCAGATAATTCTTTGTCATGGG + Intergenic
1177666496 21:24166444-24166466 ACGATTTCATTCTTTTACATTGG + Intergenic
1177822527 21:26047118-26047140 AAGAGGTAAATCTTTAACATAGG - Intronic
1179004406 21:37498314-37498336 ATGATAGAAATCTTTCATATTGG - Intronic
1180572430 22:16739817-16739839 AAGATTTAAATATTTGCCATAGG + Intergenic
1183728507 22:39603333-39603355 ATGAGAGAAATCTTTGACTTGGG + Intronic
950906150 3:16540283-16540305 AAGATATTAATCTTTGGCAGAGG + Intergenic
951060929 3:18206419-18206441 ACCATATAAATCTTTGTCAGTGG - Intronic
951864810 3:27296003-27296025 AAGATATAAATCTAAGATATTGG - Intronic
951943763 3:28111467-28111489 GCCATATAATTCTTTGTCATAGG + Intergenic
956998290 3:74852811-74852833 ACCAGATAAGTCTTTGTCATAGG - Intergenic
957105256 3:75879075-75879097 AAGATTTAAATATTTGCCATAGG - Intergenic
957836204 3:85593484-85593506 ACGATAGAAATCTCTCACAAAGG - Intronic
958522126 3:95203954-95203976 AGGATATCAATCCTTGACAAGGG - Intergenic
959258512 3:104045787-104045809 ACGTTATAAATCTTTCAAAGTGG + Intergenic
960414902 3:117372357-117372379 ACAACATAAATATTTGAAATAGG - Intergenic
961122995 3:124389574-124389596 ACCATCTAAATGTTTCACATTGG + Intronic
962713258 3:138105199-138105221 ATGATATATATCTTTCACTTTGG - Intronic
962775857 3:138659079-138659101 GCCATATAATTCTTTGATATGGG + Intronic
963079508 3:141377831-141377853 AGCATATAACTCTTTGAGATTGG - Intronic
964997972 3:162911091-162911113 AAGATACAAATTTTTAACATTGG + Intergenic
965768637 3:172157644-172157666 AGGATATAAGTTTTTGAGATTGG + Intronic
966542799 3:181110550-181110572 AAGATATAAACATTTGATATTGG - Intergenic
967743342 3:193027289-193027311 ACGATATATAGTTTTGAGATTGG + Intergenic
968535876 4:1128884-1128906 AAGATATACCACTTTGACATGGG + Intergenic
969975308 4:11093940-11093962 AAGAAATAAATCATTTACATGGG + Intergenic
971415686 4:26426597-26426619 ACTACATAAATCCTTTACATGGG - Intronic
973779650 4:54276486-54276508 TAGATATAAATATTTGAAATTGG - Intronic
975338178 4:73205796-73205818 AGGAGATAAATCTATGAAATGGG + Intronic
975691558 4:76969537-76969559 ATAAAATAAATCTTTGACTTTGG + Intronic
976012072 4:80502277-80502299 AAGATAAAAATCATTGCCATTGG - Intronic
977428065 4:96894411-96894433 AGAATATAAATATTTGACAAAGG + Intergenic
978262935 4:106784019-106784041 ACAATTGAAGTCTTTGACATAGG + Intergenic
978449961 4:108821834-108821856 TGTATATAATTCTTTGACATGGG - Intronic
980968607 4:139547922-139547944 ACTATACCAATCTTTGACCTAGG - Intronic
981220621 4:142229395-142229417 ACTATATAAGGCTTTGACAATGG + Intronic
981486628 4:145293735-145293757 AAGATATAAATCTATCAGATAGG + Intergenic
987477304 5:18406984-18407006 AGGAGAAAACTCTTTGACATTGG + Intergenic
987582043 5:19806527-19806549 ACGATATAAATCTTTGACATTGG - Intronic
989555985 5:42795641-42795663 ATGATTTAAACCTTTGAAATAGG - Intronic
991234438 5:64377554-64377576 ACAGTATAAATTTTTGACAGTGG + Intergenic
993110959 5:83656943-83656965 ACAATTTAAAACTATGACATTGG + Intronic
994046025 5:95310665-95310687 AGAATACAAAACTTTGACATAGG + Intergenic
996422211 5:123274986-123275008 ACTATATAATTCTTTGATTTGGG - Intergenic
996899105 5:128523274-128523296 AAGGTATAAATCTTTGCTATTGG + Intronic
999082881 5:148860925-148860947 ACCAGATAATTCTTTGCCATGGG + Intergenic
1009030064 6:58046148-58046170 ATCAGATAAATCATTGACATGGG - Intergenic
1009205594 6:60797379-60797401 ATCAGATAAATCATTGACATGGG - Intergenic
1009799850 6:68523042-68523064 ACAATCTATATCTTTGACAAAGG - Intergenic
1009925847 6:70119788-70119810 ACTATATAAATGTTTGCTATTGG + Intronic
1014804724 6:125816333-125816355 TCAAAATAAATCTATGACATCGG + Intronic
1016155710 6:140806558-140806580 ATGTTTGAAATCTTTGACATTGG - Intergenic
1020630739 7:10636754-10636776 TCTATATAAATCTTTTGCATGGG - Intergenic
1020717033 7:11687706-11687728 AGGATATGAATATTTGACACTGG - Intronic
1024830911 7:53455571-53455593 ATGATATAAATATTTTAAATTGG + Intergenic
1028362986 7:89991600-89991622 ACACTATAAACCTTTGAAATTGG - Intergenic
1033352969 7:140577360-140577382 AGGATATGAATCTTGGACTTAGG + Intronic
1042359028 8:67861395-67861417 AAGAAATACATCTTTGTCATTGG - Intergenic
1042688919 8:71474701-71474723 TCTTTATATATCTTTGACATGGG - Intronic
1048831225 8:138479269-138479291 ACTGAATAAATCATTGACATTGG + Intronic
1058060293 9:100488373-100488395 ACGTTAACAATCTTGGACATAGG + Intronic
1185811817 X:3117504-3117526 ATGATACAAACCTTTGCCATTGG + Intergenic
1187085547 X:16039395-16039417 AAGATATAAGACATTGACATGGG - Intergenic
1189146168 X:38657336-38657358 ACGGTAAAGATCTTTGAAATTGG - Intronic
1194339226 X:92688739-92688761 AAGATATAAATATGTGACCTGGG - Intergenic
1195843307 X:109198202-109198224 AGGATATCAATAGTTGACATTGG - Intergenic
1200647613 Y:5805520-5805542 AAGATATAAATATGTGACCTGGG - Intergenic
1201269476 Y:12240851-12240873 ATGATACAAACCTTTGCCATTGG - Intergenic