ID: 987588660

View in Genome Browser
Species Human (GRCh38)
Location 5:19893129-19893151
Sequence CTGTGTCCTCAGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 1, 2: 10, 3: 64, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987588660_987588667 -6 Left 987588660 5:19893129-19893151 CCCCTCTGCCTCTGAGGACACAG 0: 1
1: 1
2: 10
3: 64
4: 487
Right 987588667 5:19893146-19893168 ACACAGGAGAAGGTACCAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 253
987588660_987588666 -9 Left 987588660 5:19893129-19893151 CCCCTCTGCCTCTGAGGACACAG 0: 1
1: 1
2: 10
3: 64
4: 487
Right 987588666 5:19893143-19893165 AGGACACAGGAGAAGGTACCAGG No data
987588660_987588668 4 Left 987588660 5:19893129-19893151 CCCCTCTGCCTCTGAGGACACAG 0: 1
1: 1
2: 10
3: 64
4: 487
Right 987588668 5:19893156-19893178 AGGTACCAGGAGGTGAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987588660 Original CRISPR CTGTGTCCTCAGAGGCAGAG GGG (reversed) Intronic
900502984 1:3015744-3015766 CTGTGTCCTCAGTGGCAGAGAGG - Intergenic
900511005 1:3061142-3061164 CTGTGTCCTCAGTGAAAGAATGG - Intergenic
900609452 1:3538332-3538354 CTGTGTGCTCTGAGGCCGGGTGG - Intronic
900854553 1:5170553-5170575 CTGTGACCTAAGACACAGAGGGG + Intergenic
900862519 1:5243591-5243613 CTGTGCTCTCAAAGGCTGAGTGG + Intergenic
900898915 1:5503787-5503809 CTGTGGGCTCTGGGGCAGAGAGG - Intergenic
901760241 1:11466453-11466475 CTTTGCCTTCTGAGGCAGAGTGG + Intergenic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
902449996 1:16490920-16490942 CTGTGTCCTGGGTGGGAGAGAGG + Intergenic
902486625 1:16750657-16750679 CTGCGTCCTGGGTGGCAGAGAGG - Intronic
902504465 1:16930270-16930292 CTGTGTCCTGGGTGGGAGAGAGG - Exonic
902705946 1:18204561-18204583 ATGTGTGCTCAGAGGTGGAGGGG + Intronic
902992019 1:20194680-20194702 CTTTGTCCCAAGAGGCAGGGTGG - Exonic
903231079 1:21922714-21922736 CTGTGGCCTCCTAGGCAGGGGGG - Intronic
903249930 1:22045496-22045518 CTGAATCCACAGAGGCACAGAGG + Intergenic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
904321937 1:29703436-29703458 CGTTGGCATCAGAGGCAGAGAGG + Intergenic
904437034 1:30505739-30505761 CTGTGTCCTCACAGGATGGGGGG - Intergenic
904484390 1:30815127-30815149 GTGTGTCCTCAGAGGCAGAAGGG - Intergenic
904875571 1:33652054-33652076 CAGTATCTTCAGAGGTAGAGAGG + Intronic
905233320 1:36529193-36529215 CTCTGTCCTCTGAGGAAGGGGGG + Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
906375454 1:45293112-45293134 CTGTGTCCTCACATGCTGGGAGG - Intronic
907373173 1:54016066-54016088 CAGTGTCCTCAGAAGCAGAATGG + Intronic
908014109 1:59814478-59814500 CAGTGGCCGAAGAGGCAGAGGGG - Intergenic
909488633 1:76201839-76201861 CTATGTCCTTAGAAGCAGAGTGG + Intronic
909666691 1:78142205-78142227 CTCTTCCCTCAGAGACAGAGGGG - Intergenic
911747166 1:101452739-101452761 CTGTGTACTAAGAGGCAAAATGG + Intergenic
913173435 1:116252997-116253019 TTGTTTTCTCACAGGCAGAGAGG - Intergenic
915255080 1:154622118-154622140 CTATGTCCTGAAAAGCAGAGTGG + Intronic
916414900 1:164583416-164583438 CTGTGACCTGAGATTCAGAGAGG - Intronic
916453907 1:164950669-164950691 CTTTGTTCTTTGAGGCAGAGTGG + Intergenic
917122326 1:171655470-171655492 GTGTTTCCTCAGAGGGAAAGGGG - Intergenic
918489721 1:185068502-185068524 GTGTGACCACAGAGGCAGATTGG + Intronic
918562104 1:185881140-185881162 CTTTGCCCTCACTGGCAGAGAGG - Intronic
918873297 1:190005502-190005524 CTGTGCCCTCACAGACAGAGAGG - Intergenic
918925694 1:190782632-190782654 CTGTGTGCTCAGACACTGAGTGG - Intergenic
919516990 1:198538018-198538040 CTGTGGCTTCTGAGGCAAAGAGG + Intronic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
920416067 1:205800066-205800088 TGGTGTCCTGAGAGGAAGAGAGG - Intronic
920649796 1:207828405-207828427 CTGGGGCTCCAGAGGCAGAGTGG - Intergenic
920825708 1:209422801-209422823 TTTTTTCCTCAGAGGCAGTGTGG + Intergenic
922501397 1:226099354-226099376 CTGTGTCCTCAAAGAGAGAAAGG + Intergenic
922613199 1:226944914-226944936 GTGTTTCCTGAGAGACAGAGAGG + Intronic
923889117 1:238191669-238191691 CTGTGTCCTCACATGTAGAAGGG - Intergenic
924627521 1:245708059-245708081 CTGGGTCCCGAGAGGCAGGGAGG + Intronic
1062862530 10:821996-822018 CTGTGGCCTCACAGGGAGAGAGG + Intronic
1064292108 10:14044642-14044664 CTGAGCCTTCAGAGGCAGTGGGG + Intronic
1064601879 10:17002025-17002047 CTGTGTACTCAGAGGAACAGAGG - Intronic
1064742014 10:18443486-18443508 CTGTTTCCTGAGAGGCATAAGGG + Intronic
1066365405 10:34771326-34771348 CTGTTACCTCAGATGAAGAGGGG - Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067095818 10:43298838-43298860 CTGTGTCTGCAGTGCCAGAGAGG - Intergenic
1067447993 10:46364683-46364705 GTGGGTTCTGAGAGGCAGAGGGG - Intergenic
1067560519 10:47301420-47301442 CTGTGTCCAGGGAAGCAGAGTGG + Intronic
1067636511 10:48004157-48004179 GTGGGTTCTGAGAGGCAGAGGGG + Intergenic
1067686512 10:48469128-48469150 CTGTGTCTTCAGAGTCAGACTGG + Intronic
1067876977 10:50016168-50016190 GTGGGTTCTGAGAGGCAGAGGGG - Intergenic
1068313142 10:55305407-55305429 CTGATGGCTCAGAGGCAGAGAGG + Intronic
1069684517 10:70309134-70309156 CTGGGTGATCAGGGGCAGAGGGG - Intronic
1069721043 10:70549555-70549577 CAGTGTCCTCAGAGACAGCCTGG + Intronic
1070133060 10:73668141-73668163 GTGGGTTCTGAGAGGCAGAGGGG + Intergenic
1070290260 10:75109173-75109195 GAGTGACCACAGAGGCAGAGGGG - Exonic
1070565416 10:77600416-77600438 CTGTGTCCTGATAGCCACAGGGG - Intronic
1071608610 10:87015893-87015915 GTGGGTTCTGAGAGGCAGAGGGG - Intergenic
1072020631 10:91396017-91396039 CTGGGTCCTCAGAGTCTCAGGGG - Intergenic
1072036853 10:91570632-91570654 CTGTGTCTTCACAGGGAGAAAGG - Intergenic
1072523738 10:96253449-96253471 CTTGGACCTCAGGGGCAGAGAGG + Intronic
1072563812 10:96600883-96600905 GTGTGTCCACAGATGCAGAAAGG - Intronic
1072625178 10:97106744-97106766 CTGTCTGCTCAGGGGTAGAGCGG - Intronic
1072991913 10:100204007-100204029 CTCTGTCCTCACATGCAGAAGGG + Intronic
1075087182 10:119421566-119421588 CTGTGTCTCCTGGGGCAGAGTGG + Intronic
1075102518 10:119516400-119516422 CTGTGTCCTCATGGGGAAAGTGG - Intronic
1075730563 10:124633075-124633097 CTGTGTCCACAGAGAGACAGAGG - Intronic
1075743968 10:124713340-124713362 CTGTGGTGTCAGAGACAGAGTGG - Intronic
1076532718 10:131155451-131155473 CTGTGTTCTCAGAGGCTGCGTGG - Intronic
1076626681 10:131825120-131825142 CCCTGTCCTCAGGAGCAGAGGGG + Intergenic
1076788051 10:132760868-132760890 CTGTGTCCCGAGATGCAGGGCGG - Intronic
1077168346 11:1153669-1153691 GTGTGTCCCCAGGGGCAGTGAGG - Intergenic
1077425201 11:2472841-2472863 TTCTGTCCTCAGAGGCATGGGGG + Intronic
1077478575 11:2802560-2802582 CTGGCTCCTGAGAGGCAGGGTGG - Intronic
1078067502 11:8087985-8088007 CTGTGCCCTCTTAGGCAGATGGG + Intronic
1078097264 11:8307704-8307726 CTCTGCCCTAAGAGTCAGAGTGG - Intergenic
1079016224 11:16870996-16871018 CTGTTTTCTCTGAGACAGAGGGG - Intronic
1079562564 11:21840786-21840808 CTGTGTCTTCACAGGGAGAAAGG - Intergenic
1081145132 11:39553930-39553952 CTGTGTCCTGAGAAATAGAGAGG - Intergenic
1081484211 11:43515493-43515515 CTGGGTGCTCAGAGGCATTGGGG - Intergenic
1083404316 11:62446190-62446212 CTGTGACCTCATCTGCAGAGGGG - Intronic
1084870938 11:72098199-72098221 CTACCTCCTCTGAGGCAGAGTGG + Intronic
1085040578 11:73324176-73324198 CTGTTACCTCCGAAGCAGAGAGG - Intronic
1085057343 11:73413163-73413185 CTGAGTCATCAGGGGCAGGGGGG - Intronic
1085412336 11:76298616-76298638 CTGTGCACTGAGATGCAGAGTGG + Intergenic
1085985266 11:81779433-81779455 CTGTGCAGGCAGAGGCAGAGTGG - Intergenic
1086103928 11:83129175-83129197 CTGTGTCCACAGGGGCTGACAGG - Intergenic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1088625876 11:111730146-111730168 CTGTCTTTTCAGAGGCAAAGTGG + Exonic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1089002471 11:115063607-115063629 CACTGCCCTCAGAGGCAGTGTGG + Intergenic
1089508449 11:118980275-118980297 CTGGGCCCTCAGAGGGAGGGAGG + Intronic
1089533808 11:119149059-119149081 CTGTGTCCTCCGAGCCCGCGGGG - Exonic
1089692213 11:120193808-120193830 CTGTGCTCTCAAAGTCAGAGTGG + Intergenic
1090621552 11:128565251-128565273 CTGTGTCCTCAGTGGCGGAAGGG - Intronic
1090907884 11:131093327-131093349 CCCAGGCCTCAGAGGCAGAGAGG - Intergenic
1090992663 11:131833733-131833755 CTGCCTCCTCAGAAGCAAAGAGG - Intronic
1091171624 11:133524869-133524891 CTGAGTCCTCAAAGGCATTGAGG - Intronic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1092312544 12:7374151-7374173 GTGTGTTCTCAGAGCCAGAGTGG + Intronic
1092395748 12:8124252-8124274 CTGTGTTTTCTGAGGCTGAGTGG + Intronic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1093873809 12:24325620-24325642 CTGTGTCTACAGAGGAAGAAGGG + Intergenic
1094563016 12:31573750-31573772 TTGTGTTCTAAGTGGCAGAGAGG + Intronic
1095395983 12:41762812-41762834 CTGTGTCCTTAATGGCAGAGAGG - Intergenic
1096079294 12:48823164-48823186 CTGTAGCCTCAGAGGCACTGGGG + Intronic
1096612696 12:52813569-52813591 CTGTGTCCTCGGCTGGAGAGGGG - Intronic
1099004390 12:77218790-77218812 GTTTGTCCTCAAAGGCAGTGTGG - Intergenic
1099752343 12:86791929-86791951 GTGGGTCCTCAGCAGCAGAGGGG + Intronic
1099969238 12:89483478-89483500 CTGTGTCCTCACATGGTGAGAGG + Intronic
1100090976 12:90970667-90970689 CTGTGCCAACACAGGCAGAGTGG + Intronic
1100984896 12:100194422-100194444 CTGTATCCTCATAGGTGGAGCGG + Intergenic
1101037941 12:100723429-100723451 GTGTGTGCTCAGGGACAGAGTGG + Intronic
1101433256 12:104644453-104644475 CTCTTTCTTCAAAGGCAGAGTGG + Intronic
1101760735 12:107656764-107656786 CTGTGTCCTCAGAATCAGATAGG + Intronic
1102152434 12:110698082-110698104 CTCTGCCCGCAGAGACAGAGGGG + Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102825105 12:115942507-115942529 CTGTGAGGTCAGAGGCAGAGGGG - Intergenic
1102953425 12:117045019-117045041 AAGTGTCCTCAGAGGCTGGGAGG + Intronic
1103613763 12:122139498-122139520 CCGTTTACTCAGAGGCAGAGCGG - Intronic
1103736026 12:123061370-123061392 CTGTTTCCTCATCTGCAGAGTGG - Intronic
1104377373 12:128276709-128276731 CTGGGTCCGCAGAGACAGTGAGG - Intronic
1104563568 12:129860158-129860180 AAATGTCCACAGAGGCAGAGTGG - Intronic
1104717251 12:131024244-131024266 CTGTGACGTCAGGGTCAGAGAGG + Intronic
1104810391 12:131616957-131616979 CTGTGTCCTGGGAGGCGGACAGG - Intergenic
1104908564 12:132228523-132228545 CTGTCTCGCCAGAGGCAAAGAGG - Intronic
1106196665 13:27499816-27499838 CTGTCTACTCAGAGAGAGAGTGG - Intergenic
1106666982 13:31861955-31861977 CTCTGTCTTCTGAAGCAGAGAGG + Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107941735 13:45382279-45382301 GGGTGTCCTAAGAGCCAGAGGGG + Intergenic
1108163510 13:47667504-47667526 CTCTGCCCACAGATGCAGAGTGG + Intergenic
1108597277 13:51960383-51960405 CTGTGTCCTCAGAAGGGGAGTGG - Intronic
1109299615 13:60577405-60577427 CTGTGTTCTCAAAGGCTGAGAGG - Intergenic
1109660834 13:65458449-65458471 CTCTCTCCTGAGAGACAGAGGGG + Intergenic
1110428996 13:75401267-75401289 CTGTGACTTCAGAGGAAGAAAGG - Intronic
1112207188 13:97336553-97336575 GTGTGACCACAGAGGCAGATTGG + Intronic
1112312700 13:98333690-98333712 GTGTGTCCTCAGGGGCAGTGTGG + Intronic
1112406678 13:99126815-99126837 CTGTGTACTTAGTGGCAGTGAGG + Intergenic
1112751565 13:102588834-102588856 CTGTGTCCTCACAGGGGAAGGGG - Intergenic
1112829163 13:103427523-103427545 CTGTGTGCTTAGAAGAAGAGGGG + Intergenic
1113124761 13:106964953-106964975 CTGGATCTTCAGGGGCAGAGGGG - Intergenic
1113297251 13:108972700-108972722 CTGTGCCCTAAGAGAAAGAGTGG - Intronic
1113414947 13:110121517-110121539 CTGTGTCATAGGAGGAAGAGGGG + Intergenic
1113426396 13:110211912-110211934 CTGTCTCCCCAGGGGGAGAGAGG - Exonic
1113607295 13:111618773-111618795 CTGTTTCCTCAAAGGCCAAGGGG + Intronic
1113890213 13:113731630-113731652 CAGGGCCCTCAGAGGCTGAGTGG - Intronic
1114365535 14:22023368-22023390 CTGAGGCCTCAGAAGAAGAGAGG - Intergenic
1114405250 14:22450342-22450364 CTGTTTCCTCTGAGCCAGAAGGG - Intergenic
1115490373 14:33952498-33952520 TTCTCCCCTCAGAGGCAGAGAGG - Intronic
1117340664 14:54788807-54788829 CTCTGCCCTCAGAGGCTGGGAGG + Intronic
1118477595 14:66132952-66132974 CTATGTCATAAAAGGCAGAGTGG - Intergenic
1118505155 14:66403103-66403125 CTGTTTCCTCAGAGGTAAAATGG + Intergenic
1118608658 14:67522500-67522522 CAGTGTCCCCCCAGGCAGAGTGG - Intronic
1118709219 14:68506081-68506103 CTGTGTCCTGAAAGCCTGAGTGG - Intronic
1118860480 14:69659106-69659128 CTGTTTCCTCAGCTGCAGAATGG + Intronic
1120738196 14:88078772-88078794 CTGAGTTCTCAGAGTCACAGTGG + Intergenic
1120876084 14:89377203-89377225 CGGTGTCATCAGAGGGGGAGAGG + Intronic
1121269172 14:92626527-92626549 CTGATTCCTTAGAGGCAGAGGGG + Intronic
1121312607 14:92943366-92943388 GTGGCTCCTAAGAGGCAGAGTGG + Intronic
1122080160 14:99261470-99261492 CTCTGTTCTAACAGGCAGAGTGG + Intronic
1122138454 14:99647862-99647884 CTGTGTCCTCTGGAGGAGAGAGG + Intronic
1122326513 14:100883873-100883895 CGATGTACTCAGTGGCAGAGCGG + Exonic
1122488129 14:102095250-102095272 CTGGGATCTCAGAGGAAGAGAGG + Intronic
1122630596 14:103106002-103106024 CTGAGTCCCCTGAGGCACAGAGG - Intronic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1123046329 14:105518248-105518270 CTGTGTCCTTATAAGGAGAGAGG - Intergenic
1124163001 15:27291722-27291744 CTGCGTCCTCAGTGGCAGAGTGG + Intronic
1124322341 15:28724475-28724497 CAGTGCTCTCAGAGGCTGAGGGG + Intronic
1124523431 15:30426280-30426302 CAGTGCTCTCAGAGGCTGAGGGG + Intergenic
1124535235 15:30539934-30539956 CAGTGCTCTCAGAGGCTGAGGGG - Intergenic
1124654812 15:31499568-31499590 CAGTGTCCTTTGAGGCACAGAGG + Intronic
1124763419 15:32467662-32467684 CAGTGCTCTCAGAGGCTGAGGGG + Intergenic
1124775207 15:32581385-32581407 CAGTGCTCTCAGAGGCTGAGGGG - Intergenic
1125297251 15:38216540-38216562 CTGTTCCCTCAGAGGCATGGAGG + Intergenic
1125363697 15:38891096-38891118 CTGGGACATCACAGGCAGAGGGG + Intergenic
1125771694 15:42171902-42171924 CTTTGCCTTCAGAAGCAGAGGGG + Intronic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1126373386 15:47970468-47970490 CTGAGTCCTCAGAGACAGTCAGG + Intergenic
1127959517 15:63880336-63880358 CTGTGCCCTCAGAGTCAGTAGGG + Intergenic
1128452629 15:67814809-67814831 CAGTTTCCTCAGTGGCAGAGTGG + Intergenic
1128486252 15:68092729-68092751 CTGTGTCCTCACAGGGTGAAAGG - Intronic
1128749867 15:70141148-70141170 CAGTGACCTTAGAGGGAGAGGGG - Intergenic
1129352261 15:74962981-74963003 CGGAGTCCTGAGAGGAAGAGGGG + Intronic
1129487466 15:75888854-75888876 CTGCATCCTCAAAGGAAGAGTGG + Intronic
1129536364 15:76316373-76316395 CTATGTACTCAGTGGCAGTGAGG - Intergenic
1129702927 15:77778188-77778210 ATGTGACCACAGAGGCAGATTGG - Intronic
1130648937 15:85751352-85751374 CTGTTTCTTCAGGGGCACAGTGG + Intergenic
1130727984 15:86460864-86460886 TTGTGACCCAAGAGGCAGAGTGG - Intronic
1131226107 15:90625627-90625649 CAGTGTTCTCAGAATCAGAGAGG + Intronic
1131930095 15:97432194-97432216 CTGTGACCACAGAGAGAGAGAGG - Intergenic
1132349386 15:101129522-101129544 CTGTAGCCTCAAAGGCAGAGAGG - Intergenic
1132469671 16:95046-95068 ATGTGGCCACAGAGACAGAGTGG - Intronic
1132510856 16:340686-340708 GTGTTCCCACAGAGGCAGAGCGG + Intronic
1132631443 16:919575-919597 GTGCGCCCTCAGAGGCAGGGAGG + Intronic
1132755450 16:1482317-1482339 CTCCCTCCTCAAAGGCAGAGTGG + Intergenic
1132829020 16:1918508-1918530 CAGTGGCCTCGGAGGCGGAGTGG - Intergenic
1132946825 16:2536401-2536423 CTGTGTCGCCAGAGGGCGAGGGG + Intergenic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1133708690 16:8380187-8380209 CTGTGTCCTTACAAGCAGGGTGG - Intergenic
1134070133 16:11255666-11255688 CTGTGTCCACTGAGGCTGAACGG - Intronic
1135580210 16:23619142-23619164 CTGTTTCCTTAGGGCCAGAGTGG - Intronic
1136519303 16:30786053-30786075 CTGTGTGCACAGGGGCAGTGGGG + Intronic
1137025983 16:35475075-35475097 CTGTGTCTTCAATGGCAGAAGGG - Intergenic
1137467880 16:48727565-48727587 CTGTGTCCTCACATGCAAGGAGG + Intergenic
1137571169 16:49567315-49567337 TTTTGTCCTGAGAGGGAGAGAGG - Intronic
1137672068 16:50284804-50284826 CTGAGCCCAGAGAGGCAGAGTGG - Intronic
1138284010 16:55794191-55794213 CTTTGTCCTCAGAGACAGAACGG + Intergenic
1138284992 16:55802796-55802818 CTTTGTCCTCAGAGACAGAACGG - Intergenic
1138345072 16:56315706-56315728 CTGGGCCCCCAGAGGCAGGGGGG - Intronic
1138499436 16:57430086-57430108 CTGTCTCCTGAGAGTGAGAGTGG - Intronic
1138514898 16:57530642-57530664 CTGTCCTCTCAGGGGCAGAGAGG - Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1139950852 16:70668743-70668765 CTGTGTCCTCAGTGGTGGAAGGG - Intronic
1140143750 16:72285563-72285585 CTGTAGCCCCAGAGGTAGAGCGG + Intergenic
1141157816 16:81609529-81609551 CTGTCTCCCCAGGGGCTGAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142595002 17:1025567-1025589 AGGTGTGCTCAGAGGCAGAGGGG - Intronic
1143095214 17:4475268-4475290 CTGTCTCCTCAGAGTCTGTGTGG - Intronic
1143105855 17:4530330-4530352 CTCTGTCCTCATAGGCACTGGGG - Intronic
1144734967 17:17550188-17550210 CTGTGTCCTCAGAGGGTCACGGG - Intronic
1144863458 17:18320198-18320220 CTGTGTCCTCATTGGTGGAGAGG + Intronic
1145254529 17:21315378-21315400 CTGTGTCCTCAGATGTAGAAGGG - Intergenic
1145322066 17:21772587-21772609 CTGTGTCCTCAGATGTAGAAGGG + Intergenic
1146057145 17:29587189-29587211 CTGTGGCATCTCAGGCAGAGAGG - Intronic
1146775843 17:35615144-35615166 CTGAGGCTTCAGAGCCAGAGTGG + Intronic
1147511148 17:41069863-41069885 GTGTGTCCACAGAGCCAGAGAGG + Intergenic
1147556463 17:41482351-41482373 CTGGGCCCTTAGAGGCAGTGGGG - Intergenic
1147905595 17:43820766-43820788 CTCTGCCCTCACAGCCAGAGGGG - Intronic
1148455979 17:47811607-47811629 CTGGGTCCTCAGAGGAGGATTGG - Intronic
1148575146 17:48705328-48705350 CTGGGTCCGCAAAGGCAGATCGG + Intergenic
1148661738 17:49339759-49339781 CTCTGTCTTCAGTGGCACAGCGG - Intronic
1149432669 17:56606869-56606891 CTGTTTCCTCTGAGACAGAGAGG + Intergenic
1149580798 17:57749135-57749157 ATGTGAGCTCACAGGCAGAGTGG + Intergenic
1150216909 17:63476384-63476406 CTGTGTCCTCGGGGGGAAAGAGG + Intergenic
1150343588 17:64387639-64387661 ATGTGTCCTCCGAGGCCGGGAGG + Intronic
1150484684 17:65535711-65535733 CTGTGTCCTCAGGTGCTGTGTGG - Exonic
1151432403 17:74072383-74072405 TTTGGTCCTCAGAGGCACAGGGG - Intergenic
1151699832 17:75737261-75737283 CTGGGTCCTCTGGGGCGGAGGGG + Intronic
1152547524 17:81009282-81009304 CAGAGTCCTCAGTGGCAGGGCGG - Intronic
1152592346 17:81219906-81219928 CTGTGACCACGGAGACAGAGCGG + Exonic
1152647324 17:81475465-81475487 CTGGGTCCTCGGAGGCTCAGAGG + Intergenic
1152853770 17:82652077-82652099 GTGTGACCACAGAGGCAGACTGG + Intergenic
1153535817 18:6100714-6100736 CTGTGTCCTCTCAGCCAGGGTGG - Intronic
1154205090 18:12329395-12329417 CTGTGACCTCTGAGGCTGAAAGG + Exonic
1156197947 18:34797132-34797154 CTGTGTCTTCAGGGACAGAATGG - Intronic
1156450712 18:37264872-37264894 CTTTGTCCTAAGTGGCTGAGTGG - Intronic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157425597 18:47581954-47581976 ATGTGTGATAAGAGGCAGAGTGG - Intergenic
1158348057 18:56535727-56535749 CTCTCTAATCAGAGGCAGAGTGG - Intergenic
1158425875 18:57339234-57339256 CTGTGTCCTTATAGGAAGAGGGG - Intergenic
1158598127 18:58834229-58834251 CTGTGTCCTCAGGGCCGAAGAGG - Intergenic
1158605006 18:58887877-58887899 CTGCGTCCCCCGGGGCAGAGGGG + Intronic
1158920612 18:62187423-62187445 CTGTGTCCCCTGAGGCCTAGAGG + Exonic
1160257608 18:77260385-77260407 CTGTGTCCTCATAGGGTGGGAGG + Intronic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160719914 19:592494-592516 CTCTGTGCTCTGAGGCATAGAGG + Intronic
1161133834 19:2608133-2608155 CTGTGTCATGAGTGGCAGGGCGG - Intronic
1161238259 19:3208464-3208486 CTGGGGCCGCAGAGGCACAGGGG - Exonic
1161975684 19:7606754-7606776 CTGAGGCCAGAGAGGCAGAGAGG - Intronic
1163621549 19:18363796-18363818 CTGTGTCCCCAGATGCAGGGAGG - Exonic
1164472227 19:28545962-28545984 CTGTGTCCTCAGAACCACACAGG - Intergenic
1164529207 19:29035240-29035262 CTGTTTCCTCAGAAGCACAGAGG - Intergenic
1164935659 19:32208471-32208493 CTGCTTTCTCTGAGGCAGAGTGG - Intergenic
1164980108 19:32607465-32607487 CTCTGTGCTCCGAGGCTGAGTGG + Intronic
1166045109 19:40225391-40225413 CTGGGTGCTCTGAGGCAGAGGGG - Intronic
1166151737 19:40880149-40880171 CTTTGTCCTCATAGTCAAAGCGG + Exonic
1166178428 19:41090477-41090499 CTTTGTCCTCATAGTCAAAGCGG - Exonic
1166456813 19:42948811-42948833 CTGTGTCCACAGACTCAGACAGG + Intronic
1166486566 19:43219309-43219331 CTGCGTCCACAGACTCAGAGAGG + Intronic
1167593169 19:50415184-50415206 CTGTGTTCCCAGAGGAGGAGGGG - Intronic
1168474602 19:56666817-56666839 CTGTGTCCTCACACGCAGAGAGG - Intronic
1168649863 19:58086109-58086131 CTTTTTCTTCAGAGGCTGAGGGG - Intronic
1202704574 1_KI270713v1_random:13583-13605 CTGCGTCCTGGGTGGCAGAGAGG + Intergenic
924996812 2:368819-368841 CTGTGTCCTCACATGGAGGGAGG + Intergenic
926218297 2:10918960-10918982 CTGTCTCCGCACAGGCAGACAGG - Intergenic
926754443 2:16224021-16224043 CTGTTTTCTGACAGGCAGAGGGG + Intergenic
926913550 2:17873039-17873061 CAGTGTCCTCACAGGAAGAGGGG - Intergenic
927484614 2:23479942-23479964 GTGTGTCCTCATAAGCAGCGTGG + Intronic
928245884 2:29626645-29626667 CTGTGTCCTCACATGGGGAGGGG - Intronic
928388102 2:30886467-30886489 CTGTGTCCAGCCAGGCAGAGAGG - Intergenic
928436278 2:31256681-31256703 CTGTGTCTGCAAAGGCTGAGGGG - Intronic
930104343 2:47628349-47628371 GTGCCTCCTCAGAGGCAGTGTGG + Intergenic
930351395 2:50260164-50260186 CTATGTTCTAAGAGACAGAGGGG - Intronic
930749964 2:54925201-54925223 CTGTGTGCTCACAGGAAGAGCGG - Intronic
931636202 2:64342565-64342587 CTATGTCCTCTGTGGCAGAAAGG - Intergenic
931644949 2:64413597-64413619 CTTTGTCCTCATAGGTAGATTGG + Intergenic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
932805487 2:74779141-74779163 CTGGGTACTCCGAGGCAGTGAGG + Intergenic
933684337 2:85131711-85131733 CTGTGTCCTGAGGGGGAAAGAGG + Intergenic
934144615 2:89079006-89079028 CTGTTTCCTGAGTGGCAGAAGGG + Intergenic
934224637 2:90121543-90121565 CTGTTTCCTGAGTGGCAGAAGGG - Intergenic
934774350 2:96927648-96927670 CGTTGTCTCCAGAGGCAGAGTGG - Intronic
935338299 2:102036806-102036828 GTGGGTCCTCAGCGGCAGACTGG + Intergenic
935555330 2:104503408-104503430 TGGTGACCTCAGAAGCAGAGTGG + Intergenic
935674217 2:105580257-105580279 CTGGGTCCTCAGCGGCACATGGG - Intergenic
935697232 2:105780776-105780798 CTGTGTCCTCACATGCTGAAGGG - Intronic
935756297 2:106278593-106278615 CTGTGTTCTCTGGAGCAGAGAGG - Intergenic
935978892 2:108607148-108607170 CTGTGTCCTCACATGCAGGAAGG - Intronic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
937127255 2:119482524-119482546 CTGTGTCCTTGGAGGCATATGGG + Intronic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
937832956 2:126443968-126443990 CTTTGTCCTGAGATGCAGAATGG + Intergenic
937975118 2:127577618-127577640 CTCTGTCCTCAGAGGCGGTGGGG + Intronic
938767202 2:134468292-134468314 CTGTGTCCTCACATGCGGAGGGG - Intronic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
943001199 2:182330629-182330651 CCGTGGGTTCAGAGGCAGAGAGG - Intronic
944619428 2:201498759-201498781 CTGTGTGCACAGAGAAAGAGAGG - Intronic
945645404 2:212485818-212485840 CTGTGTCCTCACATGCTGAAAGG + Intronic
945946633 2:216001523-216001545 CTGGGTCTGGAGAGGCAGAGGGG - Intronic
946128144 2:217582387-217582409 CTGTGTCCTCACAGGTGGAAGGG - Intronic
946772180 2:223100123-223100145 CTGTGTGTCCAGAGCCAGAGCGG - Intronic
947145062 2:227056821-227056843 TTGTGTCCTCACAGGCAGATGGG - Intronic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
948304353 2:236935636-236935658 CTGTGTTCTCAGAGGAAATGGGG - Intergenic
948383395 2:237566938-237566960 CTGTGCTCCCAGAGGCAGCGGGG - Intronic
948643815 2:239391515-239391537 GTGTGTCCTCAGAGCCAGCGGGG + Intronic
948771055 2:240251430-240251452 CTGAGTCCTCAGCGGGGGAGGGG + Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1168843176 20:922879-922901 CTGCCTCCTCAGAGGCTGAGGGG + Intergenic
1170153175 20:13246417-13246439 CTCTGTCCTGGCAGGCAGAGTGG - Intronic
1170706647 20:18749748-18749770 CAGTGTCCTCTGTGGCAGGGTGG - Intronic
1171084974 20:22229893-22229915 CAGTGTTCTCAGTGGCACAGGGG + Intergenic
1172517196 20:35542915-35542937 CCGTGAGCTCAGAGGCTGAGCGG + Exonic
1172826250 20:37789215-37789237 CTGTGTACTGAAAGGCGGAGAGG + Intronic
1172891426 20:38268618-38268640 CTGTGTCCTCTGAGAAACAGAGG - Intronic
1174688497 20:52479104-52479126 CCATGTCCTCACAGGCAGAAGGG - Intergenic
1174778358 20:53366015-53366037 CCCTTTCCTCAAAGGCAGAGAGG + Intronic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1175872404 20:62214669-62214691 CTGTGTTCTCAGGGCCAGAGCGG + Intergenic
1176149974 20:63585785-63585807 CTGTGTCCTCAGCTGAGGAGTGG + Intergenic
1176978506 21:15352057-15352079 CTGTGCCCTGAGAGGGAGAACGG - Intergenic
1178601000 21:33994053-33994075 CTGTGCCCTCAGAGGAGGAAGGG - Intergenic
1179149392 21:38796999-38797021 CTGGGGCTTCAGAGGGAGAGTGG - Intergenic
1179979274 21:44887979-44888001 CAGGCTCCTGAGAGGCAGAGGGG - Intronic
1180131280 21:45828767-45828789 GTGTGTCCCTGGAGGCAGAGTGG + Intronic
1180180603 21:46117221-46117243 CTGTCTCCGGGGAGGCAGAGTGG - Intronic
1181366653 22:22381571-22381593 CTGTGTCCTAAGCTGCAGGGAGG - Intergenic
1181536443 22:23548738-23548760 CTGGGGCCTCAGAAGCAGACAGG + Intergenic
1182035712 22:27196709-27196731 CTGGCTCCTCAGTTGCAGAGAGG - Intergenic
1182190361 22:28453768-28453790 CTGGGTCACAAGAGGCAGAGCGG - Intronic
1182419938 22:30244055-30244077 CTGTGTACTGAGGGGCAGAAGGG + Exonic
1183303631 22:37070588-37070610 CTGTGTCCTCCGAGGGTGAGTGG - Exonic
1183384819 22:37508831-37508853 CTGTCTCCCCATCGGCAGAGTGG + Intronic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
1184094466 22:42309134-42309156 CTGTCTCCTCATTTGCAGAGTGG - Intronic
1184243207 22:43222395-43222417 CTGTGACCTCAGAGCCGGAAGGG + Intronic
1184856639 22:47149985-47150007 CTGACTCCTCAGGGGCAGCGGGG + Intronic
1185049179 22:48544829-48544851 CTCTCACCTCAGAGGCAGCGTGG - Exonic
1185133661 22:49056086-49056108 TTGTGTCCTCAGTGGCAGAAGGG - Intergenic
1185204657 22:49530905-49530927 CTCTGTGCCCAGATGCAGAGTGG - Intronic
1185367895 22:50445372-50445394 CCTTGTCCTCAGTGGCTGAGTGG + Exonic
949939240 3:9141828-9141850 ATCTATCCTCAAAGGCAGAGAGG - Intronic
949959023 3:9296557-9296579 CTGGGTCCCCAGAGGCAGTGTGG + Intronic
950717269 3:14858024-14858046 CTCTGGCCTCAGAGGTGGAGAGG - Intronic
952796355 3:37242829-37242851 CTGTGTCTTCGGTGCCAGAGGGG - Intergenic
952850449 3:37724126-37724148 CTGTGTGCCCAGAGGCTGAGTGG - Intronic
953020907 3:39112460-39112482 CTATGTGCTCAGAGGCTGGGTGG + Exonic
954829042 3:53402671-53402693 ATATGTCCACAGTGGCAGAGAGG + Intergenic
954907022 3:54071653-54071675 CTGATTCCTTAGAGGTAGAGGGG - Intergenic
955003779 3:54950925-54950947 CTCTGGGCTCAGTGGCAGAGGGG + Intronic
955465201 3:59230083-59230105 CTGTACCCTCAGAGCCACAGAGG - Intergenic
957174538 3:76789160-76789182 CTGTATCCTTAGATGCAGGGTGG + Intronic
958165789 3:89876757-89876779 CTGAGTCTTCAGAGGTTGAGGGG + Intergenic
958605608 3:96354918-96354940 CTGTGCCCTATGAGTCAGAGTGG + Intergenic
959789032 3:110334712-110334734 CTTTTTTCTCAGAGGGAGAGTGG - Intergenic
960308935 3:116096832-116096854 CTGTCTCCTCAGTGACTGAGTGG + Intronic
960710206 3:120520146-120520168 CTGTCTACTCAGAGACAGTGAGG - Intergenic
960999126 3:123360905-123360927 CAGTTTCCTCATTGGCAGAGGGG - Intronic
961006631 3:123410033-123410055 CTGTGTTCCCTGAGGCAGTGTGG + Intronic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961132778 3:124484301-124484323 TTCTGTCCTCTGAGTCAGAGTGG + Intronic
961186333 3:124918331-124918353 CTGTGAGCTCAGAGGCATGGAGG - Intronic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
962252583 3:133845391-133845413 CTGTGTCCTCAGTGGTGGAAGGG - Intronic
962508637 3:136076003-136076025 CAGTGACCTCAGAGTCTGAGTGG + Intronic
962934603 3:140068172-140068194 ATGTGTCCCCAGAGAAAGAGTGG - Intronic
962950169 3:140211166-140211188 CTCTGTGCTCAGTAGCAGAGTGG + Intronic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
965815285 3:172629780-172629802 TTGTGTCATCAGAGTGAGAGAGG - Intergenic
966220216 3:177544273-177544295 CAGTGCCCTCAGAGTCAGTGTGG + Intergenic
966558085 3:181286166-181286188 CTGTGTCCTCACATGAAGAAGGG - Intergenic
966787658 3:183635802-183635824 CTGAGTCCTCGGGGGCGGAGGGG + Intronic
967294783 3:187954439-187954461 GTGTGTCCACACAGGCAGAGAGG - Intergenic
968705411 4:2075288-2075310 CTGGGTCCTGGCAGGCAGAGGGG - Intronic
968732080 4:2273925-2273947 CTGGCTCCTTAGGGGCAGAGTGG + Intronic
969122958 4:4923305-4923327 CTGTGTCCCCATAGGCAGAATGG + Intergenic
969197943 4:5577967-5577989 CTGTGTCATCAGAGGAACGGTGG + Intronic
969593585 4:8135523-8135545 CTGTGTCCTCACACTCAGAAGGG - Intronic
972118246 4:35665735-35665757 CAGTCTCTTCAGAGGCTGAGAGG - Intergenic
972503474 4:39698500-39698522 CTGCTTCCTCACAGGCAGAAGGG - Intronic
974237099 4:59196102-59196124 CTGACACCTCAGAGGAAGAGTGG + Intergenic
975473082 4:74793281-74793303 CTGTGTCCTTGGAGTAAGAGAGG - Intronic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
975929219 4:79498116-79498138 CTGTGTCCTCACAGGATGAAAGG + Intergenic
981063858 4:140460383-140460405 CTGTGTCCTCACAGTAAAAGGGG + Intronic
981563268 4:146070193-146070215 CTGTGTCCTCAGTGGGGGAAGGG - Intergenic
985512100 5:318750-318772 CCCTGACCTCAGAGGCAGACAGG - Intronic
985538610 5:477634-477656 CTGTGGCCTCAGACGGACAGGGG - Intronic
985986500 5:3520885-3520907 CTGTGTCCTCAGCGGGACAGTGG - Intergenic
986326761 5:6681479-6681501 CTGTGTGCTCAGAGAAAGAGTGG + Intergenic
986978869 5:13423263-13423285 CTGGGTGCTGAGAGGCTGAGAGG - Intergenic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
987924662 5:24325050-24325072 CTGTGTGCTCAGAGTCATACAGG - Intergenic
988173540 5:27690892-27690914 CTGTGTCCTCACAGGGTGAAAGG + Intergenic
988657276 5:33226108-33226130 TTGTGTGCTCAGAGAGAGAGAGG - Intergenic
988673410 5:33406528-33406550 CAGTGTGCTCAGAGGCAGTCAGG + Intergenic
990260200 5:54013878-54013900 CTGTCTCCTCAGAGGTTCAGAGG - Intronic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
991215616 5:64155093-64155115 CTGATTCCTTAGAGGTAGAGGGG - Intergenic
991637021 5:68716423-68716445 CTGTACCCTGAGAGGCTGAGAGG - Intergenic
992387112 5:76295278-76295300 CTGTGTCCTCAGTGGTAGAAGGG + Intronic
992981305 5:82176250-82176272 CTCTGCCCTCAGAGGCAGCGTGG + Intronic
993284440 5:85973357-85973379 CTGTGTCCTCACATGGGGAGGGG - Intergenic
995225021 5:109691031-109691053 CTCTCTCTTCAGAGGCAGCGGGG - Intronic
995835360 5:116395164-116395186 CTGCTTCTTCAGAGGGAGAGGGG - Intronic
997593171 5:135087923-135087945 CTGGGTCCTCACTGTCAGAGTGG - Intronic
999643299 5:153693474-153693496 CTGTGGTCTCAGAGGCAGCCTGG + Intronic
999744867 5:154584338-154584360 CTGTGTTTTCTGAGGCTGAGAGG + Intergenic
999852972 5:155562850-155562872 CTGTGTTCTCAGAAGCAGACTGG - Intergenic
1001210280 5:169804791-169804813 CTGTGTAATCACAGGCATAGGGG + Intronic
1001319795 5:170671043-170671065 CTGTGTCTTCTGAGGCAGTCTGG + Intronic
1001528387 5:172445173-172445195 CAGTGTCCTGACAGGCAGACAGG - Intronic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1001778272 5:174345387-174345409 ATGTGGCCACAGAGGCCGAGAGG - Intergenic
1002756721 6:167733-167755 GTCTGGCCTCATAGGCAGAGTGG + Intergenic
1002761168 6:203552-203574 CTGTTTTCTCAGGGGCAGTGAGG - Intergenic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1004602016 6:17159289-17159311 CTGTGTCCTCAGAGCCAAGGAGG + Intergenic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1005958961 6:30683149-30683171 TTGTGTCCTCAGTGTCAGTGGGG - Intronic
1006339287 6:33437799-33437821 CGGTGTCCCCAGAGGCAGAGCGG - Exonic
1006870742 6:37248998-37249020 GTGTGACCACAGAGGCAGATTGG - Intronic
1006987131 6:38183389-38183411 AAGTGTCCTGAGAGGCAGGGAGG + Intronic
1007503053 6:42313241-42313263 CTGAGTCATCTGAAGCAGAGAGG + Intronic
1009003398 6:57749055-57749077 ATGTGTCTTCAGAGGCATAAGGG - Intergenic
1009274238 6:61654828-61654850 TTGAGTCGTGAGAGGCAGAGTGG + Intergenic
1009538892 6:64925789-64925811 CTCTGTCCTCAGAGGCAAAGTGG - Intronic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1010729963 6:79380837-79380859 CTGTGTCCTTATAAGAAGAGGGG - Intergenic
1011217301 6:85018599-85018621 CTGAGACCGCAGAGGCAGAGTGG - Intergenic
1011841067 6:91499559-91499581 CTGTGTCCTCATATGGAGTGGGG + Intergenic
1013991331 6:116257689-116257711 CTGTGTCCTCACATGCAAAAAGG + Intronic
1014933833 6:127364181-127364203 CTGTAGCCTCAGAGTCACAGGGG + Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1015204325 6:130617841-130617863 CTGCGTCCTCAAAGGCACACAGG + Intergenic
1016428475 6:143958520-143958542 CTGTGTCCCGAGAGGCAGACAGG - Intronic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1017991284 6:159491838-159491860 CTGGGTCCTCAGGGGCAGTGTGG - Intergenic
1018907418 6:168083643-168083665 CTGTCTCCCAAGGGGCAGAGGGG - Intergenic
1019442564 7:1054860-1054882 AGGAGTCCTCAGAGGCACAGCGG - Intronic
1019488604 7:1300776-1300798 CGGGGGCCTCAGAGGCACAGAGG + Intergenic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1020643043 7:10779769-10779791 CCGTGGCCTCAGAGGCCGATGGG - Intergenic
1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG + Intronic
1022110110 7:27224797-27224819 CTGTGTGCTCACAGGCAAACAGG - Intergenic
1022501237 7:30883493-30883515 CTCTGGCCTCAGAGGCAGGTGGG + Intronic
1023867147 7:44243730-44243752 CTCTGTCCCCAGGGGCAGAGGGG - Intronic
1023937587 7:44750340-44750362 CTGTGGCCTTACAGGTAGAGGGG + Intronic
1024272440 7:47652756-47652778 TTGAGTCCTAAGAGGCAGAAGGG + Intergenic
1026040004 7:66860183-66860205 CTGTGACCTGAGAGGAAGAAAGG - Intergenic
1026219263 7:68378320-68378342 CTGTTTTCTCAAAGGCAAAGTGG + Intergenic
1027146553 7:75699626-75699648 CTGTGGCCTCTGCTGCAGAGTGG + Intronic
1028364444 7:90011068-90011090 TAGTGGCCTCAGAGGAAGAGTGG - Intergenic
1029127400 7:98304084-98304106 CTCTGTCCCCAGGGGGAGAGTGG - Intronic
1029941608 7:104486506-104486528 CTGTGTCCTCACATGGTGAGAGG + Intronic
1032107938 7:129050511-129050533 CTGGTTGCTCAGAGTCAGAGAGG - Intronic
1034540724 7:151756327-151756349 TTGGTGCCTCAGAGGCAGAGAGG - Intronic
1035325064 7:158060507-158060529 CTGTGTCCTTAGCAGAAGAGGGG - Intronic
1035476640 7:159148822-159148844 CTGAGGCATGAGAGGCAGAGTGG - Intergenic
1035523814 8:296344-296366 CTGTCTCCTCAGCGGCACAATGG - Intergenic
1035819049 8:2571928-2571950 CTGAGTCCGCAGATGCAGAAGGG - Intergenic
1035923885 8:3707058-3707080 CCTGGGCCTCAGAGGCAGAGAGG - Intronic
1037466054 8:19161781-19161803 CTGTGGCCAGAGAGGCAGAAGGG + Intergenic
1037836819 8:22219554-22219576 CTGTGTCCTCACAGGGTGAAAGG - Intergenic
1038420915 8:27433602-27433624 CCGAGTCCCCAGAGGCGGAGTGG + Intronic
1039622798 8:39014501-39014523 CTCTGTTCTCTGATGCAGAGAGG - Intronic
1039648560 8:39314841-39314863 CTGTGGCCAAAAAGGCAGAGAGG + Intergenic
1039795366 8:40908482-40908504 CTGTGTCCTCACATGGAGGGAGG + Intergenic
1040448695 8:47522496-47522518 CTGTGAGCTCAGAGGGAAAGAGG + Intronic
1040574395 8:48638650-48638672 TTATGTCCACACAGGCAGAGAGG + Intergenic
1041097718 8:54365950-54365972 CTGGGTGCTCAGAGGTAAAGGGG + Intergenic
1041394914 8:57380370-57380392 CTTTGTCCACTGAGGCTGAGAGG - Intergenic
1041833285 8:62181109-62181131 GTGTGTGCTCTGAGGCAGAGTGG + Intergenic
1042059978 8:64806037-64806059 CTGTGTTCTCAGAAGCAGAGAGG - Intergenic
1043002991 8:74782266-74782288 GTGAGTCCTCAGAGGCAAATTGG - Intronic
1043830425 8:84981692-84981714 CTGTGTCCTTAAAGACAGAAGGG - Intergenic
1045510412 8:102808512-102808534 CTTTGGCCTCAGCTGCAGAGTGG - Intergenic
1048327067 8:133448136-133448158 CTCTGTCCTCAGAGCCATATGGG - Intergenic
1048872060 8:138807315-138807337 CTCTGTCCTCAGTCACAGAGTGG - Intronic
1049204962 8:141359375-141359397 CTTCTTCCTCAGAGTCAGAGAGG + Intronic
1049363634 8:142226020-142226042 TGGTGTCCTGAGAGGAAGAGAGG - Intronic
1049443782 8:142620852-142620874 CCTTGTCCACAGGGGCAGAGTGG + Intergenic
1049509584 8:143020797-143020819 CTGTGTCCTCATCTGCAAAGTGG + Intronic
1049867010 8:144945904-144945926 CTGTGTCATCACAGGTAGGGAGG - Intronic
1049938922 9:526047-526069 CATTCTCCTCAGAGGCAGAGAGG - Intronic
1049993236 9:1009854-1009876 CCGTGTCCTCAGACTCAGTGTGG - Intergenic
1051551001 9:18329161-18329183 CTGTGTCCTCACGGGTAGAAGGG - Intergenic
1051701261 9:19826628-19826650 CTGTGTCCTCACATGAAGAAAGG + Intergenic
1052347610 9:27426129-27426151 CTGTGTCCTCATAGGTAAAATGG - Intronic
1052431404 9:28371440-28371462 CTGTGTCCTCACATTCTGAGAGG + Intronic
1052701293 9:31941207-31941229 CTCTGTCATCAGAGGCCCAGAGG + Intergenic
1053067548 9:35079206-35079228 CTGTCGCCTCAGAGTCAGACCGG + Exonic
1053130527 9:35612209-35612231 TTGTGGCCTCTCAGGCAGAGAGG - Intronic
1053362973 9:37502661-37502683 CTGTGTTCCCACAGGCAGTGAGG + Intronic
1053516452 9:38734575-38734597 CTGTGTCCTCAGGAGCTGTGGGG - Intergenic
1055155007 9:73052000-73052022 CTGAATCCACAGAGGCAGTGTGG + Intronic
1055777822 9:79784939-79784961 CTGTCTCCTTTGAGGCAGAGAGG + Intergenic
1057233765 9:93342508-93342530 CAGTGTCCAGAGAGGCAGGGTGG + Intronic
1057252080 9:93511515-93511537 CAGTGTCCAGAGAGGCAGGGTGG - Intronic
1057774197 9:97992507-97992529 CTGTGAGCTGAGAGGCAGTGTGG + Intronic
1060104106 9:120862831-120862853 CTGGGTCCAAGGAGGCAGAGAGG - Intronic
1061298971 9:129693933-129693955 CTGTGTCCTTGGAGGTAGAAAGG + Intronic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1062127514 9:134871544-134871566 CTGGGGCCCCAGAGCCAGAGAGG - Intergenic
1187397780 X:18933251-18933273 CGGTGTGCAGAGAGGCAGAGGGG - Intronic
1188712343 X:33415974-33415996 CTGTGTCCTCAGAGGTAGTGTGG + Intergenic
1189556310 X:42148862-42148884 CAGTCTCCTCAAATGCAGAGTGG - Intergenic
1190324144 X:49196273-49196295 GTGTGGCCTGAGAGGCAGAGGGG - Intronic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1190344161 X:49322235-49322257 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190345256 X:49331780-49331802 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190346350 X:49341346-49341368 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190347601 X:49532375-49532397 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190348702 X:49541931-49541953 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190349802 X:49551487-49551509 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190350907 X:49561040-49561062 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190352008 X:49570598-49570620 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190353109 X:49580147-49580169 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190354210 X:49589694-49589716 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190355312 X:49599218-49599240 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190685290 X:52867893-52867915 CCGTGGCCTCAGAGGCCGAAGGG - Intronic
1190918190 X:54825493-54825515 CTGTGGCGGGAGAGGCAGAGTGG - Intergenic
1192194571 X:69019613-69019635 CAGTGGCCTCAGAGGAAAAGTGG + Intergenic
1193952224 X:87813778-87813800 CTGTGTCCACAGAAGCTGGGGGG + Intergenic
1196930176 X:120674274-120674296 TGGTGTCCTCATAGGCAGAGGGG - Intergenic
1197272843 X:124444711-124444733 CTGAGTACTCAGAGGTAGAATGG - Intronic
1197873853 X:131084046-131084068 CTGTGCCCTCAGAGGCAGGGGGG + Intronic
1198341656 X:135720063-135720085 CTGCCTGCGCAGAGGCAGAGGGG - Intronic
1198346342 X:135763298-135763320 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198348248 X:135780583-135780605 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198350150 X:135797846-135797868 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198352060 X:135815119-135815141 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198353968 X:135832387-135832409 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198355876 X:135849637-135849659 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198357787 X:135866916-135866938 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198359705 X:135884198-135884220 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198366559 X:135945976-135945998 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1199873222 X:151915086-151915108 CTGCGACTTCAGAGGCAGTGGGG - Intronic
1199873391 X:151915761-151915783 CTGCGACTTCAGAGGCAGTGGGG - Intronic
1199873749 X:151917130-151917152 CTGCGACTTCAGAGGCAGTGGGG - Intronic
1199873919 X:151917805-151917827 CTGCGACTTCAGAGGCAGTGGGG - Intronic
1201530613 Y:14986578-14986600 CTCTGTCCTCTGGGGCAGTGTGG - Intergenic
1202200928 Y:22346801-22346823 ATGTGTACCCAGAGGCATAGGGG - Intronic