ID: 987604783

View in Genome Browser
Species Human (GRCh38)
Location 5:20119106-20119128
Sequence AAAATCTACAAAAGTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987604783_987604786 12 Left 987604783 5:20119106-20119128 CCACCTCTACTTTTGTAGATTTT 0: 1
1: 0
2: 1
3: 45
4: 388
Right 987604786 5:20119141-20119163 TCCATGAAATACTTAAATATTGG 0: 1
1: 0
2: 2
3: 28
4: 410
987604783_987604789 25 Left 987604783 5:20119106-20119128 CCACCTCTACTTTTGTAGATTTT 0: 1
1: 0
2: 1
3: 45
4: 388
Right 987604789 5:20119154-20119176 TAAATATTGGGTTGTATTGTTGG 0: 1
1: 0
2: 2
3: 22
4: 248
987604783_987604788 13 Left 987604783 5:20119106-20119128 CCACCTCTACTTTTGTAGATTTT 0: 1
1: 0
2: 1
3: 45
4: 388
Right 987604788 5:20119142-20119164 CCATGAAATACTTAAATATTGGG 0: 1
1: 0
2: 5
3: 34
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987604783 Original CRISPR AAAATCTACAAAAGTAGAGG TGG (reversed) Intronic
900403647 1:2483119-2483141 AATACCTCCAAAAGTCGAGGAGG - Intronic
900571057 1:3358424-3358446 AAAATCTCCCACAGTGGAGGAGG + Intronic
902868772 1:19299571-19299593 AAAATCTAAAGAAGCAGAGCTGG - Intergenic
903049350 1:20589271-20589293 AGAATCTTCAAAGGTAAAGGTGG + Exonic
903125010 1:21241833-21241855 AAAATCTCCAAAAGGAGCGAGGG + Intronic
904122376 1:28208356-28208378 AAAACCTACAATTGTAGAGGAGG - Exonic
904230881 1:29070516-29070538 GAAAAGTACTAAAGTAGAGGTGG - Intronic
905001458 1:34673378-34673400 AAAATCTGCTAAAGAAGAAGAGG - Intergenic
905175510 1:36132885-36132907 AAAAAATACAAAAATTGAGGCGG + Intergenic
907861164 1:58354939-58354961 AAAATCAACTAACTTAGAGGGGG - Intronic
907932146 1:59010444-59010466 AACACCTACAATAGTAGAGGTGG - Intergenic
908411542 1:63870813-63870835 AAATTCTCCAAAAGGAGAAGAGG + Intronic
908596777 1:65696851-65696873 AAAATTTACTAAAGTGGTGGCGG - Intergenic
908679440 1:66643404-66643426 AAAACATACAAAAGTAAAGGAGG - Intronic
909518103 1:76534626-76534648 AACATCTACAGAAGTAGTGTTGG - Intronic
911286489 1:96000010-96000032 AAAATCTTGAATAGTAGTGGTGG - Intergenic
911898051 1:103464873-103464895 AAACGCTAAAAAAGTGGAGGTGG - Intergenic
913349442 1:117841940-117841962 AAAATAAAGGAAAGTAGAGGGGG + Intergenic
913571892 1:120128902-120128924 AAAAACAACAAAAATATAGGAGG + Intergenic
913727197 1:121668395-121668417 AACATCTGCAAATGTATAGGTGG - Intergenic
913728033 1:121677724-121677746 AACATCTGCAAATGTATAGGTGG - Intergenic
914292811 1:146290525-146290547 AAAAACAACAAAAATATAGGAGG + Intergenic
914422660 1:147543300-147543322 AAAATCTGTAAAAGTCTAGGAGG + Intronic
914553855 1:148741308-148741330 AAAAACAACAAAAATATAGGAGG + Intergenic
915202196 1:154239354-154239376 AAAATCTACAAAAATATCTGGGG - Intronic
917161943 1:172067457-172067479 CAAAGCTAGAAAAGTAGAGAGGG - Intronic
918576995 1:186073430-186073452 CAAATGTAGAAATGTAGAGGTGG + Intronic
921240222 1:213172753-213172775 ACAATCTTCAAAAGCAGAGGTGG - Intronic
921723514 1:218499771-218499793 AAAATCCACAAAATGAGATGAGG + Intergenic
922192298 1:223330104-223330126 AAGAAATACAAAAGGAGAGGAGG - Intronic
922530399 1:226341013-226341035 AAAATTTGCAAAAGTAATGGGGG + Intergenic
1064155870 10:12902674-12902696 AAAATCGTGAAAAATAGAGGAGG + Intronic
1064397794 10:14995532-14995554 AAAATATTCCAAGGTAGAGGGGG + Intergenic
1064812955 10:19222321-19222343 AAAATCTGCAACATCAGAGGTGG - Intronic
1066149987 10:32606210-32606232 AAAAAGTACAAGAGTAAAGGAGG + Intronic
1066496640 10:35948567-35948589 AAAATATGCTAAAATAGAGGAGG - Intergenic
1068048834 10:51922343-51922365 AAAATCTACAAAACCAAAAGTGG - Intronic
1069013074 10:63396416-63396438 AAAAAATAAAAAAGGAGAGGTGG - Intronic
1069197932 10:65576287-65576309 AACATTTGCAAAAGTACAGGAGG + Intergenic
1070376358 10:75834996-75835018 AATATCTAAAACAGTAGAAGTGG - Intronic
1071174184 10:82904739-82904761 GAAATCAAAAAAAGTAGATGGGG + Intronic
1071499376 10:86192714-86192736 AAAAACTACAAAAGTAAAGTAGG + Intronic
1071883874 10:89928671-89928693 AAACAATACAAAAGTAGAGGCGG - Intergenic
1071965939 10:90852849-90852871 AGAAACTAGAAAAGGAGAGGAGG + Intronic
1073194754 10:101681040-101681062 TAAATTTATAAAGGTAGAGGTGG + Intronic
1074021394 10:109588235-109588257 AAAATATACAATAGTTGAGTTGG + Intergenic
1075205349 10:120443115-120443137 AAAATCTACAAATGTGGAGTAGG + Intergenic
1077892127 11:6426539-6426561 AAGATATAGAAAAGTAGATGTGG - Intergenic
1078587188 11:12602373-12602395 AAGATCTACATAAGTATAAGGGG - Intergenic
1079961196 11:26926165-26926187 AAAATGTTAAAAAGCAGAGGGGG - Intergenic
1080487904 11:32730401-32730423 AAAATCCTCAAAAATGGAGGAGG - Intronic
1080994817 11:37586746-37586768 AAAATCAGCAAAAGAAGAGGTGG - Intergenic
1081049480 11:38319796-38319818 AAACTATAAAAAAATAGAGGAGG + Intergenic
1081516790 11:43839991-43840013 GAAATCTACAAAAGTCTGGGAGG - Exonic
1082601604 11:55164554-55164576 AAAATCTACAAAGGGATAGTTGG - Intergenic
1082896608 11:58198102-58198124 AAAATCTACATAAGGAATGGTGG - Intergenic
1083534480 11:63455534-63455556 AATATCTACAAAAGTTATGGAGG - Intergenic
1086093476 11:83027242-83027264 AAGATTTACAAAAGTAGGGAGGG - Intronic
1086665413 11:89475424-89475446 AAAATGCACAAAAGTAGAAATGG - Intronic
1086793989 11:91077402-91077424 AAAATCCAGAAAAGTAAAAGTGG - Intergenic
1088281361 11:108138390-108138412 AAAAAAAAAAAAAGTAGAGGCGG - Intronic
1088310838 11:108458750-108458772 AAAATTTAAAAAAGTAGGGAAGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089907704 11:122060294-122060316 AAAATAGAAAAAAGTACAGGAGG + Intergenic
1090230745 11:125101599-125101621 AAAAACAACAGAAGTGGAGGTGG - Intronic
1090372685 11:126267878-126267900 AAAAACTAGAAAGGTAGATGGGG - Intronic
1092299314 12:7230427-7230449 AGAATTTTCCAAAGTAGAGGTGG - Intergenic
1092347402 12:7727100-7727122 AAAATCTACAAAAGTAGTCATGG + Intergenic
1092766829 12:11860695-11860717 AAAATTTACACAAACAGAGGGGG - Intronic
1093285614 12:17257201-17257223 GAAGTCTACAAATGAAGAGGTGG + Intergenic
1093352052 12:18116009-18116031 AAAATCTAGAATAGGAGAGCAGG + Intronic
1094110801 12:26860285-26860307 AAAATCTTCAAGAGAAGAGAAGG - Intergenic
1095067635 12:37799856-37799878 AAAATCTACAAAGGTATATTTGG + Intergenic
1095398242 12:41785802-41785824 AAAATATCAAAAAGTGGAGGTGG - Intergenic
1096050377 12:48602196-48602218 AAAAGCTATAAAATCAGAGGGGG + Intergenic
1096130353 12:49154124-49154146 TAAATATAAAAAAGTAGAGAGGG - Intergenic
1096814082 12:54190672-54190694 TAAATTTACATAAGTAGAGAGGG - Intergenic
1096961343 12:55581162-55581184 ACAGTCTATAAAACTAGAGGGGG - Intergenic
1097607862 12:61778173-61778195 ACAATCTCCAAAAGTAAAGAGGG - Intronic
1097683825 12:62673876-62673898 AAAAAGTAAAAAAGTATAGGTGG - Intronic
1098311896 12:69156960-69156982 AAAACTTAGAAAAGTAGAAGAGG + Intergenic
1099437552 12:82661816-82661838 ATAATTTTTAAAAGTAGAGGGGG + Intergenic
1099748581 12:86740536-86740558 AAAAACTACAAAATCAGAAGTGG - Intronic
1099945707 12:89241540-89241562 AAAAAGAACAAAACTAGAGGAGG - Intergenic
1100014899 12:89997300-89997322 AATTTCTTTAAAAGTAGAGGAGG + Intergenic
1100093137 12:90996906-90996928 AAAATCTACATAAGTAGTTGAGG + Intronic
1101224168 12:102671078-102671100 GGAATCTACAAAAAAAGAGGAGG + Intergenic
1101298753 12:103455627-103455649 AAAATCGATGAAAGTAGAAGAGG - Intronic
1102065927 12:109975660-109975682 AAAATATTCAAAAGAGGAGGGGG - Intronic
1102538183 12:113597697-113597719 AAAATATCCAATTGTAGAGGTGG + Intergenic
1103133280 12:118486776-118486798 AAAATTACCAAAATTAGAGGAGG - Intergenic
1106675867 13:31957526-31957548 AAAATCTGCACAAATAGGGGTGG + Intergenic
1107112681 13:36714976-36714998 AAAAGCTACAAAAGAGGAGCAGG + Intergenic
1107280249 13:38725407-38725429 AAAATGAATAAATGTAGAGGAGG + Intronic
1108367847 13:49734872-49734894 AAAATTTGCAAAATTAGAAGGGG - Intronic
1109066936 13:57707542-57707564 AATATCTAAAAATGTAGAAGTGG - Intronic
1109220565 13:59636991-59637013 AAGATCTTTAAAAGTAGAGGAGG + Intergenic
1109477647 13:62903841-62903863 AATATCTAGAAAAGTAGATTTGG + Intergenic
1109607599 13:64717337-64717359 AAGATCTTAAAAAGTAGGGGAGG - Intergenic
1109669288 13:65584164-65584186 GAAATCTATCTAAGTAGAGGAGG - Intergenic
1110889812 13:80684783-80684805 ACAATTTCAAAAAGTAGAGGGGG - Intergenic
1112032114 13:95466867-95466889 AAAAAAAAAAAAAGTAGAGGGGG - Intronic
1112511633 13:100015014-100015036 AAAATTTACAAAAATAAAGTTGG - Intergenic
1112729216 13:102341088-102341110 AAAATTAACAAAAGTAAAAGGGG + Intronic
1113047553 13:106171892-106171914 AAAAACAAGAAAAGAAGAGGAGG + Intergenic
1113236251 13:108278495-108278517 AAAATTTACAAATTTAGAAGAGG - Intronic
1114553346 14:23546954-23546976 GAAATCTACAAAAGAAGACAGGG - Intronic
1115076699 14:29401155-29401177 AAAATCTCAACAAATAGAGGGGG - Intergenic
1115534566 14:34360784-34360806 AAAATGTAGAAAAGGAAAGGAGG + Intronic
1115654480 14:35430304-35430326 AAAACCTACGATTGTAGAGGAGG + Intergenic
1116801491 14:49449094-49449116 AAAATGTAAAAAAGGAAAGGAGG + Intergenic
1117790302 14:59333214-59333236 ATAAAATACAAAAATAGAGGCGG + Intronic
1117923018 14:60745375-60745397 AAAATCTGCAAGACTACAGGAGG - Intronic
1118523304 14:66611994-66612016 TAAAACTAAAAAAGTAGATGGGG - Intronic
1119108901 14:71952462-71952484 AAAATCTAGAAAGGTAGATATGG - Intronic
1119124089 14:72108643-72108665 AATAACTTCAAAAGTAGAAGGGG - Intronic
1120375448 14:83699571-83699593 AAAATCAACAAAAGCAAAAGAGG + Intergenic
1121375791 14:93409872-93409894 AAAATTTACATGAGTAGAAGGGG + Intronic
1124597087 15:31100403-31100425 AAAATTAGCAAAAGTAGTGGGGG - Intronic
1125242910 15:37597253-37597275 AGAATCTACAAATCTAGAGCAGG - Intergenic
1129810144 15:78503961-78503983 AAAAATTATAAAAATAGAGGTGG + Intergenic
1130101488 15:80897754-80897776 AAATTCAGCAAAAGCAGAGGGGG + Intronic
1130780713 15:87036831-87036853 AAAATTGACAAAAAAAGAGGAGG - Intergenic
1133017924 16:2953347-2953369 AAAAACTACAAAATTAGCCGGGG - Intergenic
1133644726 16:7753824-7753846 AAAATTTACAAAAAAAGGGGTGG + Intergenic
1134157668 16:11856819-11856841 AAAAGATGCAAAAGTAGATGTGG - Intergenic
1134781398 16:16900054-16900076 AAAATTAACAAAAGAAGAGTTGG - Intergenic
1135094287 16:19551791-19551813 AAAATCTACAGAAGTTAATGTGG + Exonic
1135557599 16:23450093-23450115 TAAAAATACAAAATTAGAGGTGG - Intronic
1135788850 16:25375047-25375069 AAATCCTACAAAAGTAGCAGAGG - Intergenic
1136531102 16:30869950-30869972 AAATTCTAGAAAAATAGAGTAGG + Intronic
1138030576 16:53556473-53556495 AAACTCTACAAAATGAGATGGGG + Intergenic
1138950142 16:61902783-61902805 AAAATATTCAAAAGTAAAGTAGG - Intronic
1139060219 16:63241324-63241346 AAAATTTAAAAAAGTTGGGGGGG + Intergenic
1140709954 16:77668170-77668192 AAAAAATAAAAAATTAGAGGCGG - Intergenic
1141271077 16:82541732-82541754 AAACTCCACAAACGTGGAGGAGG - Intergenic
1141517593 16:84556419-84556441 AAAGTCTGCAAAAAGAGAGGAGG + Intergenic
1142764976 17:2059585-2059607 GAAATATACAAACGAAGAGGAGG - Exonic
1143353773 17:6309199-6309221 AATTTCTACAACAGGAGAGGAGG - Intergenic
1143364154 17:6394862-6394884 AAACGCTACAAGAGCAGAGGGGG + Intronic
1143945246 17:10586032-10586054 AAAGTCTTAAAAAGTAGGGGTGG - Intergenic
1144192120 17:12856154-12856176 AAAATCTACAGGAATACAGGTGG - Intronic
1144478996 17:15613491-15613513 AAAGGCCACAAATGTAGAGGAGG + Intronic
1144919308 17:18750239-18750261 AAAGGCCACAAATGTAGAGGAGG - Intronic
1144943115 17:18954898-18954920 AAATAATACAAAAGTAGAGACGG - Intronic
1145899409 17:28480459-28480481 GAAATCTCAAAAGGTAGAGGTGG - Intronic
1147217707 17:38910640-38910662 AAAATCTACAAAATCAGGGCTGG - Intronic
1149398049 17:56264954-56264976 AAAATGTGAAAAAGTAGATGAGG - Intronic
1155478194 18:26256458-26256480 AAAATCAACAAAACTGGAGTAGG - Intronic
1155535524 18:26812418-26812440 AAAATGGACAAAAGTAGTAGAGG + Intergenic
1156604215 18:38646580-38646602 AAAATAGAAAAAAGTATAGGTGG + Intergenic
1156963826 18:43065817-43065839 AAAATTTAGAAAGGTAGAAGTGG + Intronic
1157053190 18:44194635-44194657 AAAATAAAAAAAAGAAGAGGAGG - Intergenic
1157183145 18:45515608-45515630 AGGATCTAGAAAAGAAGAGGAGG + Intronic
1158844655 18:61428932-61428954 AAAATAAAGAAAAGAAGAGGAGG - Intronic
1158869353 18:61669563-61669585 ATGATCTCCAAAAGTAGAGAAGG - Intergenic
1158922505 18:62208988-62209010 AAGATCTTGAAAAGTGGAGGAGG - Intronic
1159541537 18:69783437-69783459 AAAATCCAAAAAGGAAGAGGTGG - Intronic
1159759145 18:72403079-72403101 AACACCTACAAACGTAGAAGTGG - Intergenic
1160770860 19:830447-830469 AAAATTTAAAAAAGTAGAGACGG + Intronic
1161565694 19:5000782-5000804 AAAATCAGCAAGAGTTGAGGAGG - Intronic
1161745056 19:6052391-6052413 AAAATTAACAAAACTAAAGGAGG + Intronic
1161908856 19:7177686-7177708 AAAAAATACAAAATTAGATGGGG - Intronic
1162615945 19:11800221-11800243 AAAGTCTACTCAAGAAGAGGGGG + Intronic
1162685529 19:12380299-12380321 AAAATCTATAAATGTAAATGTGG - Exonic
1163082826 19:14956030-14956052 TAAAACTACAAAAGAAGAAGAGG + Intronic
1163657739 19:18557475-18557497 AAAATCAGCAAAAGTGGAGCAGG + Intergenic
1164795214 19:31021102-31021124 AAAATATAGAAAAGTAGAGGGGG + Intergenic
1165103220 19:33451953-33451975 CAAATATACAAAAATAGGGGAGG + Intronic
1165106466 19:33472539-33472561 AAAATCACAAAAAGTAGATGAGG + Intronic
1165670115 19:37670865-37670887 AAAATTGACAAAAGTAAAGCAGG + Intronic
1165893801 19:39129969-39129991 ATAATCTACAAGGGTAGAGCTGG - Intronic
925727414 2:6887031-6887053 AAAACCTTCAAAAGCTGAGGAGG + Exonic
925894173 2:8458525-8458547 ACAACCTACAAAACCAGAGGTGG - Intergenic
926021369 2:9498429-9498451 AAAGTCAACACAAATAGAGGAGG + Intronic
927449207 2:23192199-23192221 AAATTGTAAAAAAGTAAAGGTGG + Intergenic
927541786 2:23918707-23918729 AAAATCTGAAAAAGTGAAGGTGG - Intronic
927643881 2:24862835-24862857 AAGATATAGAAAAGTAGAAGAGG - Intronic
928133501 2:28670652-28670674 AAAATTCCCAAAAGTAGATGAGG + Intergenic
928855556 2:35798967-35798989 AAAATCTAGAAAAATAGACAAGG + Intergenic
928893674 2:36236447-36236469 AAAATCTATAAAATGTGAGGAGG + Intergenic
929812000 2:45197905-45197927 AAACTCTTAAAAATTAGAGGAGG + Intergenic
930370950 2:50500520-50500542 AATATCTACAGTAGTAGAAGTGG - Intronic
931066613 2:58594830-58594852 AAAAACTTCAAAACTGGAGGAGG + Intergenic
931190610 2:59996636-59996658 AAATTCCTCAAAAGTACAGGCGG + Intergenic
931410205 2:62022698-62022720 CATTTCTACTAAAGTAGAGGGGG - Intronic
933543809 2:83683706-83683728 AAAATCTAAAAAAGTAAAATTGG - Intergenic
934485606 2:94706951-94706973 AAAACATAAAAAAGCAGAGGTGG - Intergenic
935563563 2:104583778-104583800 CAAATATATAAAAGTAGAGTTGG + Intergenic
935901462 2:107798047-107798069 AAAAACTACAAAACTAAAAGTGG + Intergenic
935917104 2:107966928-107966950 AAAATCAACAAAATTAGAGCTGG + Intergenic
937498862 2:122455543-122455565 AAGAGCTACCAAAGTAGAGCTGG + Intergenic
939778990 2:146421412-146421434 AAAATTAACAAAAGTAAAGCAGG + Intergenic
940166505 2:150779640-150779662 AAAATCTTCCATAGCAGAGGAGG + Intergenic
940293969 2:152103309-152103331 AAAATGGACAAAAGTAGCAGGGG + Intergenic
940643050 2:156367262-156367284 AAAATATAGAAAATTAGAAGCGG + Intergenic
940851000 2:158688219-158688241 ACAACCTACATGAGTAGAGGTGG - Intergenic
941215968 2:162709610-162709632 AAATTTTACAAAAGAAGAGAGGG - Intronic
943764823 2:191649185-191649207 AAAAAAAAAAAAAGTAGAGGTGG + Intergenic
944449427 2:199825874-199825896 CAAATCTACAATGGTTGAGGAGG + Intronic
944671411 2:201997367-201997389 AAATTCTACCAAATTTGAGGGGG - Intergenic
944747160 2:202669513-202669535 AAAATCTAGAAAATTTGAGGAGG - Intronic
945712749 2:213319971-213319993 AAAATCTAAAAAATTAGACAAGG + Intronic
946058124 2:216918880-216918902 AAAATCTCCAAAAGTAGGCCGGG + Intergenic
946150789 2:217767311-217767333 AATAACTTCAAAAGTAGAGGAGG + Intergenic
948049983 2:234972883-234972905 ACAATCTGCAAAGGTAAAGGTGG - Intronic
948175967 2:235943301-235943323 AAAATCTACAAAAGGAAGTGAGG - Intronic
1168777521 20:460835-460857 AAAATCAAGGAAACTAGAGGGGG + Intronic
1169434632 20:5574920-5574942 TAAACTTACAAAAGTAGAAGGGG + Intronic
1169685896 20:8271261-8271283 AAAATCAACAAAAGAAGATGAGG - Intronic
1170621488 20:18000055-18000077 AAAATAAAAAAAAATAGAGGTGG - Intronic
1170789260 20:19494348-19494370 CAGATCTACAAAATTAGTGGAGG + Intronic
1173171708 20:40730809-40730831 AACATATACAAAAATAGAGAAGG - Intergenic
1174527797 20:51187734-51187756 AAAACCCACAAAAGGAGATGGGG - Intergenic
1174804222 20:53593009-53593031 AAAATCTTTAAAATTAGAGGAGG + Intronic
1176409892 21:6443404-6443426 AAAATATTAAAAAGTAGACGAGG + Intergenic
1176721140 21:10393946-10393968 ACAGTCTCAAAAAGTAGAGGTGG - Intergenic
1176994131 21:15534424-15534446 AAAATTTAGAAACTTAGAGGAGG + Intergenic
1177588664 21:23132742-23132764 AAAGTCAACAAAAGAAGAGTTGG - Intergenic
1177915268 21:27081208-27081230 TAAATCCAGAAAGGTAGAGGAGG + Intergenic
1178043424 21:28667665-28667687 AAAAGTTACAAAAGTAAAAGAGG + Intergenic
1178205384 21:30458119-30458141 AAAAAATACAAAAATAGACGGGG - Intergenic
1179685385 21:43051726-43051748 AAAATATTAAAAAGTAGACGAGG + Intergenic
1180128843 21:45811912-45811934 AAAAGCTATAAAAGAAGAGAGGG - Intronic
1180244048 21:46534491-46534513 AGAATCTTCAAAAGAAGAAGTGG - Intronic
1180281282 22:10698998-10699020 AAAATCCACAAAAGTCGCGGCGG - Intergenic
1180302329 22:11046736-11046758 ACAGTCTCAAAAAGTAGAGGTGG - Intergenic
1180560149 22:16609438-16609460 AAAATCTTTAAAATTAGAGGAGG + Intergenic
1181667730 22:24410021-24410043 AAAATTTTAAAAAGTTGAGGTGG + Intronic
1183535246 22:38397686-38397708 AAAATCTTTAAAATTAGAGGAGG + Intronic
1203238366 22_KI270732v1_random:30460-30482 AAAATCCACAAAAGTCGCGGCGG - Intergenic
949490352 3:4583291-4583313 AAACTCTACAAATGTAGACTTGG + Intronic
951343741 3:21521037-21521059 AAATTCTACAAAACTATAGAGGG - Intronic
951526986 3:23662908-23662930 AAAAGCCATAAATGTAGAGGAGG - Intergenic
951758925 3:26123692-26123714 AAAATCAACAAAAGTAGTCGAGG + Intergenic
952222283 3:31336077-31336099 ACTATTTTCAAAAGTAGAGGAGG + Intergenic
952367996 3:32691895-32691917 AAAATGTAAAAAATTAGTGGTGG + Intronic
952389452 3:32867179-32867201 AAGATCTAAAAAAGAGGAGGGGG - Intronic
953249867 3:41235345-41235367 AAGATATACAAAAATAGAGGGGG + Intronic
953677629 3:45015688-45015710 AAAATCTACCACCTTAGAGGGGG - Intronic
953849054 3:46451267-46451289 AAAATCAGAAAAAGTATAGGAGG + Intronic
954981109 3:54746137-54746159 AAATTCTACAAGAGTAGAGATGG - Intronic
955103520 3:55874710-55874732 AGAAGCTACAGAAGTAGGGGTGG + Intronic
956366801 3:68512902-68512924 AAAATGTACAAAGGTGGAGATGG - Intronic
956545838 3:70400958-70400980 AAAGAATACAAAAGTAGAGGTGG + Intergenic
957007276 3:74964550-74964572 AAAAACCACAAAAATAGAAGAGG - Intergenic
957447571 3:80334283-80334305 AAAAACTACAAAATTAGAAATGG - Intergenic
957513911 3:81225980-81226002 TAAATCACCAAAAGTAGAAGAGG - Intergenic
957799394 3:85055667-85055689 AAAATCTACAAAAGTTAATAGGG - Intronic
958150973 3:89694745-89694767 AAATTATGCAAAAGTATAGGTGG + Intergenic
958893756 3:99807984-99808006 AACATCCACTGAAGTAGAGGAGG - Intergenic
961208153 3:125103791-125103813 AAAAACTAAAAAATTAGTGGGGG - Intronic
961419763 3:126792845-126792867 CAAATCTACAAAAATAGTTGAGG - Intronic
961900853 3:130210030-130210052 AAAATAAACAAAAATAGAGCTGG - Intergenic
962216461 3:133526576-133526598 TAAAAATACAAAATTAGAGGGGG - Intergenic
962573735 3:136736797-136736819 AAAACCTACAATTGTAGAGGAGG - Intronic
962696810 3:137957229-137957251 AATATACACAAAAGTAGAGAAGG + Intergenic
962726917 3:138238022-138238044 AAAATCTTCAAAAGTTGTGATGG + Intronic
962799474 3:138878030-138878052 AAAATATAAAAAATTAGTGGCGG - Intergenic
963086970 3:141445992-141446014 AAAATCTTCAAAAATATAGTTGG + Exonic
963743742 3:149105458-149105480 AAAAATTACAAACCTAGAGGAGG + Intergenic
964146050 3:153464891-153464913 AAAATCCAAAGAAGTAGAAGTGG + Intergenic
965164313 3:165175791-165175813 AATATCTCCACAAGTAGAGCTGG + Intergenic
965870909 3:173264243-173264265 AAAGACCACAGAAGTAGAGGTGG + Intergenic
969104572 4:4795782-4795804 CTAATCAACAACAGTAGAGGAGG + Intergenic
969980562 4:11149947-11149969 AAAAAATACAAAAACAGAGGAGG + Intergenic
970612213 4:17736445-17736467 AAACTCTCCAAAAGTACAGAGGG + Intronic
970703229 4:18768250-18768272 AAAATATACAAAAACAGAAGTGG - Intergenic
971855729 4:32041021-32041043 AAAATTTATAAATGTAGATGTGG + Intergenic
971957400 4:33439728-33439750 ACAATGGACAAAATTAGAGGCGG + Intergenic
972463298 4:39327115-39327137 AATATCTGCCAAAGTAGAGAAGG + Intronic
972798091 4:42442873-42442895 AAAATGTATAAAAGTAAATGTGG - Intronic
975189784 4:71446787-71446809 AAAATCTACAAAAGGTGACGTGG - Intronic
975603069 4:76123866-76123888 AAAATATACAAAATTAGTAGTGG - Intronic
977021160 4:91761725-91761747 ATAATCTCCAATATTAGAGGTGG - Intergenic
977125147 4:93155953-93155975 AAAATCTAAAAGAGTAGAATTGG + Intronic
977269096 4:94892818-94892840 AAAATATACAAAACTTGAGTTGG - Intronic
977697765 4:99985869-99985891 ATAAACTAAAAAAGTTGAGGAGG + Intergenic
978612632 4:110560563-110560585 AAAAGCTGCAAAAGTTGAGGTGG + Intronic
978888418 4:113794076-113794098 AAAATCAACAAAACAAAAGGTGG + Intergenic
979767495 4:124479996-124480018 AAAAAAAAAAAAAGTAGAGGTGG - Intergenic
980216943 4:129864509-129864531 TAAATATAAAAAAGTAAAGGAGG - Intergenic
981336276 4:143572236-143572258 AAAATGTACAAAATTAATGGGGG + Intergenic
982053106 4:151523179-151523201 AAAATCAACTTAAGAAGAGGTGG + Intronic
982594151 4:157356471-157356493 AAATTTTACCAAAGTAGAAGAGG - Intronic
982611556 4:157580615-157580637 GAAATATAGAAAAGTTGAGGAGG + Intergenic
982628454 4:157799715-157799737 AAAATCAATAAAAGTAAAGAAGG - Intergenic
983924358 4:173382251-173382273 AAAATCTCCAAAAATAGAAGAGG - Intergenic
984082890 4:175271065-175271087 AAAATATACTGAAATAGAGGAGG + Intergenic
985818387 5:2143687-2143709 TGAATCTAAAAATGTAGAGGTGG - Intergenic
986486267 5:8241599-8241621 AAAATTAACAGAAGTAGAAGTGG + Intergenic
986993108 5:13576896-13576918 ATGATTTACAAAAGAAGAGGAGG + Intergenic
987604783 5:20119106-20119128 AAAATCTACAAAAGTAGAGGTGG - Intronic
987912754 5:24170141-24170163 AAGATGTACAAAACTCGAGGGGG + Intronic
988112637 5:26842787-26842809 AAAATCTTTAAAGGAAGAGGAGG - Intergenic
988351528 5:30114482-30114504 AAAATGTATAAAAGTAGAGCTGG + Intergenic
989479240 5:41910157-41910179 AGCATCTGCAAAAGTAAAGGGGG - Intronic
989625935 5:43429507-43429529 TAAAACTACAAAAATACAGGTGG - Intergenic
989762946 5:45041707-45041729 AAACTCTTTAAAAGTAGAGGGGG + Intergenic
990714791 5:58624609-58624631 ATTTTCGACAAAAGTAGAGGTGG - Intronic
990898416 5:60724645-60724667 AAAGTCTTCTAAAGTAGTGGGGG + Intergenic
991321560 5:65379227-65379249 AAACTCTACAAAAGTGAAGAGGG - Intronic
991521833 5:67507747-67507769 AAAATTTACATAAGTAATGGTGG + Intergenic
992258409 5:74945605-74945627 AAATTCAACAAAAGAGGAGGAGG + Intergenic
992941157 5:81763402-81763424 AAAATTAATAAAAGTAGAGAAGG + Intergenic
993603279 5:89955337-89955359 AAAATATTCAAAAGTAGAATAGG + Intergenic
993915452 5:93739617-93739639 AAAATTGACCAAAGTAGAAGTGG + Intronic
993953631 5:94205449-94205471 AAAATATAAAAAAGTGGTGGTGG - Intronic
993974111 5:94455895-94455917 AAAAGGTATAAAAGGAGAGGTGG + Intronic
994534698 5:101014091-101014113 AAAATATACAAAAATACAAGTGG + Intergenic
995100033 5:108289488-108289510 AGAATGAATAAAAGTAGAGGAGG - Intronic
995240083 5:109875732-109875754 AAATTCTGCAAAAGTAGCTGTGG + Intergenic
995487641 5:112655417-112655439 AAAACCCACAAAAGTTGAAGAGG + Intergenic
995861072 5:116641212-116641234 GAAAACTACAAAAATAGTGGAGG + Intergenic
995878446 5:116817185-116817207 AAAATATACAAAAGTTGGTGAGG - Intergenic
995929027 5:117413095-117413117 AAAATGTTAAAATGTAGAGGAGG - Intergenic
996036909 5:118768571-118768593 AAAATGTACCAAATAAGAGGGGG - Intergenic
996641174 5:125755829-125755851 AAAATCAGTAAAAGTAGAGAAGG + Intergenic
997428455 5:133820499-133820521 AAAATATACATAAGTGGAGTAGG - Intergenic
999020582 5:148161561-148161583 AAAATAAAAAAAAGTAGGGGAGG + Intergenic
999566549 5:152868901-152868923 AAAAACTACAAAATTAGCTGGGG + Intergenic
1000452418 5:161406389-161406411 AAAATCTACGAAGGTTGAGAAGG + Intronic
1000842423 5:166237407-166237429 AAAATCTATAAAACTAAAAGTGG + Intergenic
1000941345 5:167364828-167364850 AAAATTAACAAAAATAAAGGAGG + Intronic
1003635732 6:7829787-7829809 AACATCTACATATGAAGAGGCGG - Intronic
1005295934 6:24427451-24427473 CAACTCTACAAAAGTATTGGAGG + Intronic
1005647747 6:27857277-27857299 AAAAACTACAAAATAAGAAGAGG + Intronic
1006208384 6:32371099-32371121 AAAATCTCCAAAAGTTGATTTGG - Intronic
1006323435 6:33334892-33334914 ATAATTTAAAAAAGAAGAGGCGG - Intergenic
1006539158 6:34725462-34725484 AAAATTTAAAAAATTAGATGTGG - Intergenic
1006578349 6:35061987-35062009 AAAATCAGCAGAAGGAGAGGTGG - Intronic
1007924764 6:45642194-45642216 AAATTCTACAAAAGTACGGGGGG - Intronic
1008188916 6:48430450-48430472 TAAATCAACAAAAGTAGACCTGG - Intergenic
1008460158 6:51759567-51759589 AAGAAGTAAAAAAGTAGAGGAGG + Intronic
1008553181 6:52652840-52652862 GATATCAAGAAAAGTAGAGGTGG + Intergenic
1010975602 6:82310327-82310349 AAAATTTAAAAAGGGAGAGGGGG - Intergenic
1011241173 6:85272830-85272852 ACAATCTACAAGAGATGAGGTGG + Intergenic
1012025720 6:93987699-93987721 AAAATAAACAATAGTAGAGGAGG + Intergenic
1012359545 6:98360264-98360286 AAATTCTACAAAAGTGGCAGTGG - Intergenic
1012709898 6:102585572-102585594 AAATTCTCCAGAAATAGAGGAGG - Intergenic
1013705160 6:112824572-112824594 AAATCCCAAAAAAGTAGAGGTGG + Intergenic
1014308907 6:119774188-119774210 AAAATCTAGAAAAGAAGATATGG - Intergenic
1014464081 6:121733811-121733833 AAAATCTCCAAGAGAAGATGTGG + Intergenic
1015348539 6:132189241-132189263 AAAATGTACAAAAATAAAGAAGG + Intergenic
1016427497 6:143950027-143950049 AACATCTACAACAGAAGATGAGG - Intronic
1016562603 6:145413935-145413957 ACAATCTAGAGAAGGAGAGGGGG - Intergenic
1016703449 6:147079457-147079479 AAAATTTTCAAAAGTAGGGCCGG - Intergenic
1017218394 6:151936881-151936903 AAAAACTACAAGAACAGAGGAGG + Intronic
1017438913 6:154444020-154444042 TAAATCTGCAACATTAGAGGTGG + Intronic
1020725127 7:11803015-11803037 TAAATCTAGAAAAGGAGAGGTGG + Intronic
1021592451 7:22278490-22278512 AAAATGAACAAAAGTAGATGAGG + Intronic
1022770553 7:33467573-33467595 AACAACTACAATAGTGGAGGTGG - Intronic
1022944877 7:35272522-35272544 AAAATGTACTAAAGAAGAAGTGG + Intergenic
1023778111 7:43629714-43629736 CTAATCTGAAAAAGTAGAGGAGG - Intronic
1024436857 7:49366670-49366692 AATATCTAGAAAAGTTGAAGTGG - Intergenic
1024769995 7:52711419-52711441 AAAATCTTGAAAACCAGAGGAGG - Intergenic
1025592528 7:62880274-62880296 AGAATCTACAAAAATATAGCAGG + Intergenic
1026007617 7:66612419-66612441 TAAATATACAAAATTAGACGGGG - Intergenic
1026547830 7:71339525-71339547 AAAATATACAAAAAAAGAAGCGG + Intronic
1027572470 7:79887473-79887495 AAAATCTTAAAAAATAAAGGTGG - Intergenic
1028318950 7:89436989-89437011 AAGATCTGCAAAAGCAGAGGGGG - Intergenic
1028416372 7:90584734-90584756 AAGATTTACAAAACTAGAGGTGG - Intronic
1028605262 7:92648438-92648460 AAAATCAACAAAAGTAAACTTGG + Intronic
1028747135 7:94339936-94339958 AAAGACTACAAAAATAGAAGGGG + Intergenic
1031331104 7:120465692-120465714 AAAATCTTCAGAAGTAGAGCTGG + Intronic
1031997560 7:128242639-128242661 AAAATGTACAAAATATGAGGAGG - Intronic
1033105148 7:138513956-138513978 AAAAACTACAGAATCAGAGGAGG + Intronic
1033834915 7:145298628-145298650 AAAATATGCAAAAGTGGATGAGG - Intergenic
1033878068 7:145847023-145847045 AAAAAGTAAAAAAGTAGAGCAGG + Intergenic
1035004814 7:155648208-155648230 GAAATATACAAAAGTGGAGGTGG - Intronic
1036624385 8:10454929-10454951 AAAATATACAAAAGAAAAAGAGG - Intergenic
1039757318 8:40537553-40537575 AAATTCTATATAAGCAGAGGAGG - Intronic
1040126076 8:43739527-43739549 AGAATCTACAAATGTAGGGGTGG + Intergenic
1040275091 8:46008371-46008393 AAAATCTGCAAAGGTAGAGTTGG + Intergenic
1041531577 8:58874208-58874230 AAAATCTACCAAAGGGCAGGGGG - Intronic
1043008112 8:74845912-74845934 AAAATCTAAAAAATAAGAGAAGG - Intronic
1043072258 8:75653280-75653302 AGAAACAACAAAAGTAGAGCTGG + Intergenic
1044933533 8:97272697-97272719 AAAATGGACAAAATTAGAAGTGG - Intergenic
1045258669 8:100551782-100551804 AAACTCAACAAAAAGAGAGGTGG - Intronic
1045735620 8:105293276-105293298 AAAATGTAAAAAAGAAGAGTGGG + Intronic
1046654547 8:116878803-116878825 AAAATCTACAAATGGGAAGGCGG - Intergenic
1046719180 8:117599716-117599738 ATAATGTACAAGAGTAGAGGAGG + Intergenic
1047432613 8:124805756-124805778 AAAGTTTCCAAAAGTAGAAGAGG + Intergenic
1047915819 8:129582768-129582790 GAAATCAAGAAAAGTAGAGCAGG + Intergenic
1048076827 8:131080539-131080561 AAAATCTCCAATAGTAGATCTGG - Intergenic
1048521539 8:135159961-135159983 CAAAACTTCAAAAGTAGAGAAGG - Intergenic
1048566609 8:135606316-135606338 AAAATCTTCAAAAGAAAAGTGGG - Intronic
1048761935 8:137804894-137804916 AAAATCTACTGAAGGAAAGGAGG + Intergenic
1050752067 9:8950856-8950878 AAAATCTGAACAAGTAGAGTAGG - Intronic
1051271390 9:15358672-15358694 AAAATTTAGACAAGAAGAGGTGG - Intergenic
1051392736 9:16583165-16583187 AAAATCTTTAAAAATAGAAGTGG - Intronic
1051520767 9:17984872-17984894 TAAAATTACAAAGGTAGAGGGGG - Intergenic
1051672755 9:19528696-19528718 AGAATCTATAAAAGTTGTGGTGG - Intronic
1052273129 9:26648331-26648353 AAATTGTAATAAAGTAGAGGAGG + Intergenic
1053227794 9:36376219-36376241 AAAATCTAAAAATGTAAAGCGGG + Intronic
1054480842 9:65662516-65662538 AAAAGCTACAAAAATAGTAGAGG - Intergenic
1055897292 9:81192950-81192972 AATATCTACAGTAGTAAAGGTGG + Intergenic
1056592115 9:87972217-87972239 AAAATCAACAGAACTAGAAGAGG + Intronic
1057738493 9:97690204-97690226 AAAAACAAAAAAAGTAGAAGAGG - Intronic
1058219346 9:102277711-102277733 AAAAAGTTAAAAAGTAGAGGTGG + Intergenic
1058820675 9:108726707-108726729 AAAATTTACAGAACTAAAGGGGG + Intergenic
1059460048 9:114423903-114423925 AAACTGTACAAAGGAAGAGGTGG - Intronic
1061624954 9:131836089-131836111 AAAAAAAAAAAAAGTAGAGGAGG - Intergenic
1185539825 X:894118-894140 ACAGTCTGAAAAAGTAGAGGTGG + Intergenic
1186569844 X:10703285-10703307 AAAATCCACACAAGTAAATGTGG + Intronic
1187562879 X:20418976-20418998 AAAATCTAGAAACTTAGAGGAGG + Intergenic
1187743052 X:22377004-22377026 AAAATTTAGATAATTAGAGGAGG - Intergenic
1188443808 X:30236133-30236155 AACATCTACAGATGTAGTGGTGG - Exonic
1188543452 X:31275576-31275598 AAGATATTCAAAAGTACAGGTGG - Intronic
1188543999 X:31282194-31282216 AAAATCTGCAAAAATATAGAAGG - Intronic
1188703265 X:33292572-33292594 AAAATCTACAAAAAAATAGTAGG + Intronic
1189102685 X:38207581-38207603 AAAATCTAAGAAAGGAAAGGAGG + Intronic
1189140336 X:38598504-38598526 AAAATCTACAATAATACAAGAGG - Intronic
1189928056 X:45977941-45977963 AACATACACAAAACTAGAGGGGG + Intergenic
1190928878 X:54932012-54932034 AACAACAACAAAAGGAGAGGTGG + Intergenic
1191116202 X:56855919-56855941 AAAATGTTAAAAAGTAGAGGGGG - Intergenic
1192715130 X:73632532-73632554 AAAATCAACAAATGAAAAGGAGG - Intronic
1193100823 X:77609634-77609656 AAAAAATACAAAAGTCGAGGTGG - Intronic
1193298505 X:79860696-79860718 ACAATTTAGAAAATTAGAGGAGG - Intergenic
1193630816 X:83885875-83885897 ATAATGTATAAAATTAGAGGGGG + Intronic
1195442854 X:104918418-104918440 AAAAAACAAAAAAGTAGAGGAGG + Intronic
1195693883 X:107652366-107652388 AAAATAAACAAAAGTAGACCTGG - Intergenic
1195880491 X:109587790-109587812 ACAAGCTACAAACGTGGAGGAGG + Intergenic
1195909318 X:109873833-109873855 AAAAACAAAAAAAGTAGAGAAGG - Intergenic
1197062486 X:122197724-122197746 AAACTCTTGAAAAGTAGAAGAGG + Intergenic
1197078298 X:122379081-122379103 ATAATCTACATATGTAGGGGAGG - Intergenic
1197110131 X:122763165-122763187 AAAATCCTCAAAAGTAGGGAAGG + Intergenic
1197240232 X:124115666-124115688 AAAATCAACAAAAATGGGGGAGG - Intronic
1198143374 X:133828853-133828875 AAAAAGTACATAAGTAGATGAGG + Intronic
1199260744 X:145771511-145771533 AGAATTTACAAATGTAGAAGCGG - Intergenic
1201953137 Y:19587087-19587109 AAAATGTACAAAAGCATAGAGGG + Intergenic
1202163039 Y:21955368-21955390 TGAATCTCCAAAAGTAAAGGAGG - Intergenic
1202228317 Y:22631000-22631022 TGAATCTCCAAAAGTAAAGGAGG + Intergenic
1202314840 Y:23565176-23565198 TGAATCTCCAAAAGTAAAGGAGG - Intergenic
1202555961 Y:26105417-26105439 TGAATCTCCAAAAGTAAAGGAGG + Intergenic