ID: 987591547

View in Genome Browser
Species Human (GRCh38)
Location 5:19934256-19934278
Sequence GTGAGAAGGACTTAATGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987591547 Original CRISPR GTGAGAAGGACTTAATGTGC TGG Intronic
902113658 1:14103605-14103627 GTGAGAAGGACTCACTGGCCAGG - Intergenic
902211851 1:14910288-14910310 CAGAAAAGGACTTGATGTGCAGG + Intronic
904399988 1:30249894-30249916 CTGAGAAGGACCGGATGTGCTGG - Intergenic
905796632 1:40819674-40819696 GTCACAAGGTCTTGATGTGCGGG - Intronic
906409801 1:45569316-45569338 GTGAGAAGGACACAATGTTGTGG + Intronic
911653147 1:100412293-100412315 GTGAGGAGTACTTAAAGTGGGGG + Intronic
912612665 1:111064161-111064183 GTTCCAAGGACTTACTGTGCTGG + Intergenic
912873066 1:113327779-113327801 GTGAGAAGGACTTTTTCTGGTGG - Intergenic
918699197 1:187586234-187586256 TTAAAAAGGACTTAATGTCCAGG + Intergenic
921423110 1:214971692-214971714 GTGAGGAGGACATAGAGTGCAGG - Intergenic
922117898 1:222632205-222632227 GACAGCAGAACTTAATGTGCAGG + Exonic
922958068 1:229622283-229622305 TTGGGAAGGACATAATGGGCTGG - Intronic
1065563965 10:26990508-26990530 GTGTCAAGGGCTTAAGGTGCAGG + Intergenic
1067196298 10:44122342-44122364 GATAGAGTGACTTAATGTGCTGG + Intergenic
1072709956 10:97709770-97709792 GTGACAGGGAATTAATGTGAGGG - Intergenic
1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG + Intergenic
1080312562 11:30911877-30911899 GTGAGCAGGACATAATATTCTGG - Intronic
1080383996 11:31799818-31799840 GTGACAAGGAGATAATATGCGGG - Intronic
1084599209 11:70134936-70134958 CTGAGAAGAACTTAGTGTGCTGG + Intronic
1086897300 11:92328135-92328157 GTCAAAAGCACTTAATGTCCAGG - Intergenic
1087543437 11:99550621-99550643 GTGATAAGGCCTCAATGTGAGGG - Intronic
1087919545 11:103850471-103850493 GTGAGAGGGATTTGATGTGAGGG - Intergenic
1096568157 12:52498442-52498464 GTGAGCAGGAGATAGTGTGCAGG + Intergenic
1098920031 12:76294403-76294425 GTGATAAGGTTTTAATGTGATGG - Intergenic
1099833254 12:87873126-87873148 GTGAGAAGGACTTGCTGGGTTGG - Intergenic
1099873351 12:88375023-88375045 GTGAGAAGGACATAAATTTCAGG - Intergenic
1102773543 12:115499378-115499400 GTGGGAAGGTCTTTCTGTGCAGG + Intergenic
1103826481 12:123743183-123743205 GAGAGCAGGACTGAATGCGCCGG - Intronic
1104537759 12:129634045-129634067 GTGGGAAAGAATTAATATGCTGG - Intronic
1105256573 13:18747195-18747217 GTGAGAAGGACATGAGGTTCTGG - Intergenic
1106143710 13:27033703-27033725 GTGAGTAGGACTCATGGTGCTGG + Intergenic
1106417389 13:29557734-29557756 GTGAGGAGGAGTGAATGTGAGGG + Intronic
1109333187 13:60957771-60957793 GTGAGATGGAGTTAAGGTGAAGG - Intergenic
1109651270 13:65330602-65330624 GGGAGAAGGTCTAATTGTGCTGG - Intergenic
1109900225 13:68759012-68759034 GTGAGAAGGACTTGACCTGTGGG - Intergenic
1113902152 13:113803457-113803479 GTGGGAGGCACTTAACGTGCCGG + Intronic
1114059821 14:19008624-19008646 TTGAGGAGGACTTTATGTTCAGG + Intergenic
1114102726 14:19393127-19393149 TTGAGGAGGACTTTATGTTCAGG - Intergenic
1114416470 14:22548156-22548178 GTGAGACTGACTTAGTGAGCTGG - Intergenic
1114642794 14:24235461-24235483 GTCAGAAGCAGTGAATGTGCTGG + Intronic
1117161381 14:52993902-52993924 GTGAGAAGAACTTTATCTTCTGG - Intergenic
1117222338 14:53618638-53618660 GTGAGAAGGACTCCACGTGGAGG + Intergenic
1120249203 14:82041749-82041771 AAGAGAAAGAGTTAATGTGCAGG - Intergenic
1121391745 14:93581872-93581894 GTGAGAATGACTTGATGAGTGGG + Intronic
1121678747 14:95775501-95775523 GTGAGAGGGGCATAATGTGGTGG - Intergenic
1202835458 14_GL000009v2_random:74908-74930 GTGAGAAGGACATGAGGTTCTGG + Intergenic
1125376787 15:39038747-39038769 GTGAGAATGAAATAATGTGCAGG + Intergenic
1127760610 15:62135903-62135925 GTGTGCAGGACATAATGTGTGGG + Intergenic
1130886509 15:88096901-88096923 GAGATAAGGACTTGATGTGCAGG - Intronic
1131413352 15:92229843-92229865 GTGAGTAGTGCTTTATGTGCAGG - Intergenic
1131542976 15:93289948-93289970 GTGGGAGGGAGTAAATGTGCAGG - Intergenic
1133819492 16:9223918-9223940 ATGAGAAGGATTTGATGTGTTGG + Intergenic
1134094022 16:11407057-11407079 GTGAAATGGACACAATGTGCTGG - Intronic
1135560481 16:23472544-23472566 CAGAGAAGGACTTAATAAGCTGG + Intronic
1140740018 16:77933129-77933151 GTCAGAAGAAATTAATGTGATGG + Intronic
1141332202 16:83121176-83121198 GTGAAAAGGACTCAATATGCAGG - Intronic
1143749445 17:9017774-9017796 GTGAGAAGTTCTTAAAGTGGCGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149662470 17:58342052-58342074 ATGAGAAGCACCTAAGGTGCTGG - Intergenic
1150363236 17:64557139-64557161 GTGCTAAGTGCTTAATGTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150570328 17:66380545-66380567 GTGAGAAGTACTGATTATGCTGG - Intronic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150820463 17:68430483-68430505 GTGAGATGGACTTGATATCCAGG + Intronic
1151520206 17:74623032-74623054 GTGAGAAATAATTAATGGGCTGG - Intronic
1154372139 18:13774011-13774033 GTGAGAAGGACATGATGTTTGGG - Intergenic
1154434471 18:14333484-14333506 GTGAGAAGGACATGAGGTTCTGG + Intergenic
1155032798 18:21998841-21998863 GTAAGAAGGAGATAGTGTGCTGG + Intergenic
1159091969 18:63860211-63860233 GTGAGAAGGACTTTATCTTGTGG - Intergenic
1160596229 18:79976357-79976379 GTGAAAAGTTCTCAATGTGCCGG + Intronic
1165939872 19:39409730-39409752 GTGGGGAGGACGGAATGTGCTGG + Intergenic
1168562032 19:57392755-57392777 GTCAGATGGACTTAATTTGAGGG + Intronic
1202637170 1_KI270706v1_random:52441-52463 GTGAGAAGGACATGAGGTTCTGG - Intergenic
925784002 2:7410720-7410742 GTGAGAATACCTGAATGTGCTGG - Intergenic
926791756 2:16579556-16579578 GTGAAAAGGTGTTAATTTGCAGG + Intronic
927276968 2:21270548-21270570 ATGAGAAGGAGTTAACGTACTGG - Intergenic
928258488 2:29745639-29745661 CTGAGAAGGACTTTTTGAGCAGG - Intronic
928628801 2:33169321-33169343 GGGAGAGAGACATAATGTGCTGG - Intronic
931974761 2:67630834-67630856 GTGAGAAGGACTAAATCTAGGGG + Intergenic
932180264 2:69640764-69640786 GTGAGTAGGAGTTAGTGTGGTGG - Intronic
934491628 2:94765028-94765050 GTGAGAAGGACATGAGGTTCTGG - Intergenic
937546217 2:123024285-123024307 GTCAGAAGGAATTAATGGGCTGG + Intergenic
938610148 2:132938890-132938912 GTGAGAGGGAATGAATGGGCGGG - Intronic
939754515 2:146093538-146093560 GTGAGAAGGACTTAAGATTTGGG - Intergenic
946848048 2:223878608-223878630 GTGAGAGGGACTTCATTTGGTGG + Exonic
947049353 2:226024629-226024651 GTGAGAAGGACTTCGTTAGCTGG - Intergenic
947078834 2:226373083-226373105 ATGACAAGGACTTAATGTCTAGG + Intergenic
1171471599 20:25376512-25376534 GTGAGAAGGCCTTATTTTCCTGG + Intronic
1171883329 20:30633464-30633486 GTGAGAAGGACATGAGGTTCTGG - Intergenic
1176254689 20:64145801-64145823 TTGAGAAGGAAATAATGGGCTGG + Intergenic
1176842567 21:13852223-13852245 GTGAGAAGGACATGAGGTTCTGG - Intergenic
1180478300 22:15731236-15731258 TTGAGGAGGACTTTATGTTCAGG + Intergenic
1181181742 22:21073367-21073389 GGAAGAAGCACTTAATGTGAGGG - Intergenic
1183044321 22:35207627-35207649 GTGAGAAGGACATAATTTTGGGG - Intergenic
950815258 3:15694567-15694589 CAGAGAATTACTTAATGTGCTGG - Intronic
951890622 3:27564714-27564736 CTGAGATGGAGTTAGTGTGCAGG - Intergenic
959448232 3:106466960-106466982 GTGGGAAGGACTTCATCTGGTGG - Intergenic
968094696 3:195920368-195920390 ATGAGAAGGACTCAGTATGCAGG - Intergenic
968914279 4:3490384-3490406 GAAAGAAGGACTGAATGAGCAGG - Intronic
968914393 4:3490936-3490958 GGGAGAAGGAATGAATGAGCAGG - Intronic
968914425 4:3491086-3491108 GAGGGAAGGAATTAATGAGCAGG - Intronic
970830815 4:20337435-20337457 GTGGTAAGGACTGACTGTGCTGG - Intronic
973366986 4:49215780-49215802 GTGAGAAGGACATGAGGTTCTGG - Intergenic
973393638 4:49576624-49576646 GTGAGAAGGACATGAGGTTCTGG + Intergenic
973651741 4:53003659-53003681 GGGAGAAGAACTTAATGGGATGG + Intronic
980578085 4:134711645-134711667 GTGAGAAAGATTTAATCTGGGGG - Intergenic
981757673 4:148158554-148158576 ATGAGAACATCTTAATGTGCTGG - Intronic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
1202764489 4_GL000008v2_random:138298-138320 GTGAGAAGGACATGAGGTTCTGG - Intergenic
985481380 5:113098-113120 CTGAGAAAGACAAAATGTGCAGG - Intergenic
987591547 5:19934256-19934278 GTGAGAAGGACTTAATGTGCTGG + Intronic
987881219 5:23749026-23749048 GTGAGAAGAACATAAATTGCGGG - Intergenic
988895744 5:35673013-35673035 GTGAGAATGACTGAATGTGAGGG + Intronic
992304491 5:75422253-75422275 GAGAGGAAGATTTAATGTGCTGG - Intronic
993493608 5:88582700-88582722 ATGAAAAGGACTTAATGTTAAGG - Intergenic
995898781 5:117045739-117045761 GTGAGCTTGACTTAAGGTGCAGG + Intergenic
1000139033 5:158383284-158383306 GTGGGAAGAACTTGATGTACTGG - Intergenic
1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG + Intronic
1005015077 6:21367539-21367561 GTGACTAGGACTTAATCTTCTGG + Intergenic
1006219521 6:32476730-32476752 TGGAGAAGGATTTAATTTGCAGG + Intergenic
1009569697 6:65368336-65368358 GTGTGAAGGATTTGATGTACAGG - Intronic
1010111444 6:72238923-72238945 TTGACAAGGACTTGCTGTGCAGG + Intronic
1010611129 6:77954587-77954609 GTGAGAAGGACTTGATGTTTGGG + Intergenic
1018137876 6:160795908-160795930 CTGAGAATGACTTAATTTTCTGG - Intergenic
1019107374 6:169679393-169679415 GTGAGAAGGACATAAAATGTAGG + Intronic
1020954538 7:14724570-14724592 GGGAGAAGGACTTAAAGTATAGG + Intronic
1022370488 7:29766471-29766493 GTGACAAAGGCTGAATGTGCAGG - Intergenic
1024955503 7:54915102-54915124 TTGAGAAGGGCTTCAGGTGCTGG - Intergenic
1029928180 7:104340962-104340984 GTAAGAATGACTAAATGTTCAGG - Intronic
1034454840 7:151163147-151163169 GTGAAAAGGACGCTATGTGCTGG - Intronic
1035000079 7:155605463-155605485 GTTAGAAAGACTCAATGTGGAGG - Intergenic
1035604784 8:922838-922860 GTGAGTTGGGGTTAATGTGCAGG + Intergenic
1035813383 8:2512673-2512695 ATGTGAAGGACTCATTGTGCTGG + Intergenic
1035963070 8:4158702-4158724 GTGATAAGGACTGAATGGGGTGG - Intronic
1036015458 8:4778585-4778607 GTGAGAGGGAGGTCATGTGCAGG + Intronic
1037327686 8:17710077-17710099 GTGAGCAGGAATTATTTTGCTGG + Intronic
1039479793 8:37864017-37864039 CTCAGAAGGACTCAATGAGCAGG + Intronic
1041199551 8:55438103-55438125 TTGAGAATGACTCAATGAGCAGG + Intronic
1049939442 9:531140-531162 GTGAGAAGTACTTAATTGGCTGG + Intronic
1050166941 9:2774858-2774880 GAGAGAAGGAATCATTGTGCTGG - Intronic
1050397127 9:5210838-5210860 GTGGGAAGGAATAAATGTACAGG + Intergenic
1052818067 9:33117069-33117091 TGGATAAGGACTTCATGTGCGGG - Intronic
1053666374 9:40320846-40320868 GTGAGAAGGACATGAGGTTCTGG + Intronic
1053915958 9:42945892-42945914 GTGAGAAGGACATGAGGTTCTGG + Intergenic
1054377527 9:64460874-64460896 GTGAGAAGGACATGAGGTTCTGG + Intergenic
1054518235 9:66055437-66055459 GTGAGAAGGACATGAGGTTCTGG - Intergenic
1054991038 9:71327306-71327328 GTGCTAGTGACTTAATGTGCTGG + Intronic
1059643405 9:116239410-116239432 TAGAGAAGGGCTTAATGTGTTGG - Intronic
1059697925 9:116746380-116746402 GTGAAAAGGACTCAATTGGCCGG - Intronic
1061358774 9:130126944-130126966 GTGACAAAGACTCAATGTGCTGG - Intronic
1203545237 Un_KI270743v1:123185-123207 GTGAGAAGGACATGAGGTTCTGG - Intergenic
1186103016 X:6176630-6176652 ATGAGAAGGACTCAATCTACTGG + Intronic
1188305293 X:28554705-28554727 GTGAGAAGAATTCAATGTGAGGG - Intergenic
1188656253 X:32699955-32699977 GTCAGATCAACTTAATGTGCGGG - Intronic
1190560218 X:51679561-51679583 GTGAGAAGGACTTAAGGCTATGG - Intergenic
1190564073 X:51713760-51713782 GTGAGAAGGACTTAAGGCTATGG + Intergenic
1192959345 X:76110705-76110727 GTGAGAAGGACTTTATCTCATGG + Intergenic
1193630283 X:83877132-83877154 GTGAGAAGGAGATTATGTCCAGG - Intronic
1194034352 X:88853003-88853025 GTTAGAAGGAGTTTATGTTCTGG - Intergenic
1194469391 X:94273360-94273382 GTGAGAAGGTCATCATGTTCTGG + Intergenic
1197072707 X:122319832-122319854 CTGATAAGGACTTAATATCCAGG + Intergenic