ID: 987598133

View in Genome Browser
Species Human (GRCh38)
Location 5:20028370-20028392
Sequence TTACACAGATTAGAAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 553}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987598133_987598134 6 Left 987598133 5:20028370-20028392 CCAGTATTTTCTAATCTGTGTAA 0: 1
1: 0
2: 2
3: 55
4: 553
Right 987598134 5:20028399-20028421 ACACATGTATGTAACTTAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987598133 Original CRISPR TTACACAGATTAGAAAATAC TGG (reversed) Intronic
901043942 1:6384173-6384195 TTACACCAATTGGAAAATACAGG + Intronic
901599420 1:10411118-10411140 TGAGAAAGAGTAGAAAATACAGG + Intronic
901701868 1:11049048-11049070 TTACACATATTTAAAAACACTGG + Intergenic
902996526 1:20229747-20229769 TTTCTCAGATTAGAAAACTCAGG + Intergenic
903189628 1:21649479-21649501 TTTCACAGATGAGAAAATTGAGG + Intronic
903357580 1:22757531-22757553 TTACACAGATGAGAAAATTGAGG - Intronic
903541125 1:24096952-24096974 TTTCACAGATGAGGAAATAGAGG + Intronic
903602350 1:24551934-24551956 TTTCACAGATGAGAAAACAGAGG + Intergenic
904113458 1:28144605-28144627 TAACACAGATGAGTAAAAACAGG + Intergenic
904928296 1:34065616-34065638 TTGCACAGATAAGAAAATTGAGG - Intronic
906855141 1:49296230-49296252 TTATACAGTTGAGAAAATAGAGG + Intronic
907536168 1:55160480-55160502 TTCCACAGATTAGGAAATTGAGG + Intronic
908336341 1:63128216-63128238 TTATACAGATGAGAAAATAGAGG + Intergenic
908587834 1:65592607-65592629 TAAAACAGATATGAAAATACTGG - Intronic
908589144 1:65610560-65610582 TTACACAGATGAGAAAACTGAGG - Intronic
908671307 1:66550753-66550775 TTACACAGATGAGAAAACTGAGG + Intronic
909174690 1:72341949-72341971 TCATACAGATTACAAAATATTGG + Intergenic
909561295 1:77011960-77011982 TTTTACAGATGAGAAAAGACAGG + Intronic
909578420 1:77203577-77203599 TTTCAAATATTAGAAAATTCTGG + Intronic
909774467 1:79466766-79466788 TTAAACAGAGGAGAAAATAAAGG + Intergenic
909898742 1:81107473-81107495 GTACACATATTAGAAAATCTAGG - Intergenic
910568276 1:88670529-88670551 TTACACAGATTTGAATAGACTGG + Intergenic
910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG + Intronic
910752658 1:90650779-90650801 TTACAACTAATAGAAAATACTGG - Intergenic
911314186 1:96336251-96336273 TTTTACAGATTGGAAAATAAAGG - Intergenic
911355900 1:96820095-96820117 TTTTACAGATGAGAAAATAATGG - Intronic
911802851 1:102166111-102166133 TTTCACAATTTAGAAAAGACAGG - Intergenic
912311727 1:108628841-108628863 CTACACAGATTACAAAAACCTGG - Intronic
912648466 1:111417299-111417321 TCTCACAGATGAGAAAATAAAGG + Intronic
912961422 1:114198800-114198822 TTATACAGATGAGAAAATGGAGG + Intergenic
913047166 1:115084290-115084312 TTATACAGATGAGAAAATGGAGG + Intronic
914731115 1:150371325-150371347 TTTTACAGATTAGAAAACAGAGG + Intronic
915653439 1:157336884-157336906 TTATACAGATTAGAAAGTGGTGG - Intergenic
915881066 1:159671977-159671999 TGAAACAGATTAGAAAGTCCAGG + Intergenic
916097073 1:161360804-161360826 TTAAATAGAATAGAAAATATAGG + Intronic
916416720 1:164599213-164599235 TTACACAATTTAGAAAGAACTGG - Intronic
916637530 1:166689573-166689595 TTACACAAATATGAAAATAGAGG - Intergenic
917462210 1:175241796-175241818 TTACACAGATTAGTAGATGGTGG - Intergenic
917612675 1:176704273-176704295 TTACACAGAGAAGAAAACATAGG - Intronic
917618261 1:176768284-176768306 TTCCACAGAATAGGTAATACAGG - Intronic
917892672 1:179454646-179454668 TTATTAAGATTAGAGAATACAGG + Intronic
918242252 1:182630834-182630856 TTACACAGATGAGAAAAGCAGGG + Intergenic
918342092 1:183576376-183576398 TTATACAGATTAGAAAGTTGGGG - Intronic
919758640 1:201082433-201082455 TTAAACAGTTTAGTAAATTCAGG - Intronic
920083500 1:203396091-203396113 TTCTACAGATGAAAAAATACTGG - Intergenic
920236028 1:204505972-204505994 TTAGAGAGTTTAGTAAATACTGG + Intergenic
920808999 1:209264592-209264614 TTTCATAGATAAGGAAATACCGG - Intergenic
920809461 1:209268459-209268481 TTTCATAGATAAGGAAATACAGG - Intergenic
920959026 1:210647794-210647816 TTACACAGATTAAAGGAAACTGG - Intronic
921662779 1:217826853-217826875 TTCCACAAATTAGAAAATTAAGG - Intronic
922356950 1:224785553-224785575 TTTCACAGATGAGAAAACAGGGG - Intergenic
922543410 1:226435800-226435822 TTTTACAGATTAGAAATTAAGGG + Intergenic
924190086 1:241541636-241541658 TGACACAGATTAGAGAACTCAGG + Intronic
924246976 1:242094811-242094833 GTTTACAGATTAGAAAATAGAGG + Intronic
924350524 1:243109837-243109859 TTTCCCAAATTAGAAAATTCTGG + Intergenic
1063396769 10:5695507-5695529 TTACACAAAATATAAAATAATGG + Intronic
1064844792 10:19639886-19639908 TTACATATATTAGAAAATATGGG + Intronic
1065130652 10:22616414-22616436 TTACACAGATAAGGAAATTGAGG + Intronic
1065139842 10:22709514-22709536 TTAAGTTGATTAGAAAATACAGG - Intronic
1065144224 10:22751713-22751735 TTACACAGATGAGAAAATGGAGG + Intergenic
1065147255 10:22782205-22782227 AAACACAGATTAGAAAATAAAGG - Intergenic
1065448271 10:25825292-25825314 TTTTACAGATAAGAAAATAGAGG - Intergenic
1068600223 10:58948964-58948986 CTTCACAGATGAGAAAATAGAGG - Intergenic
1069743310 10:70699253-70699275 TTGCACAGATGAGGAAATAGAGG - Intronic
1070166907 10:73905820-73905842 TTACACAGAGAGGAAAATAGAGG - Intergenic
1071365499 10:84896119-84896141 TTACACAGACTACAAAAAAATGG - Intergenic
1072237270 10:93464200-93464222 TTCCACAGCTTAGAAAACTCAGG - Intronic
1072494523 10:95943073-95943095 TCACACTGAATAGAAACTACTGG - Intergenic
1073891957 10:108112490-108112512 TCACCCAGATCAGAACATACAGG - Intergenic
1074037402 10:109754235-109754257 TTGCACACATTAGAAGTTACAGG + Intergenic
1074312823 10:112337023-112337045 TTTTACAGATGAGAAAATAAAGG - Intergenic
1074662863 10:115682216-115682238 TTTCACAGATTAGGAAACAAAGG - Intronic
1074752530 10:116600462-116600484 TGATACAGTTTAGAAAACACAGG + Intronic
1075225547 10:120625546-120625568 TTTTACAGATTAGAAAATGGAGG - Intergenic
1075562141 10:123475692-123475714 TTTCACAGATAAGAGAATTCAGG + Intergenic
1076318047 10:129556715-129556737 TTACACATATTTGAAAAGAAAGG + Intronic
1077832937 11:5895556-5895578 TTACAAAGATTAAAAAATAGAGG - Intronic
1078261157 11:9710185-9710207 TTTTAGAGATCAGAAAATACAGG - Intronic
1078276998 11:9858651-9858673 TTATATCAATTAGAAAATACAGG + Intronic
1078358628 11:10651472-10651494 CTATACAGATTACAAAATATAGG - Intronic
1078469622 11:11576594-11576616 TTCCACAGATTAGGAAATTGAGG + Intronic
1078858921 11:15229525-15229547 TTACACAGATGAGGAAATTGTGG - Intronic
1079142124 11:17818488-17818510 TCACACAGATAAGAAAATTGAGG + Intronic
1079284453 11:19116779-19116801 TTTCACAGATGAGAAAATTGAGG + Intergenic
1080133424 11:28823890-28823912 TTAGAAAAATTGGAAAATACTGG + Intergenic
1082017380 11:47501019-47501041 TTACACAGATTAGAACTTCTAGG - Intronic
1082988788 11:59189681-59189703 TTATAAAGATGAGAAAATAGGGG - Intronic
1084234953 11:67781643-67781665 TTACACAGCTGAGAAAACCCAGG - Intergenic
1084358598 11:68655138-68655160 GTACACACATTCGAAAATACCGG - Intergenic
1084403346 11:68957198-68957220 TTGCACAGATGAGAAAACAGAGG + Intergenic
1084922590 11:72483070-72483092 TTTCACAGATAAGAAAACAGAGG + Intergenic
1085205457 11:74729401-74729423 TTAGACAGATTAGGAAATTGAGG + Intronic
1085476099 11:76789834-76789856 TTACACAGATAAGAAAACCAAGG + Intronic
1085866188 11:80296612-80296634 TTACATAGTTCAGAAAACACTGG + Intergenic
1086126896 11:83358035-83358057 TTTCACAGATTAGGAAATGGAGG - Intergenic
1086229528 11:84551578-84551600 TTTAACAGATGAGAAAATACAGG + Intronic
1086857420 11:91881782-91881804 TTTCAGAGAATAGAAAAGACTGG - Intergenic
1087325027 11:96711116-96711138 TTTTACAGATGAGAAAATTCAGG + Intergenic
1088603772 11:111509761-111509783 TTAGACTAATTAGAAATTACTGG - Intronic
1090223641 11:125054614-125054636 TAACAGTGATCAGAAAATACTGG + Intergenic
1093063388 12:14630900-14630922 ATACTCAGATTAGAAAAAAAGGG + Intronic
1093624968 12:21334838-21334860 TAATACAGATTAGAAAATCATGG + Intronic
1093731942 12:22574930-22574952 TTTAACAGAATAGAAAATGCAGG + Intergenic
1093859889 12:24152089-24152111 TTCTACAGAATAGAAAATGCTGG - Intergenic
1093946906 12:25119873-25119895 TTAAAAATATTAGAAAATAGAGG + Intronic
1094729217 12:33155562-33155584 TTTCACAGATAAGAAAATAGAGG - Intergenic
1094875211 12:34633074-34633096 CTTCACAGATTATAAAAAACAGG - Intergenic
1095276856 12:40296064-40296086 TTTCACAGATGAGAAAATGAAGG - Intronic
1095481835 12:42644302-42644324 TTACATAAATGAGAAAGTACTGG + Intergenic
1096062737 12:48715818-48715840 TTAAATAGTTTACAAAATACCGG - Intronic
1096713537 12:53476318-53476340 TTTTACAGATTAAAAAATAGAGG + Intronic
1097026994 12:56064153-56064175 TTACAAAAATTAAAAAATATAGG + Intergenic
1097530963 12:60799436-60799458 CTACACAGAGAAGAAGATACAGG - Intergenic
1097687714 12:62706617-62706639 TTACACAAATAAGAAAATGGAGG + Intronic
1097971413 12:65637111-65637133 TTTTACATATTAGAAAATTCAGG - Intergenic
1098530307 12:71534145-71534167 TTACATGGACTACAAAATACTGG + Intronic
1098806089 12:75021513-75021535 TTACACAGTTCAGAAAATGAAGG + Intergenic
1098924970 12:76339151-76339173 TTTCACAGATGAGGAAATAAAGG + Intergenic
1099033091 12:77553564-77553586 ACACAAAGATTAGAAAATAAAGG - Intergenic
1099068130 12:78009614-78009636 TTTCACAGATTAGGAAATTGTGG - Intronic
1099263028 12:80408523-80408545 TTTTACAGATGAGAAAATAGAGG + Intronic
1099365637 12:81763136-81763158 TTACATAAATTAGAAAACTCAGG - Intergenic
1099905827 12:88768679-88768701 TTACACAAATGTGAGAATACTGG + Intergenic
1099958253 12:89372114-89372136 TTTTACAGATGAGACAATACAGG - Intergenic
1100101765 12:91116272-91116294 CTACAAAGATTACAAAATAGTGG - Intergenic
1101791460 12:107931423-107931445 TTTCACAGATGAGAAAACAGAGG + Intergenic
1102013274 12:109631971-109631993 TTTCACAGATGAGAAAACAGAGG - Intergenic
1102223858 12:111214064-111214086 TTACAAAGCTGAGAAAAGACAGG - Intronic
1102241105 12:111325430-111325452 TTTCACAGATGAGGAAATCCAGG + Intronic
1102550690 12:113689717-113689739 TTTCACAGATGAGAAAACAGAGG + Intergenic
1102818049 12:115884807-115884829 TTTCACAGATGAGAAAATTGAGG - Intergenic
1102948112 12:117007984-117008006 TTAAACATTTTAGAAAATACTGG + Intronic
1102996526 12:117355665-117355687 TTTCACAGATAAGAAAACAGAGG + Intronic
1103386801 12:120539192-120539214 TTTCACAGAAAAGAAAATAGAGG + Intronic
1103487039 12:121289997-121290019 TTTCACAGATGAGAAAATCAAGG - Intronic
1103574898 12:121870332-121870354 TTTCACAGATTAGAAGATGGAGG + Intergenic
1104087419 12:125488891-125488913 TGATGCAGATTAGAAAATAAGGG + Intronic
1105237341 13:18569607-18569629 TTACACACATTGAAAAAAACAGG - Intergenic
1105533451 13:21241937-21241959 TTACATTGATTAGAAATTATGGG - Intergenic
1105809123 13:23979351-23979373 TGACACAGACAAGCAAATACAGG - Intergenic
1105939411 13:25133961-25133983 TTCCACAGATGAGAAAATCGAGG + Intergenic
1106045196 13:26133115-26133137 TTTCACAGAATACAAGATACAGG + Intronic
1107225859 13:38046148-38046170 CCACACAGATGAGAAAAAACTGG + Intergenic
1108593198 13:51928653-51928675 TCAAACAGATGAGAAAATAGAGG + Intergenic
1108719108 13:53111942-53111964 GTACACAGATTAGAAGAAAATGG + Intergenic
1108845259 13:54670583-54670605 TTATACAGGTTAGAAAATGTTGG - Intergenic
1108857741 13:54816324-54816346 TTAAACACAGTAGAAAATAAAGG + Intergenic
1109950203 13:69491770-69491792 GTACACCAACTAGAAAATACTGG + Intergenic
1110872921 13:80473557-80473579 TTACACTGTCTAGAAAATACAGG - Intergenic
1110943745 13:81386693-81386715 TGACACAGATATTAAAATACTGG - Intergenic
1111122744 13:83876574-83876596 TTATACAGATGAGAAAATTGAGG - Intergenic
1111534691 13:89587590-89587612 TCACACATTTTAGAAATTACTGG + Intergenic
1111902565 13:94217844-94217866 TTATACAGATAAGAAAATGAAGG - Intronic
1111931612 13:94518448-94518470 TTCCACAGCTCAGAAAATACTGG + Intergenic
1112032474 13:95470423-95470445 TCACACAAATTATAGAATACAGG - Intronic
1112238853 13:97661191-97661213 TTTCACAGATTAGAAAACAGAGG - Intergenic
1112338722 13:98535679-98535701 TTACACAGCTGAGACAATTCGGG + Intronic
1112484035 13:99803569-99803591 TTACACATATTAGGAAAGTCAGG - Intronic
1112513702 13:100033334-100033356 GGACACAAATTAGAAAATCCAGG - Intergenic
1112609210 13:100939595-100939617 TTACACAGATGAGAAAATGTAGG - Intergenic
1112827984 13:103414064-103414086 TAACACAGATAAGAAGAAACAGG - Intergenic
1113036840 13:106059437-106059459 TTTCACAGTTTAAAAAACACAGG + Intergenic
1113157259 13:107337835-107337857 TTGCACAGATAAGACAATAGAGG - Intronic
1114846372 14:26327662-26327684 TTACGCAGATAAGCAATTACAGG - Intergenic
1115948264 14:38689911-38689933 TTACACAAAAGAGAAACTACAGG + Intergenic
1119812294 14:77532312-77532334 ATACACAGAATAGAAAATCCTGG + Intronic
1121504560 14:94466882-94466904 TTACACAGATGAGGAAATGGAGG - Intronic
1121773217 14:96571168-96571190 TAACACAGCTTAAAAATTACAGG - Intergenic
1121841978 14:97142211-97142233 TTTCACAGATAAGAAAATTGAGG + Intergenic
1122052502 14:99069655-99069677 TTTCACAGATTAGTCAATTCAGG + Intergenic
1122093648 14:99355830-99355852 TTTTATAGATTAGAAAATAGCGG - Intergenic
1122954486 14:105064145-105064167 TGAAACAGCTTAGAAATTACAGG - Intronic
1202918529 14_KI270723v1_random:7806-7828 TTACAAAGATGATAAAATACTGG + Intergenic
1202926093 14_KI270724v1_random:26765-26787 TTACAAAGATGATAAAATACTGG - Intergenic
1125033627 15:35097863-35097885 TAATACAGATTTGAAAATATTGG + Intergenic
1125113018 15:36055443-36055465 TTTCACAAATTAGAAATTATAGG - Intergenic
1125176463 15:36828257-36828279 TTACAAATATTGGAAAATATTGG - Intergenic
1125333566 15:38605521-38605543 TTTTACAGATTAGAAAACAGAGG - Intergenic
1126096160 15:45092255-45092277 TTACACAGATGAGAAAAGGCAGG - Intergenic
1126157903 15:45582582-45582604 TTACATGAATTTGAAAATACTGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126908014 15:53388534-53388556 TTGTACAGATTAGAAAATTGAGG - Intergenic
1127962817 15:63902493-63902515 TTTCACAGATTAGAAAACTGAGG + Intergenic
1128062713 15:64745440-64745462 TGATACAGATAAGAAAATAGAGG + Intronic
1128524403 15:68402693-68402715 TTTCACAGATGAGAAGATACAGG + Intronic
1129288606 15:74545886-74545908 TTTCACAGATGAGAAGACACAGG - Intronic
1129493562 15:75954208-75954230 TTACACACCATAGAAAATATTGG - Intronic
1130033497 15:80336972-80336994 TAACACAGCTGATAAAATACTGG + Intergenic
1131542392 15:93285800-93285822 TTATACAGATGAGGAAATAGAGG + Intergenic
1131762468 15:95639361-95639383 TTACACATATTAGAAAAGGGAGG + Intergenic
1131938206 15:97531452-97531474 GTACAAATATTAGAAAATATAGG - Intergenic
1132145058 15:99424710-99424732 TTTCACAGATAAGAAAATTGAGG - Intergenic
1132179397 15:99741103-99741125 TTTCATAGATGAGAAAATTCGGG - Intergenic
1132261583 15:100429786-100429808 TTACACATATTGTACAATACGGG - Intronic
1133092549 16:3415536-3415558 TTTCACACATCAGAAAATATAGG - Intronic
1133727154 16:8548216-8548238 TTTCACAAATGAGAAAATCCAGG - Intergenic
1133826046 16:9279153-9279175 TTAAACAGATGAGAAAACAGAGG + Intergenic
1133840412 16:9403035-9403057 TTACACAGATGAGAAAACTAAGG + Intergenic
1134017347 16:10898301-10898323 TTACACAGATGAGAAAATGGAGG + Intronic
1134162984 16:11907375-11907397 TTTTACAGATGAGAAAATAAAGG - Intronic
1134337602 16:13315612-13315634 TTTTACAGATGAGAAAATAAAGG - Intergenic
1134354812 16:13471831-13471853 TTACACAGAATATCAGATACAGG + Intergenic
1134610316 16:15603114-15603136 TAACAGAGTTTAGAAAATGCTGG + Intronic
1135091811 16:19523621-19523643 TTATACAGATAAGAAAAAAATGG + Intergenic
1135113315 16:19707417-19707439 TTGCACAGAGGAGAAAATAGAGG + Intronic
1135661540 16:24301279-24301301 TCCCACATATTAGAAAATATGGG + Intronic
1135780933 16:25299992-25300014 TTTCACAGATTAGAAAAGTGAGG + Intergenic
1138359510 16:56415717-56415739 TTACACAGATTAGGATATTTGGG - Intronic
1138449015 16:57081833-57081855 TTTCACAGATGAGAAAATTGGGG - Intronic
1139141856 16:64273934-64273956 TACCACAGAATAAAAAATACTGG + Intergenic
1139339151 16:66256468-66256490 TTTCACAGATGAGAAAATTGAGG - Intergenic
1139774588 16:69308592-69308614 TTGCACAGATTAGCCAAAACAGG - Exonic
1140054656 16:71515594-71515616 TTTTAAAAATTAGAAAATACAGG + Intronic
1140322342 16:73965400-73965422 TTTCACAGATTAGAAAACTGAGG + Intergenic
1140510820 16:75506986-75507008 TTACATAGATGAGAAAATCATGG + Intergenic
1140516679 16:75548078-75548100 TTACACAGATGACAAAATCAAGG + Intronic
1140953143 16:79838287-79838309 TTTCACAGATGAGAAAACAGAGG + Intergenic
1140992606 16:80228700-80228722 ATACACAGATCAGAAAAAAAAGG + Intergenic
1141394037 16:83689254-83689276 TTTAACAGCTTAGAAAATATTGG - Intronic
1142828949 17:2533035-2533057 TTATACAGATGAGAAAATTGAGG + Intergenic
1143075282 17:4337299-4337321 TTACACAGATTAGAGTGTAGTGG - Intronic
1143247217 17:5497359-5497381 TAATATTGATTAGAAAATACAGG + Intergenic
1143576048 17:7793979-7794001 GTACCCAAATGAGAAAATACAGG - Intronic
1146074953 17:29719656-29719678 TTTCACAGATGAGAAAACAAAGG + Intronic
1146204445 17:30890218-30890240 TTACACTGAATAGAATATATAGG - Intronic
1147022390 17:37547094-37547116 TCATACAGATTAGAAAACACTGG - Intronic
1147207781 17:38850796-38850818 TTACACTTGTGAGAAAATACTGG - Intronic
1147447198 17:40481664-40481686 TTTCACAGATAAGAAAATAAGGG - Intronic
1147699289 17:42382363-42382385 TTTTACAGATAAGAAAATAGAGG + Intronic
1148738274 17:49877231-49877253 TTTCACAGATGAGAAAACAGAGG - Intergenic
1149196152 17:54123809-54123831 TTACATAGATGAGAAATTAGAGG + Intergenic
1149904358 17:60511704-60511726 TTAAAAACATTAGAAAATGCAGG + Intronic
1150186995 17:63192678-63192700 TTTTACAGATGAGAAAATAGAGG - Intronic
1150844487 17:68641391-68641413 TTTCACAGATTAGGAAATTGAGG + Intergenic
1155109324 18:22698300-22698322 TTATACAGATTATTAAATACAGG + Intergenic
1155638307 18:27981227-27981249 TTACACAAAAAATAAAATACTGG + Intronic
1156217558 18:35015280-35015302 TTACACAGTTTAGGAAATGAAGG - Intronic
1156505413 18:37587482-37587504 TTTCACAGAGGAGAAAATAGAGG - Intergenic
1156565742 18:38187990-38188012 TTATAAAAATTAGAAAATGCTGG + Intergenic
1156570996 18:38252987-38253009 TTGCACAGATAAGAAAACATAGG - Intergenic
1156572759 18:38277826-38277848 TTACACAGAATGGAAAATAAAGG + Intergenic
1156601152 18:38608843-38608865 TTGCACATATTACATAATACTGG - Intergenic
1156719664 18:40054502-40054524 TAACCCAAATTAGCAAATACAGG - Intergenic
1157406761 18:47428260-47428282 TTACACAAATTAGAACAGGCTGG + Intergenic
1157535422 18:48453808-48453830 TTTTATAGATGAGAAAATACAGG - Intergenic
1157598263 18:48876790-48876812 TTTTACAGATGAGAAAATAGAGG - Intergenic
1157837302 18:50917542-50917564 GTACACATTTTAAAAAATACAGG - Intronic
1158000390 18:52611728-52611750 TTATACAGATGAGAAAATTGAGG - Intronic
1158197780 18:54908141-54908163 TTACAGAGTTTTAAAAATACAGG + Intronic
1158322549 18:56279488-56279510 TTTTACAGATGAGAAAATCCAGG + Intergenic
1158819793 18:61146189-61146211 TTTCACAGATTAGTAAGAACTGG - Intergenic
1159240313 18:65734218-65734240 TTTTATAGATTAGAAAATAGAGG + Intergenic
1159619419 18:70620219-70620241 TTACACAGTTTAGATAATAATGG - Intergenic
1159790238 18:72769585-72769607 TTAGAAAAATTAGAAAATACAGG + Intronic
1159872161 18:73770414-73770436 TAACACAGTTCAGAAACTACAGG + Intergenic
1160054780 18:75468279-75468301 TTTCTCTGATTATAAAATACAGG + Intergenic
1160206070 18:76833722-76833744 TTACAGAGAAAAGAAAATAAAGG - Intronic
1161314790 19:3612761-3612783 TAAGACAGAGGAGAAAATACTGG - Intronic
1162551964 19:11362820-11362842 TTTCACAGATGAGAATATCCAGG - Intronic
1164750623 19:30652217-30652239 TTTCACACATGAGTAAATACAGG + Intronic
1166064258 19:40347912-40347934 TTGTACAGATGAGAAAAAACGGG + Intronic
1167288006 19:48609760-48609782 TTACACAGATGAGAAAAGAGAGG + Intronic
1167656602 19:50768558-50768580 TTTCACAGAATATAAAATTCTGG + Intergenic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
925737103 2:6973041-6973063 TTTCATAGATAAGAAAATAGAGG - Intronic
926514736 2:13828475-13828497 TTACTCAGAATAAAAAATAGAGG - Intergenic
927531408 2:23806811-23806833 TTTCACAGATGAGAAAATTAAGG + Intronic
929071127 2:38031699-38031721 TTACAAAGAGAAGAAATTACTGG + Intronic
929210165 2:39347433-39347455 TCACACAGCTTACAAAAAACAGG + Intronic
930889322 2:56364648-56364670 TTAACCAGCATAGAAAATACCGG - Intronic
931506720 2:62936147-62936169 TTACACAAATTATAGAAAACTGG - Intronic
931532058 2:63226641-63226663 TTACACACTTTACAAAATAATGG + Intronic
931855301 2:66296787-66296809 TTACATAGATTAGAAATTTGCGG - Intergenic
932282625 2:70507363-70507385 ATACACAGATGCAAAAATACAGG - Intronic
933132656 2:78691675-78691697 TTACACAGATGAGACAATTTAGG - Intergenic
933330936 2:80892355-80892377 TTAAAGATATTAGAAATTACAGG - Intergenic
933772434 2:85753158-85753180 TTTCACAGATGAGTAAATCCCGG + Intronic
935169338 2:100598538-100598560 TTTCACAGATGAGAAAATGGAGG - Intergenic
935530173 2:104222667-104222689 TTTCAGATATTAGAAAATAGCGG + Intergenic
936758172 2:115739627-115739649 ATACACAGTCTAGAAAATATAGG + Intronic
937688861 2:124730953-124730975 TTACACAGACTAGAAAGAAGTGG - Intronic
938236025 2:129708000-129708022 TTTCACAGATGAGAAAATAGTGG + Intergenic
938471300 2:131564944-131564966 TTCTACAGATTAAAAAATGCAGG - Intergenic
938512436 2:131964896-131964918 TTACACACATTGAAAAAAACAGG + Intergenic
938656607 2:133441030-133441052 CTCCACATATTAGAAAACACAGG + Intronic
939097721 2:137853775-137853797 TTAGACAGATAAGAAAAAACAGG - Intergenic
939097995 2:137857883-137857905 TTAGACAGATAAGAAAAAACAGG + Intergenic
939540754 2:143490926-143490948 TTAAAGAAATTAGAAAATATGGG - Intronic
939580672 2:143941961-143941983 TTTCACAGATGAGAAAATTAAGG - Exonic
940046132 2:149411824-149411846 TAACACAGTTTAGAAAATAAAGG + Intronic
941040897 2:160622025-160622047 TTTCACAAAATAGAAATTACAGG - Intergenic
941153852 2:161950449-161950471 TGACACAGATAAGAAAATTGAGG - Intronic
942821226 2:180117910-180117932 TTAAACAGATTAGAAAATATAGG + Intergenic
942822795 2:180135802-180135824 TTAGAAAGGTTAGAAAATATAGG + Intergenic
942897514 2:181075211-181075233 TTACATAGTTGAGAAAATTCAGG - Intronic
943165395 2:184316685-184316707 TTAATCAGATTACAAATTACAGG + Intergenic
943693354 2:190893352-190893374 TTTCACAGATTAGGAAACAGAGG - Intronic
943730225 2:191294911-191294933 TTAAACAGAATAGAAAATGAAGG - Intronic
943799445 2:192039491-192039513 TTGCACAGATTGGAAAACATTGG - Intronic
944514070 2:200493643-200493665 TTTCACAGCTGAGAAAATTCAGG - Intronic
944928272 2:204488230-204488252 TTATACAGATGAGAAAATTGAGG - Intergenic
945605505 2:211924906-211924928 ATACAAAGATTTGAAAATAATGG - Intronic
945707843 2:213257859-213257881 TTGTACAGATTAGAAAATGGAGG - Intergenic
946152867 2:217787960-217787982 TTTCACAGATTAGAAAACCAAGG - Intergenic
946459852 2:219858957-219858979 AAACACATTTTAGAAAATACTGG - Intergenic
946463706 2:219892748-219892770 TTAAACAGATCATAAAACACAGG - Intergenic
946573432 2:221049064-221049086 TTTTACAGATTAGAAAATTGAGG - Intergenic
947502438 2:230681226-230681248 TAACACAGATGAGAAATGACAGG + Intergenic
948215320 2:236224687-236224709 GTACACAGATTAGAAAACCAAGG - Intronic
948669535 2:239559165-239559187 TTTCACAGATGAGAAAGTCCAGG + Intergenic
1169027268 20:2381491-2381513 TTACACAGATCAGAAAACAGAGG - Intronic
1170102891 20:12721612-12721634 TTACTCATATTTGGAAATACTGG - Intergenic
1170184992 20:13579133-13579155 TTACACACAATAGGAAATATTGG + Intronic
1170277734 20:14611213-14611235 TTTCACAGATAAGGAAACACAGG - Intronic
1170295418 20:14819572-14819594 TTAAACAGATCAGTACATACCGG + Intronic
1170339671 20:15310088-15310110 TTTTACAGATGAGATAATACAGG - Intronic
1170845801 20:19960961-19960983 TTACACAGATGAGAAAACTGAGG - Intronic
1170918849 20:20656342-20656364 TTAAACATATTAGAAAATGTGGG + Intronic
1171426642 20:25052678-25052700 TTGCACAGATTTGGAAATAAAGG - Intronic
1172895665 20:38298479-38298501 TTTCACAGATGAGAAAATTGAGG - Intronic
1173230617 20:41193178-41193200 TTACAGAAATAAGAAAATCCAGG - Intronic
1173406617 20:42771786-42771808 TTTCACAGATCAGAAAATTAAGG + Intronic
1173497050 20:43527226-43527248 TTTCACAGATGACAAAATAGAGG + Intronic
1173522171 20:43708404-43708426 ATACACACATTAGAAAACTCAGG - Intronic
1173650030 20:44657467-44657489 CTACACAGATGAGAAAATCAAGG - Intergenic
1173692794 20:44977581-44977603 TTTTACAGATGAGAAAATTCAGG + Intronic
1173934691 20:46851075-46851097 TTTCACAGATTAGAAAATCGAGG - Intergenic
1174815494 20:53683682-53683704 TTTCACAGATGAGAAAACAGAGG + Intergenic
1174967688 20:55237264-55237286 TTAAACAGATGAGAATATAATGG - Intergenic
1175612914 20:60366387-60366409 TTTCACAGATGAGAAAATCACGG - Intergenic
1176372788 21:6072528-6072550 TTACATAGATTATAGAATATGGG + Intergenic
1176781328 21:13197890-13197912 TTACACACATTGAAAAAAACAGG - Intergenic
1177417676 21:20815619-20815641 TTACACAGAATAGAAAATGGTGG + Intergenic
1177608905 21:23420547-23420569 TTACATAAAATAGAAAATATAGG + Intergenic
1177685180 21:24427013-24427035 TTCCACAGAATAGAAAATATGGG + Intergenic
1177845396 21:26282646-26282668 TTAAACAGATGAGAAAACAGAGG - Intergenic
1178028255 21:28492997-28493019 TTCAACAGATTTGAAAATGCAGG - Intergenic
1178556757 21:33598302-33598324 TTTCAAATCTTAGAAAATACTGG + Intronic
1178938608 21:36885871-36885893 TGACACAGATAAGGAAATAGAGG + Intronic
1179750689 21:43465715-43465737 TTACATAGATTATAGAATATGGG - Intergenic
1180705379 22:17806664-17806686 TAACACAGATTTGAAAACACAGG - Intronic
1181711064 22:24689497-24689519 TCACACTAATTACAAAATACAGG + Intergenic
1182023290 22:27098743-27098765 TTCCACAGATGAGAAAATAGAGG - Intergenic
1182186685 22:28411044-28411066 TTACACAAACTTGAAAATAAAGG - Intronic
1182857365 22:33529614-33529636 TTTCACAGATGGGAAAATAATGG - Intronic
1184466810 22:44673282-44673304 TTTCACAGATTAGAAAACTGAGG - Intronic
1184535154 22:45081802-45081824 TTCCACAGATGAGAAAATTGAGG + Intergenic
1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG + Intergenic
950132087 3:10554211-10554233 TTTCACAGAAGAGAAAAAACTGG + Intronic
951354999 3:21655260-21655282 TTTCACAGATGAGAAAATGCAGG + Intronic
951793370 3:26511044-26511066 TTTCACAGATTACAAAATTTTGG - Intergenic
952486260 3:33814091-33814113 TTTCACAGATAAGAAAATTAAGG - Intronic
953007362 3:38990739-38990761 TTTCACAGATGAGAAAATCATGG + Intergenic
953118267 3:40014342-40014364 TTACACAATTTACAAAATAATGG + Intronic
955434286 3:58884841-58884863 TTTCACAGATGAGAAAATCAGGG - Intronic
955825781 3:62946025-62946047 TTACACAGATGAGAAAATGGAGG + Intergenic
956264512 3:67381934-67381956 TTACACACAAGAGAAAATAAAGG + Intronic
956323178 3:68021601-68021623 GTATTCAGAGTAGAAAATACAGG - Intronic
956699065 3:71942778-71942800 TTTCACACATGAGAAAATAGAGG - Intergenic
956806205 3:72814596-72814618 TTTTACAGCTTAAAAAATACTGG + Intronic
956899477 3:73700106-73700128 CTTCCCACATTAGAAAATACAGG + Intergenic
957238060 3:77620597-77620619 TTTAACAGATTAGAAAGTTCAGG - Intronic
957504260 3:81099506-81099528 ATACCAAGATTAGAAAATGCTGG + Intergenic
957944182 3:87041118-87041140 ACACACAGATAAGTAAATACTGG + Intergenic
958666826 3:97150801-97150823 TTAAAGAGATTAGAAATTAGAGG - Intronic
958898648 3:99859884-99859906 ATACACAGAATAAAAAAGACGGG - Intronic
958987136 3:100794323-100794345 TTTTACAGATTAGAAAATTGAGG - Intronic
959365594 3:105454041-105454063 TTACACAGATGAGAAAATTGAGG + Intronic
959387913 3:105735590-105735612 TCACACATATTTGAAAATACAGG + Intronic
960308140 3:116087659-116087681 TTACTTGGCTTAGAAAATACAGG - Intronic
960614161 3:119581601-119581623 TTTCACAGATAAGAAAATGAAGG - Intronic
960897868 3:122524490-122524512 TAACAGATATTAGAAAATTCAGG + Intergenic
961597953 3:128034201-128034223 TTATACATATTAGAAAATCTTGG - Intergenic
963277854 3:143350711-143350733 TCTTACAGATTAGAAAATAGTGG + Intronic
963638087 3:147824804-147824826 TTACCCTGATTAGAAATGACAGG + Intergenic
963665178 3:148175742-148175764 TTACATAGACCAGAAAATGCAGG - Intergenic
963834239 3:150040331-150040353 TTTCACAGATGAGAAAATTGAGG - Intronic
963886041 3:150583717-150583739 AAACACAGATTTTAAAATACAGG - Intronic
965424711 3:168507891-168507913 TAAGACAGATCAGAAAATATAGG - Intergenic
965533159 3:169796265-169796287 TTTAACAGAATAGAAAATGCAGG - Exonic
965549929 3:169953864-169953886 TCTCACAGATTAGAAAATGGAGG - Intergenic
965801876 3:172502803-172502825 TTGAACAGATTAGTAAATTCTGG - Intergenic
965967871 3:174518040-174518062 TTGCACAGACTCGAAAAAACTGG + Intronic
966218441 3:177526831-177526853 TTATAAATATTAGAAAGTACAGG + Intergenic
966479203 3:180386560-180386582 TTTCACAGATTAAGAAATTCAGG - Intergenic
966518966 3:180852232-180852254 TGACACTGATTATAAAATAGAGG + Intronic
966577647 3:181520475-181520497 TTTTACAGATAAGAAAATAAAGG + Intergenic
967342224 3:188411555-188411577 TTACACAGAATAGAAAGTGATGG - Intronic
967872726 3:194245666-194245688 TTTTACAGATGAGAAAATAGAGG - Intergenic
968115776 3:196088468-196088490 TTAAATAGAATAGAAAATTCTGG - Intergenic
969096374 4:4735761-4735783 TTTCACAGATGAGAAAAGAGAGG + Intergenic
969185806 4:5473480-5473502 TTTCACAGGTTAGGAAGTACAGG + Intronic
969210286 4:5682020-5682042 TTTCACAGATGAGAAAACAGAGG - Intronic
969835996 4:9842084-9842106 TTACACAGATTGAAAAAAAATGG - Intronic
969974042 4:11079606-11079628 TTTGACAGATGAGAAAATAGAGG + Intergenic
970491626 4:16581270-16581292 TTTCACAGATGAGAAAATGAAGG + Intronic
970959023 4:21851244-21851266 TTACACAGATGAGAAAACCAAGG + Intronic
971740470 4:30513843-30513865 TTACACAGTATAGAAAAGATAGG - Intergenic
973071366 4:45863224-45863246 TTACCTAGATTAGAAGTTACTGG - Intergenic
974650292 4:64746468-64746490 TTCAAAAGATTAGCAAATACAGG - Intergenic
975476900 4:74833889-74833911 TTCTACAGATGAGAAAATTCAGG - Intergenic
976471826 4:85437438-85437460 TTACACTGATTATAAAACATAGG - Intergenic
976701783 4:87977896-87977918 TTCAACTGATTTGAAAATACAGG + Intronic
977082330 4:92547600-92547622 TTACCCAAAATGGAAAATACAGG + Intronic
977082723 4:92553218-92553240 TTACACAGATTACCCAATGCAGG - Intronic
977377899 4:96231250-96231272 TTACACACATTAGAAAATAGTGG + Intergenic
978368426 4:108006483-108006505 TGGCACAGATTAGAAACAACTGG - Intronic
978668050 4:111210553-111210575 TGACACATATAAGAAAATTCTGG + Intergenic
978709459 4:111761046-111761068 TCATACAGATAAGAAAATTCAGG + Intergenic
978768828 4:112432524-112432546 TTTCAGAGACTAGAGAATACGGG + Exonic
978897659 4:113908757-113908779 TTACACAGAATAGAAATTAAAGG + Intronic
979251416 4:118570720-118570742 TTTCCCAAATTAGAAAATTCTGG - Intergenic
980427314 4:132643218-132643240 TTATACTGAGTTGAAAATACTGG + Intergenic
981141420 4:141273922-141273944 TTTTACAGATTAGAAAACAGAGG + Intergenic
981234932 4:142404721-142404743 TTCCACAGACTAAAGAATACCGG + Intronic
982494605 4:156075035-156075057 TTCAACAGATTAGAAAATTGAGG - Intergenic
982935330 4:161467287-161467309 ATACTCAGATTAGAAAAAATAGG + Intronic
982976083 4:162063206-162063228 TTTCACAGATGAGAAAAAAGGGG - Intronic
982997395 4:162366937-162366959 TTACAGACCTTAGAGAATACTGG - Intergenic
983535639 4:168854057-168854079 TTACATAGATGAGAAAACAGAGG + Intronic
983612691 4:169667397-169667419 TTACACATATTAGGAAATAATGG + Intronic
984055624 4:174926007-174926029 TTACACAAAATAGGAAATAAAGG - Intronic
984557043 4:181226862-181226884 TTACACAGAATAGATTGTACAGG + Intergenic
984997498 4:185449879-185449901 TTACACATTTTATAAAATCCCGG + Intronic
986723129 5:10574697-10574719 TAGCACACATTTGAAAATACAGG + Intronic
986888595 5:12271651-12271673 ATACACAGACTAGTAAATATGGG + Intergenic
987055616 5:14188295-14188317 TTACACTTATTAAATAATACAGG - Intronic
987598133 5:20028370-20028392 TTACACAGATTAGAAAATACTGG - Intronic
988598707 5:32619820-32619842 TTACATAAATTAGAGAATACTGG - Intergenic
990147427 5:52778454-52778476 TAACACATATTAGAAAATTGTGG + Intergenic
990925649 5:61019049-61019071 TTTTACAGATGAGGAAATACAGG - Intronic
990969738 5:61491635-61491657 ATACACACATTTGTAAATACTGG + Intronic
991327779 5:65456807-65456829 TTAGAAAATTTAGAAAATACAGG - Intronic
991461109 5:66860176-66860198 TTTTACAGATGAGAAAATAAAGG - Intronic
991657146 5:68915340-68915362 TCATACAGATCAGAAATTACTGG + Intergenic
992093018 5:73335995-73336017 TTTCACAGATAAGAAAATTGAGG - Intergenic
992099922 5:73397155-73397177 TAACACAGCTTAGATAATATGGG - Intergenic
992302776 5:75401384-75401406 TTTCACAGATTAGAAAACCAAGG + Intronic
992358152 5:76007035-76007057 TTTCACACATGAGAAAATAAAGG + Intergenic
993714684 5:91264357-91264379 TTACAGAGCTTAGAAAAGAGGGG + Intergenic
993845485 5:92937551-92937573 TTAAACAAATAAAAAAATACTGG + Intergenic
993847671 5:92965699-92965721 TTACACACATTAATAAAAACTGG - Intergenic
993911092 5:93685731-93685753 TTAGATAGATGAGCAAATACTGG - Intronic
994553505 5:101266412-101266434 TGAAACAGATTAGAAAGTCCAGG + Intergenic
996833520 5:127766311-127766333 TTACACAGAGTATAATATGCAGG + Intergenic
997001885 5:129771372-129771394 CTACAAAGATGAGAAAATCCTGG - Intergenic
997637258 5:135421723-135421745 TTAAACAGATTTCAAAAAACTGG - Intergenic
997697350 5:135872090-135872112 TTTCACAGATGAGAAAACTCAGG + Intronic
997730407 5:136168294-136168316 TTATACACAATATAAAATACTGG - Intronic
998381482 5:141729175-141729197 TTTCACAGACAAGAAAATAGAGG + Intergenic
998912401 5:146974353-146974375 TTTCACACATTAGAAAATGGAGG + Intronic
998977576 5:147664909-147664931 TCATACAGTTTAGAGAATACAGG + Intronic
999321897 5:150620438-150620460 TTATACAGATGAGAATATAGAGG + Intronic
999494902 5:152087227-152087249 TTTCACAGATAAGAAAATTGAGG - Intergenic
1000336645 5:160246228-160246250 TTTTACAGATCAGAAAATAAGGG - Intergenic
1000339798 5:160268375-160268397 TTTCACAGATGAGGAAACACAGG - Intronic
1001088238 5:168717234-168717256 TTTCACAGATCAGTAAATAGAGG - Intronic
1001091143 5:168741867-168741889 TTTCACAGATCAGTAAATAGAGG + Intronic
1001753864 5:174151262-174151284 TTATACAGATAAGAAAATTGGGG - Intronic
1002630998 5:180578400-180578422 TTACACATACAACAAAATACAGG - Exonic
1003337723 6:5190158-5190180 GTACACAGAGTAGATACTACTGG + Intronic
1003388808 6:5694409-5694431 TTACATTGATTAGAAATTATGGG + Intronic
1003411363 6:5865691-5865713 TCACACAGATGAGGAAGTACAGG - Intergenic
1003917320 6:10799451-10799473 TTAGAAAAATTAGAAAATATGGG + Intronic
1004808467 6:19231348-19231370 TTACTAGAATTAGAAAATACAGG + Intergenic
1005129806 6:22493358-22493380 ATACAAAGATTCGTAAATACTGG - Intergenic
1005189479 6:23203576-23203598 TTATATAAATTAGAAACTACAGG - Intergenic
1005259351 6:24041762-24041784 TTAAAGAAATTAAAAAATACAGG - Intergenic
1007087253 6:39157450-39157472 TTACACAGATTAGGAAACTGAGG + Intergenic
1007408392 6:41647703-41647725 TTTCACAGATGAGAAAACAGAGG - Intronic
1007491335 6:42224366-42224388 TTACTCAAATTTGAAAATGCAGG + Intergenic
1007637728 6:43309312-43309334 TTGCACAGATGAGAAAATGGAGG - Intronic
1007738221 6:43994962-43994984 TTACACAGACAAGAAAACAGAGG - Intergenic
1007982798 6:46176294-46176316 TTTCAAAGGTTAGTAAATACAGG + Intergenic
1008422419 6:51317209-51317231 TTCTACAGATTAGATAATGCTGG + Intergenic
1009203333 6:60772706-60772728 TTTAACAGATTAGAAAACTCTGG - Intergenic
1009287655 6:61842028-61842050 TTACACAGCTAAGAATATAAAGG - Intronic
1009372715 6:62927335-62927357 TTACACAGGATAGCAAATAAAGG + Intergenic
1010976426 6:82319749-82319771 TTTCACACATGAGGAAATACAGG + Intergenic
1011823469 6:91279332-91279354 TCACAAAGATTTGAAAATTCAGG + Intergenic
1011936933 6:92791292-92791314 TTACAAGGATTAGAAAAGATGGG - Intergenic
1012003128 6:93679742-93679764 CTACCCAGATTAGAAAAGTCAGG + Intergenic
1012232874 6:96781314-96781336 TTTCACAGATGAGAAAACAAAGG + Intergenic
1012664555 6:101951251-101951273 TTAAAGAAAATAGAAAATACAGG - Intronic
1013872033 6:114775803-114775825 TTACACATTTTAGGAAATAGAGG + Intergenic
1014310982 6:119801184-119801206 TTTCACAGCTGAGAAAACACAGG - Intergenic
1014900717 6:126960884-126960906 TTACACATTGTAGAAAATAATGG + Intergenic
1015150406 6:130030820-130030842 TTTCACAGATGAGAAAATTGAGG - Intronic
1015206520 6:130645734-130645756 TTAAACAAATTCTAAAATACAGG - Intergenic
1015474539 6:133645450-133645472 TTTCACAGATTAGACACCACAGG - Intergenic
1016180051 6:141134690-141134712 TTACACAGAGGACAACATACTGG + Intergenic
1017165775 6:151407245-151407267 CTATACAGATTAGAAACTACAGG - Intronic
1017237758 6:152134938-152134960 TTACAAAGATTGGAAACCACAGG + Intronic
1017264776 6:152430572-152430594 TGACACAAATAAGAAGATACGGG - Exonic
1017971312 6:159314922-159314944 TTTCACAGATTAGGAAATCGTGG - Intergenic
1018052873 6:160026855-160026877 CTACAGAGACTAGAAAATGCAGG - Intronic
1018393181 6:163356406-163356428 TTATACAGATTAGAAAGTTGAGG + Intergenic
1018479681 6:164177496-164177518 TTACACAAATCTGAAAATTCAGG + Intergenic
1019058528 6:169239817-169239839 TTACAGAGATGTGAAAATAAGGG + Intronic
1019557938 7:1641871-1641893 TTTCACAGATGAGAAAACAGAGG - Intergenic
1019761595 7:2816828-2816850 TTTCACAGATGAGAAAACTCAGG + Intronic
1019806302 7:3128678-3128700 TGACACAGATTGCAAAACACTGG - Intergenic
1020482287 7:8676961-8676983 TTACACTGTTCAGCAAATACTGG + Intronic
1020936081 7:14465630-14465652 TTACACTGATTAGAAAATTGGGG + Intronic
1021338703 7:19436524-19436546 TTTTACAGATCAGAAAATACAGG + Intergenic
1021508811 7:21413370-21413392 TTTCACAGATGTGAAAATAGAGG - Intergenic
1021543715 7:21789710-21789732 TTTCACAGATGAGAAAACAGAGG - Intronic
1021644853 7:22779411-22779433 TTTCACAGATTAGAAAAACCTGG - Intergenic
1022399412 7:30023177-30023199 TTGCACAGATGAGGAAACACAGG + Intronic
1023132764 7:37019143-37019165 TTTCACAGATGAGAAAATTGAGG + Intronic
1023230364 7:38021578-38021600 TTTCACAAATGAGAAAACACAGG + Intronic
1023494032 7:40775555-40775577 TTTTACAGATTAGAAAATTAAGG + Intronic
1023655431 7:42414886-42414908 TTACGCAGATTAGTGAAGACTGG + Intergenic
1024122016 7:46252228-46252250 TTACACAGGATATAAAATTCTGG - Intergenic
1024228397 7:47345886-47345908 TTCTACAGATTAGAACATAGAGG + Intronic
1024741401 7:52358965-52358987 TTACACATATAAGAGAATAGAGG - Intergenic
1025194159 7:56919583-56919605 TTTTACAGATGAGAAAATTCTGG - Intergenic
1025677790 7:63657361-63657383 TTTTACAGATGAGAAAATTCTGG + Intergenic
1025883356 7:65561610-65561632 AGGCACAGATAAGAAAATACAGG - Intergenic
1026128835 7:67603762-67603784 TTTTACAGATTAGGAAATTCAGG + Intergenic
1026623438 7:71971594-71971616 TTACACAGGTGAAGAAATACAGG + Intronic
1027882985 7:83866501-83866523 ATATACAGATAAGAAAATTCAGG - Intergenic
1028678983 7:93503553-93503575 TTGCAAAAATTAGAAAATGCAGG - Intronic
1029347308 7:99987757-99987779 TTCCACAGATTAGACAATGGCGG - Intergenic
1029794945 7:102884318-102884340 TTGTACAGAGTAGAAAATAATGG + Intronic
1029987430 7:104934920-104934942 TTAACCAGATAATAAAATACAGG - Intergenic
1031132923 7:117853897-117853919 TTCCATATATTAGAAAATGCAGG - Intronic
1031133826 7:117863642-117863664 TTATACAGATGAGAAAACAGAGG - Intronic
1031391074 7:121215964-121215986 TTTCACAGATAAGAAAATTAAGG + Intronic
1031706488 7:124986305-124986327 TTATACATATTAGAAATTTCAGG + Intergenic
1031752500 7:125594459-125594481 TTTTACAGATGAGAAAATAGAGG + Intergenic
1031852397 7:126880998-126881020 AGGCACAGATAAGAAAATACAGG - Intronic
1033902021 7:146155085-146155107 TTTCACAGATGAGAAAATTGAGG + Intronic
1035439662 7:158885708-158885730 TTTCAAAGATTAGAAAACCCAGG + Intronic
1036733611 8:11286875-11286897 ATACACAGATGACAGAATACAGG - Intronic
1037009715 8:13825439-13825461 TTTCAGAGCTTAAAAAATACAGG + Intergenic
1037148572 8:15606015-15606037 TTAAACAGAATGAAAAATACAGG - Intronic
1037752039 8:21688953-21688975 CTTCACAGATCAGAAAATGCTGG + Intergenic
1037982596 8:23265107-23265129 TTCTACAGATTGGAAATTACAGG + Intergenic
1038973180 8:32660701-32660723 TTTCACAGATGAGAAAATCGGGG - Intronic
1039622952 8:39017088-39017110 TTACATAGAGAAGAAAATAGAGG - Intronic
1040798383 8:51313740-51313762 TAATCCAGATTAGAAAATCCAGG - Intergenic
1041474922 8:58253706-58253728 TTACACAGAGTTAGAAATACAGG - Intergenic
1041681767 8:60600828-60600850 TTACACAGATGGGATAATACAGG - Intronic
1041971170 8:63744376-63744398 TTACACAGATGAGTATATAGTGG - Intergenic
1042513332 8:69633957-69633979 CTACACAGATTAGAAAATTTGGG + Intronic
1043807141 8:84685658-84685680 TTACACAATTTAAAAAACACAGG + Intronic
1044093309 8:88029442-88029464 TTAAATAGATTAGATAATTCAGG + Intergenic
1044902894 8:96967862-96967884 TTTCACAGATGAGAAAATTGAGG - Intronic
1045439186 8:102192945-102192967 TTTTACAGATTAGAAAATTGAGG + Intergenic
1045804434 8:106141002-106141024 ATTCACAGATTAGAAAACTCAGG - Intergenic
1046625682 8:116574414-116574436 TTAATCAAATTAGAAAACACAGG + Intergenic
1047182717 8:122604868-122604890 TTTCACAGATGAGGAAATAGAGG - Intergenic
1047472028 8:125184908-125184930 TTTTAAAGATTAGAAAATAGAGG + Intronic
1047616807 8:126569451-126569473 TTTCACAGATGAGAAAACAGAGG + Intergenic
1047822700 8:128538945-128538967 CTACTCACATTAGAAAATAACGG - Intergenic
1047915354 8:129577526-129577548 TTATATATATTAGAAAATGCAGG - Intergenic
1048424915 8:134314066-134314088 TTAAACAGATGAGGAAATAAAGG - Intergenic
1048560789 8:135535131-135535153 TCACACAAATTAGAAAATTAGGG - Intronic
1048856087 8:138687726-138687748 TTTTACAGATGAGAAAATCCAGG + Intronic
1050706266 9:8402030-8402052 AAACACAGAAGAGAAAATACTGG - Intronic
1051204920 9:14676564-14676586 ATACACAAGTTAGAACATACCGG - Intronic
1051241903 9:15065880-15065902 TTACACATATTAAGAAATAATGG - Intergenic
1051540761 9:18214149-18214171 TTAGAAAGAGAAGAAAATACAGG - Intergenic
1051719002 9:20016065-20016087 TACCACAGATTGGAAAATATAGG + Intergenic
1051762003 9:20477887-20477909 TTTCACAGATTAACCAATACTGG + Intronic
1052737722 9:32361338-32361360 TTCCACAGAATAGAAAATGATGG - Intergenic
1054861981 9:69963353-69963375 TTACAGGGGATAGAAAATACAGG - Intergenic
1054941861 9:70752202-70752224 TTACACTGATTAGAAAAATAGGG + Intronic
1054988230 9:71287929-71287951 TTACAGGTATTACAAAATACAGG + Intronic
1055040990 9:71872155-71872177 TTAAACAGATGAGGAAACACAGG + Intronic
1056008960 9:82304955-82304977 TTTCACAGATGATAAAATAGAGG - Intergenic
1056029982 9:82543427-82543449 ATACACAGTTTAGAAAAGATGGG - Intergenic
1056468460 9:86882082-86882104 ATACACAGACTAGGAGATACTGG - Intergenic
1057184793 9:93051153-93051175 CTAAACAGTTTAGCAAATACGGG + Intergenic
1058694138 9:107545043-107545065 TTACACATATTTGCAAGTACTGG - Intergenic
1059135303 9:111800808-111800830 TTACACACATTGAAAAATTCAGG + Intergenic
1059306696 9:113359192-113359214 TTTTACAGATTAGAAAATAGAGG + Intronic
1059403910 9:114088115-114088137 TTACCAATATTAGAAAATAAAGG + Intronic
1059733586 9:117079973-117079995 TTACACAGCTGAGAAAATCGTGG + Intronic
1059848261 9:118305692-118305714 TTGCAAACATTAGCAAATACAGG + Intergenic
1059974384 9:119700030-119700052 TTTCACAGTGGAGAAAATACTGG - Intergenic
1060121822 9:120998707-120998729 TTACAAAGATGAGAAAATGGAGG - Intronic
1060788595 9:126469944-126469966 TTCCACAGTTTAGAAAAGAGAGG - Intronic
1061465034 9:130771431-130771453 TTATACAGATGCCAAAATACAGG + Intronic
1061648530 9:132026903-132026925 TTTCACAGATGAGAAAATTGAGG + Intronic
1062156936 9:135055200-135055222 TTAGCCAGATTGAAAAATACGGG + Intergenic
1186892817 X:13976459-13976481 TTATTTACATTAGAAAATACTGG + Intergenic
1186954274 X:14664457-14664479 TTACAGAATTCAGAAAATACCGG + Intronic
1187464199 X:19514439-19514461 TTTTACAGATAAGAAAATAGAGG - Intronic
1188071423 X:25722797-25722819 TTTTACAGATTAGAAAATTGAGG + Intergenic
1190396116 X:49986922-49986944 ATTCACAGTTTAGAAAATGCTGG + Intronic
1191680792 X:63837967-63837989 TTACACAGATGAGAAAATTGAGG - Intergenic
1192036796 X:67572006-67572028 TTATACAGATGAGAAAATCGAGG - Intronic
1192545263 X:72007673-72007695 TTTTACAGATTAGAAAATCAAGG + Intergenic
1193184490 X:78496066-78496088 TTATACAGAGAAGATAATACAGG + Intergenic
1193410343 X:81155304-81155326 TTAGAGATATTAGAAAATTCTGG + Intronic
1194868782 X:99101498-99101520 ATAAACAGATAAGAAAGTACAGG + Intergenic
1194877725 X:99209712-99209734 TTACACAGAAGAAAAAACACTGG - Intergenic
1195375953 X:104228431-104228453 TGTCAAAAATTAGAAAATACAGG - Intergenic
1196208691 X:112970655-112970677 TTCCACAGATTAGACAATGTTGG + Intergenic
1196484940 X:116195917-116195939 TGACACTGATTAGAAAAGAATGG + Intergenic
1196661736 X:118277881-118277903 TTACACAGATGAGGAAACCCAGG + Intergenic
1197675484 X:129325439-129325461 TTTCACTGATTAGAAAACACAGG + Intergenic
1198399785 X:136257555-136257577 TTATACAGATTAAAAAAAATGGG + Intergenic
1198999802 X:142621667-142621689 TTCCACAGATTGGGAAATTCAGG + Intergenic
1199418561 X:147615961-147615983 TTTCACAGATGAGAAAATTGAGG - Intergenic
1199487577 X:148364949-148364971 TTACTAAAATTATAAAATACAGG - Intergenic
1200973303 Y:9179452-9179474 ATACACAGAAGAGAAATTACAGG + Intergenic
1202030083 Y:20562408-20562430 GTTCACAGAATATAAAATACAGG + Intergenic
1202137774 Y:21685060-21685082 ATACACAGAAGAGAAATTACAGG - Intergenic