ID: 987605333

View in Genome Browser
Species Human (GRCh38)
Location 5:20127231-20127253
Sequence GTAAACACCATGTCCTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987605333_987605340 18 Left 987605333 5:20127231-20127253 CCATGTGAGGACATGGTGTTTAC 0: 1
1: 0
2: 3
3: 36
4: 273
Right 987605340 5:20127272-20127294 CACTGATTGTAAGTTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987605333 Original CRISPR GTAAACACCATGTCCTCACA TGG (reversed) Intronic
903322398 1:22550987-22551009 GGAAGCACCCTGTCCCCACAGGG + Intergenic
903552876 1:24170088-24170110 GCAAACACTGTGTCCTCACGTGG - Intronic
905953366 1:41971907-41971929 AGGAACACCGTGTCCTCACATGG - Intronic
906096462 1:43227523-43227545 CCAAACACCATGGCCTCACCTGG - Intronic
907813388 1:57894513-57894535 GTAAACACCTTGGCCTTAAAAGG + Intronic
908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG + Intergenic
908502424 1:64757470-64757492 GTTATCACTATGTCCTCACATGG - Intronic
908714681 1:67056426-67056448 AAGAACACCATGTCCTCACATGG + Intergenic
910107925 1:83651588-83651610 ATGAACACTGTGTCCTCACATGG - Intergenic
911108283 1:94155509-94155531 GTGAATGCTATGTCCTCACATGG - Intronic
911724148 1:101224003-101224025 GAGAACACTGTGTCCTCACATGG - Intergenic
912093295 1:106108521-106108543 AAAAACACTGTGTCCTCACATGG - Intergenic
912788348 1:112626013-112626035 CTGAACAGCATGTCCACACAGGG + Intronic
913997030 1:143660107-143660129 GTAAACACCACGTGCTGTCAAGG + Intergenic
915647511 1:157284292-157284314 AGGAACACCGTGTCCTCACATGG + Intergenic
915647522 1:157284353-157284375 GGGAACACTGTGTCCTCACATGG + Intergenic
915647546 1:157284505-157284527 GGGAACACCATGTCCTCATATGG + Intergenic
915647553 1:157284536-157284558 GGTAAGACTATGTCCTCACATGG + Intergenic
915663083 1:157419862-157419884 GGGAACACCATGTCCTCAGATGG - Intergenic
915663112 1:157420044-157420066 AAAAACACCTTGTCCTCACATGG - Intergenic
915663123 1:157420105-157420127 AGAAACACCATGTCCTCACCTGG - Intergenic
915663127 1:157420135-157420157 AGGAACACCATGTCCTCATATGG - Intergenic
915663133 1:157420166-157420188 GGCGATACCATGTCCTCACATGG - Intergenic
915663148 1:157420257-157420279 GGCAACACTGTGTCCTCACATGG - Intergenic
915832025 1:159140173-159140195 GTCCACACCATGTCCTCCAAAGG + Intronic
915887691 1:159740793-159740815 CCAAACACGGTGTCCTCACATGG + Intergenic
916970815 1:170013074-170013096 CTTCTCACCATGTCCTCACATGG - Intronic
917594637 1:176516623-176516645 AAAAACACTATGTCCTCATATGG - Intronic
918387759 1:184027559-184027581 GTAAGGACCATGTCCACTCATGG + Intronic
918471397 1:184878967-184878989 GTAAAAACCACATACTCACAAGG + Intronic
919159123 1:193805766-193805788 ATGAACACTGTGTCCTCACATGG + Intergenic
919504975 1:198387271-198387293 GTAAACACCAGCTTCTCCCAGGG - Intergenic
919565466 1:199179912-199179934 GCAGATCCCATGTCCTCACATGG - Intergenic
919598337 1:199591825-199591847 CTTCTCACCATGTCCTCACAAGG - Intergenic
921312129 1:213855009-213855031 TTTCACACCATGTCCTCACATGG + Intergenic
921546934 1:216484297-216484319 GAAAATTCCATGTCCTCACTAGG + Intergenic
922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG + Intergenic
922038256 1:221870960-221870982 GCAAACATCAAGTCGTCACAGGG - Intergenic
922315788 1:224440552-224440574 GTAATCACCATGTACTGATATGG + Intronic
922727541 1:227929854-227929876 CTTCTCACCATGTCCTCACATGG - Intronic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
923707812 1:236359415-236359437 TTAAACACTATGTCCTCACATGG - Intronic
1063361758 10:5465152-5465174 GTGGACACTTTGTCCTCACATGG - Intergenic
1064144196 10:12814594-12814616 CTTCTCACCATGTCCTCACATGG + Intronic
1065228827 10:23575569-23575591 AAAAACACTGTGTCCTCACATGG - Intergenic
1065335264 10:24651011-24651033 GAAAACACCATGTTTTCACTTGG + Intronic
1065993828 10:31037676-31037698 AGAAACACTGTGTCCTCACATGG - Intergenic
1069069629 10:63979892-63979914 GTAAACACTGTGTCCTCAGGTGG + Intergenic
1071103668 10:82068981-82069003 GTTAACAGCATGTCCACAGAAGG + Intronic
1071398889 10:85250135-85250157 GTGAACACAGCGTCCTCACATGG + Intergenic
1072422411 10:95300184-95300206 AGAAACACTATGTCCTTACATGG + Intergenic
1073476889 10:103759665-103759687 GTAATGACCATTTCCTCTCAGGG + Intronic
1073529918 10:104221481-104221503 ATTTCCACCATGTCCTCACATGG - Intronic
1073629718 10:105136269-105136291 TTGAACACTGTGTCCTCACATGG + Intronic
1074890386 10:117731045-117731067 GTAATCACCAAGTCGTTACATGG - Intergenic
1075350957 10:121724974-121724996 TTGAACACTGTGTCCTCACATGG + Intergenic
1076236260 10:128865525-128865547 ATATACTCCATGTCCACACATGG + Intergenic
1077931112 11:6734052-6734074 AGGAACAACATGTCCTCACATGG - Intergenic
1077932333 11:6746636-6746658 GGGACCACCATGTCCTTACATGG + Intergenic
1078843652 11:15102255-15102277 ACAAACACTGTGTCCTCACATGG + Intergenic
1081196877 11:40172069-40172091 AGAAACATTATGTCCTCACATGG - Intronic
1081314788 11:41618870-41618892 ATGAACACTGTGTCCTCACATGG - Intergenic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1081427055 11:42937027-42937049 TTGAACACTATCTCCTCACAAGG + Intergenic
1082941354 11:58708626-58708648 ATGAACACTGTGTCCTCACATGG - Intronic
1083482928 11:62961238-62961260 CTTCCCACCATGTCCTCACATGG - Intronic
1085753863 11:79187793-79187815 CTTCCCACCATGTCCTCACATGG - Intronic
1088338550 11:108736674-108736696 GGAAAAACTGTGTCCTCACATGG - Intronic
1090505058 11:127302238-127302260 GTAAATATAATGTCCTCAAAAGG + Intergenic
1093269494 12:17041783-17041805 AGAAACACTGTGTCCTCACATGG - Intergenic
1094775023 12:33716488-33716510 GTAAAAACTATATCCACACAGGG - Intergenic
1095620113 12:44242911-44242933 GTAAACAACACGTGCTCACGAGG - Intronic
1096159313 12:49364114-49364136 GTAAACATGACCTCCTCACAAGG - Intergenic
1096210369 12:49760742-49760764 TTCGACACCATGTCCTCACGGGG - Intronic
1096335191 12:50749886-50749908 ACGAACACCATGTCCTCGCATGG - Intergenic
1099709324 12:86200921-86200943 CTTCTCACCATGTCCTCACATGG - Intronic
1101540488 12:105660536-105660558 GTGAACTCTGTGTCCTCACATGG + Intergenic
1101919918 12:108924112-108924134 GCAAACACTGTGTCCTCAGATGG - Intronic
1102437390 12:112935964-112935986 AGGAACACTATGTCCTCACATGG + Intergenic
1102550940 12:113691789-113691811 CCTCACACCATGTCCTCACAGGG - Intergenic
1104092020 12:125525457-125525479 CGAAACACCATGTCCTCGCATGG - Intronic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1106690069 13:32105284-32105306 TTGAACACTGTGTCCTCACATGG - Intronic
1106884443 13:34168914-34168936 AAAAATACAATGTCCTCACAAGG + Intergenic
1107948823 13:45443942-45443964 ACAAACACTGTGTCCTCACATGG - Intergenic
1108374182 13:49797949-49797971 ATGAACACTGTGTCCTCACATGG - Intergenic
1108374187 13:49797980-49798002 ATGAACACTGTGTCCTCACATGG - Intergenic
1108533289 13:51347099-51347121 GTGAGCACCATGTCCTTCCAAGG + Exonic
1109249023 13:59995850-59995872 GTAAAAACCAAGACCTCAGATGG + Intronic
1110157036 13:72329913-72329935 ATGAACACTGTGTCCTCACAAGG + Intergenic
1110783115 13:79490027-79490049 GTAATGAGCATGTCCTGACATGG - Intronic
1110823743 13:79947280-79947302 AGAAACACCATGTTCTAACATGG - Intergenic
1111641486 13:90976293-90976315 AGAAACACTATGTTCTCACATGG - Intergenic
1112391987 13:98993573-98993595 GAAAACAACATGTCTTCACTAGG + Intronic
1113578025 13:111408012-111408034 GTCCTCACCATGTCCTCACGTGG + Intergenic
1115373874 14:32651607-32651629 GTGAACTCTGTGTCCTCACATGG + Intronic
1115836935 14:37416761-37416783 GTAAACAGCAAGACCTCTCAGGG + Intronic
1116298929 14:43151322-43151344 ATCAACACTGTGTCCTCACAAGG + Intergenic
1117447032 14:55813917-55813939 ACAAACACTGTGTCCTCACATGG - Intergenic
1118611778 14:67547099-67547121 GTAACCAGAATGTCTTCACATGG + Intronic
1119247118 14:73120253-73120275 TTAAACTCCATGCCTTCACAAGG - Exonic
1119685476 14:76627624-76627646 GTCAGCACTCTGTCCTCACATGG + Intergenic
1119863594 14:77955025-77955047 CTTCTCACCATGTCCTCACACGG + Intergenic
1120535253 14:85687212-85687234 AGGAACACCTTGTCCTCACATGG + Intergenic
1120658892 14:87229810-87229832 GGAAGCAACATGTCCTCACATGG + Intergenic
1120721346 14:87892652-87892674 TTGAACACTGTGTCCTCACATGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122089948 14:99331350-99331372 GGAAACCCCATCTCCTCACCTGG + Intergenic
1123574655 15:21655413-21655435 GTAAACACTAGCTCTTCACATGG + Intergenic
1123611269 15:22097909-22097931 GTAAACACTAGCTCTTCACATGG + Intergenic
1123939533 15:25210151-25210173 GCCAACACCAAGTCCGCACAGGG - Intergenic
1126345569 15:47690114-47690136 CTAAACACCATGTCTGCAGATGG - Intronic
1126597936 15:50400323-50400345 TTGAAAACTATGTCCTCACATGG - Intergenic
1127241594 15:57121564-57121586 ATAAACGCTGTGTCCTCACAGGG - Intronic
1129125957 15:73441625-73441647 GTACAAACCATGTACTCTCAGGG - Intergenic
1129497514 15:75999453-75999475 CCGAACACTATGTCCTCACATGG - Intronic
1131330164 15:91490696-91490718 GACAACACTGTGTCCTCACATGG - Intergenic
1202983519 15_KI270727v1_random:389665-389687 GTAAACACTAGCTCTTCACATGG + Intergenic
1133436528 16:5784793-5784815 CTATGCGCCATGTCCTCACATGG - Intergenic
1137515495 16:49140069-49140091 ATGAACATCATGTTCTCACATGG + Intergenic
1138128068 16:54455088-54455110 GTAAACACCCTGGCTTCACGAGG - Intergenic
1138878156 16:60978436-60978458 GAATATACCTTGTCCTCACAAGG + Intergenic
1143006138 17:3836022-3836044 ATCAACACCTTCTCCTCACAGGG + Intronic
1144133555 17:12271035-12271057 GTAAACCCCAAGTCTTTACATGG + Intergenic
1146508613 17:33426699-33426721 GCATACAGCAGGTCCTCACAAGG - Intronic
1147769827 17:42859812-42859834 GCACACCTCATGTCCTCACAGGG - Intergenic
1149249418 17:54750779-54750801 GTGAATGCTATGTCCTCACATGG - Intergenic
1149478452 17:56982954-56982976 GTCAGCACCATGTCCTCAGTAGG - Intronic
1149937713 17:60825688-60825710 TTGAACTCCATGTCCTCACATGG + Intronic
1150306928 17:64093586-64093608 CTTCTCACCATGTCCTCACATGG + Intronic
1150998555 17:70347555-70347577 ATAAACCCAATGTCCTCACATGG + Intergenic
1151052414 17:70993382-70993404 GAAAACTCCATCTCATCACAAGG + Intergenic
1151127314 17:71859189-71859211 ATAATCACCATTTGCTCACATGG - Intergenic
1153126447 18:1797970-1797992 GTCAACACTATGTGCTCACTTGG + Intergenic
1154250945 18:12744539-12744561 TTAAAAACCATGTCATCTCAAGG - Intergenic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1156757900 18:40550933-40550955 GTAAACACATCGTCTTCACATGG - Intergenic
1157942667 18:51946140-51946162 AGAAACACTGTGTCCTCACATGG - Intergenic
1158403268 18:57139956-57139978 GTAAAGACTATCTCCTAACAAGG - Intergenic
926310967 2:11675986-11676008 CTCCTCACCATGTCCTCACATGG - Intergenic
927092416 2:19722212-19722234 CTTCACACCATGTCCTCGCATGG + Intergenic
927531717 2:23811360-23811382 GGAACAACAATGTCCTCACATGG - Intronic
929385394 2:41400565-41400587 GTAGACACGAATTCCTCACATGG - Intergenic
929965565 2:46532670-46532692 ACAAACACTATGACCTCACATGG - Intronic
932857780 2:75255621-75255643 ACAAATGCCATGTCCTCACATGG - Intergenic
933385022 2:81599270-81599292 ATACACACCATGTACACACAAGG - Intergenic
934735404 2:96687444-96687466 GCAATCACCATGCCCTCTCATGG + Intergenic
935478677 2:103557944-103557966 GAGAACACTGTGTCCTCACATGG + Intergenic
937594499 2:123657626-123657648 ATGAACACCATGTGCTCACATGG + Intergenic
940557097 2:155243099-155243121 GTAAACCCAATGTAATCACAAGG - Intergenic
941554781 2:166963935-166963957 GAACACACCATGTCTTCACCTGG - Intronic
943370877 2:187014180-187014202 ATGAACACTACGTCCTCACATGG - Intergenic
943994110 2:194736947-194736969 GTAAACATTATGTACTCACATGG - Intergenic
944223580 2:197326655-197326677 GGCGATACCATGTCCTCACATGG - Intergenic
946658981 2:221979079-221979101 ACAAATGCCATGTCCTCACATGG - Intergenic
947361793 2:229352861-229352883 AGAAACACTGTGTCCTCACATGG - Intergenic
947814591 2:233027874-233027896 ATGAACACTGTGTCCTCACATGG + Intergenic
947995606 2:234524682-234524704 GAGAACACTGTGTCCTCACATGG - Intergenic
1169877157 20:10310725-10310747 GGAAAAACTGTGTCCTCACATGG + Intergenic
1171318271 20:24215146-24215168 AGAAACAGCATGTCCTCATATGG - Intergenic
1171726251 20:28623877-28623899 GGGAACACTGTGTCCTCACATGG + Intergenic
1172308152 20:33896488-33896510 ACAAACACCTTGTCCTCACATGG - Intergenic
1173395865 20:42678737-42678759 GGGAAAACCATTTCCTCACATGG - Intronic
1174723417 20:52837516-52837538 GTGAACAGACTGTCCTCACAGGG + Intergenic
1175182657 20:57159583-57159605 GTGAGCCCCATGTCATCACAGGG + Intergenic
1176408297 21:6433825-6433847 GTAAACCCCATGGCCCCACATGG + Intergenic
1177103613 21:16926072-16926094 TTAAATACCATGTCCTCACATGG - Intergenic
1177486040 21:21757560-21757582 ACAAACACAGTGTCCTCACATGG + Intergenic
1177504770 21:22006228-22006250 AGAAACACCATATCCTCATATGG + Intergenic
1177812220 21:25936597-25936619 CTACGCATCATGTCCTCACATGG - Intronic
1179683790 21:43042151-43042173 GTAAACCCCATGGCCCCACATGG + Intergenic
1180551343 22:16544284-16544306 GCAAGGACCATGTCCTCACCTGG - Intergenic
1180623701 22:17179759-17179781 GTACACCCCATGTCTCCACAGGG - Exonic
1181975715 22:26727930-26727952 GTGAACTCTGTGTCCTCACATGG + Intergenic
1183614853 22:38937745-38937767 GTGAACACAATGCACTCACATGG - Intergenic
949303277 3:2609318-2609340 TTGAATACCGTGTCCTCACATGG - Intronic
949604382 3:5637254-5637276 AGAAACACTGTGTCCTCACATGG + Intergenic
950342160 3:12257298-12257320 GGAAACAGCACGTCTTCACATGG + Intergenic
953975215 3:47377148-47377170 GGGAACACCTTGTCCCCACATGG - Intergenic
955525946 3:59819926-59819948 ACAAACACTGTGTCCTCACATGG - Intronic
955649244 3:61175706-61175728 AAGTACACCATGTCCTCACATGG - Intronic
958185500 3:90114402-90114424 AAAAACACTGTGTCCTCACAAGG - Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
959403914 3:105937301-105937323 AGGAATACCATGTCCTCACATGG - Intergenic
959891675 3:111563043-111563065 AGAAATGCCATGTCCTCACATGG + Intronic
961098092 3:124174965-124174987 GACAACACAAAGTCCTCACATGG - Intronic
962978729 3:140469039-140469061 CTTCTCACCATGTCCTCACATGG + Intronic
963091807 3:141489330-141489352 GAAAACAGCATCTCTTCACAAGG - Intronic
963847380 3:150172866-150172888 ATGAACACTGTGTCCTCACAGGG - Intergenic
963898402 3:150710475-150710497 ACAAACACTGTGTCCTCACATGG - Intergenic
966288749 3:178329574-178329596 ATAAACACTGTGTCCTCACATGG + Intergenic
966301976 3:178489334-178489356 CTACTCTCCATGTCCTCACATGG + Intronic
967255916 3:187591630-187591652 GTAAAGACCATGCCAACACAAGG - Intergenic
967570592 3:191023659-191023681 ATGAATACCATGTCCTCGCATGG - Intergenic
968589704 4:1451183-1451205 GTCCACACCTGGTCCTCACAAGG - Intergenic
969271047 4:6102470-6102492 TTGAATGCCATGTCCTCACATGG - Intronic
969300932 4:6296478-6296500 GTAAAAACCATGTGCTCCCTTGG - Intronic
969833347 4:9817152-9817174 GTAAACCCAATGTCCTCATAAGG - Intronic
970511299 4:16784437-16784459 GGAAACACCATCTCTTCCCAGGG + Intronic
970918664 4:21367042-21367064 GGAAACGCTGTGTCCTCACATGG - Intronic
972297135 4:37750641-37750663 ACAAACACTGTGTCCTCACATGG - Intergenic
972828699 4:42789317-42789339 GTAAACAACTTGTCACCACATGG - Intergenic
973096869 4:46213259-46213281 CTTCTCACCATGTCCTCACAAGG - Intergenic
973766125 4:54164663-54164685 GCAAACTCTGTGTCCTCACATGG + Intronic
973962653 4:56127146-56127168 AGAAACACCATGTCCTCATATGG - Intergenic
974478486 4:62414674-62414696 GTGAACATTGTGTCCTCACATGG - Intergenic
974511073 4:62841649-62841671 GAAGACACTGTGTCCTCACATGG + Intergenic
974647960 4:64718235-64718257 AGAAATACCATGTGCTCACAAGG + Intergenic
976626871 4:87194238-87194260 ATGAACACTGTGTCCTCACATGG - Intronic
977020485 4:91753013-91753035 TTAAATACCACGTCCTCACCGGG - Intergenic
978740868 4:112136411-112136433 ATGAACACTATGTCCTCACATGG + Intergenic
979409360 4:120357174-120357196 TAAAACATCATGCCCTCACATGG + Intergenic
979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG + Intronic
980727068 4:136776549-136776571 ACAAACACTGTGTCCTCACATGG - Intergenic
980890918 4:138814436-138814458 GAAAATACCATGTACTGACAAGG + Intergenic
982294924 4:153817975-153817997 GTAAATGCCATGTCCTCACGTGG - Intergenic
982617503 4:157658853-157658875 TAGAACACCTTGTCCTCACATGG + Intergenic
983433132 4:167676504-167676526 GTGAACTCTATGTCCTTACATGG - Intergenic
986407229 5:7438223-7438245 GTAAGCACAATGCCCTAACAAGG - Intronic
986677140 5:10196002-10196024 CTTCTCACCATGTCCTCACATGG + Intergenic
987364413 5:17136214-17136236 AGAAACTCCAGGTCCTCACATGG + Intronic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
987816328 5:22905679-22905701 AGGAATACCATGTCCTCACATGG + Intergenic
988656395 5:33216583-33216605 GCAAACACTGTGTCCTTACATGG - Intergenic
988776073 5:34479107-34479129 CTTCTCACCATGTCCTCACATGG - Intergenic
991134057 5:63160716-63160738 ATTCTCACCATGTCCTCACATGG + Intergenic
994999312 5:107106812-107106834 ATGAACACTATGTCCTCACATGG - Intergenic
995855284 5:116585275-116585297 CTTCTCACCATGTCCTCACATGG + Intergenic
997100944 5:130968842-130968864 GTAAATGCTGTGTCCTCACATGG - Intergenic
997383090 5:133451234-133451256 GTAAACAGCAGGCCCTCAGAAGG - Intronic
997650791 5:135517724-135517746 CTTCTCACCATGTCCTCACATGG - Intergenic
998642149 5:144023035-144023057 ACAAACACTGTGTCCTCACATGG - Intergenic
998842598 5:146271516-146271538 GGAAAGACCATGTCCTCTCAAGG + Exonic
998932328 5:147194931-147194953 ATGAACACTATGTCCTCACATGG + Intergenic
1000375246 5:160574741-160574763 ACAAACACTGTGTCCTCACATGG - Intronic
1000941943 5:167372405-167372427 GTGTACTCCATGTCCTCCCATGG + Intronic
1001979083 5:176025771-176025793 AGAAACACCGTGTTCTCACATGG - Intronic
1002238334 5:177817993-177818015 AGAAACACCGTGTTCTCACATGG + Intergenic
1002993307 6:2257896-2257918 GGGAACACTGTGTCCTCACATGG - Intergenic
1003336462 6:5177552-5177574 AGAAACAGCATGTCCTAACAAGG - Intronic
1003477272 6:6495061-6495083 GTAAACCGCAGGTCTTCACATGG + Intergenic
1004190654 6:13460898-13460920 GCAAACTCTGTGTCCTCACATGG - Intronic
1004870237 6:19896924-19896946 GTAGACCAGATGTCCTCACATGG - Intergenic
1006597894 6:35206855-35206877 GGAAAGACCATGTACACACAGGG - Intergenic
1006723735 6:36180290-36180312 ATGAACACTATGTCCTCACATGG - Intergenic
1007183508 6:39948025-39948047 GTAACCACCATTTCCTGACTTGG + Intergenic
1008637981 6:53431515-53431537 AGAAACACTGTGTCCTCACATGG - Intergenic
1009489245 6:64267309-64267331 TCAAACACCAAGTCCTGACATGG + Intronic
1011349368 6:86405593-86405615 CTTCTCACCATGTCCTCACATGG - Intergenic
1012157495 6:95838071-95838093 CTACTCACTATGTCCTCACATGG - Intergenic
1013692614 6:112663791-112663813 ATAAACACTGTGTCCTCACATGG + Intergenic
1014075079 6:117226290-117226312 AGAAACACTATGTCCCCACATGG + Intergenic
1014786944 6:125630392-125630414 ACAAACACTGTGTCCTCACATGG - Intergenic
1017799558 6:157881140-157881162 GTCAACAGCATGTACTCACTTGG + Intronic
1018680508 6:166260477-166260499 AGGAACGCCATGTCCTCACATGG - Intergenic
1020565754 7:9793536-9793558 TCAAACACTGTGTCCTCACATGG + Intergenic
1022131900 7:27412250-27412272 GTAAAAGCCAGGTCCTGACACGG + Intergenic
1022544486 7:31173445-31173467 GTCAACACCATTCCATCACAAGG - Intergenic
1022699357 7:32743597-32743619 AGGAACACCGTGTCCTCACATGG + Intergenic
1023708797 7:42969994-42970016 GTAAACTCCATGTCCTTGAAGGG + Intergenic
1023886671 7:44361923-44361945 GCAAATGCCATGTTCTCACATGG + Intergenic
1024622760 7:51176545-51176567 GCAAAAATCATGTCCTCAAAAGG - Intronic
1024666055 7:51548324-51548346 GAAAATACCATTTCCTCTCAGGG + Intergenic
1031179747 7:118399087-118399109 GCAAACAGCATGTCTTCACATGG + Intergenic
1031273976 7:119694247-119694269 ACAAACACTGTGTCCTCACATGG - Intergenic
1031385559 7:121146232-121146254 GAAAATTCTATGTCCTCACATGG + Intronic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1035277783 7:157758365-157758387 GTAACCTCCATGTCCCCAAAGGG + Intronic
1036579854 8:10063684-10063706 CTTCTCACCATGTCCTCACATGG - Intronic
1036677551 8:10847517-10847539 CTTCTCACCATGTCCTCACAGGG - Intergenic
1041483994 8:58353901-58353923 ATAAACACCATATCCCCAGAAGG - Intergenic
1041521036 8:58756570-58756592 ATTAACACTCTGTCCTCACATGG - Intergenic
1041740560 8:61152521-61152543 CTTATCACCACGTCCTCACAAGG + Intronic
1045546621 8:103134892-103134914 ATGAACACTGTGTCCTCACAAGG - Intronic
1046340129 8:112843347-112843369 GAAGACACTGTGTCCTCACATGG - Intronic
1047180419 8:122582519-122582541 GAAAACACAATGTCCTCAAGTGG - Intergenic
1048485383 8:134843176-134843198 CTTCTCACCATGTCCTCACATGG - Intergenic
1050389179 9:5120171-5120193 AGGAACACCATGTCCTCACATGG + Intronic
1051000469 9:12275915-12275937 ATGAACACCGTGTCCTAACATGG + Intergenic
1053185831 9:36015654-36015676 TTGAACACTATGTCCTCACATGG + Intergenic
1053459653 9:38258439-38258461 GGGAGCACTATGTCCTCACATGG + Intergenic
1053723365 9:40971986-40972008 GGGAACACTGTGTCCTCACATGG - Intergenic
1054888589 9:70227242-70227264 GTAAACTCTATATCCTAACATGG + Intergenic
1055633932 9:78255545-78255567 CTTTTCACCATGTCCTCACATGG + Intronic
1056665441 9:88577571-88577593 GTGGACACTGTGTCCTCACATGG + Intronic
1056876549 9:90338762-90338784 AGAAATATCATGTCCTCACATGG - Intergenic
1057222631 9:93265549-93265571 ACAAACACCAGGTCCTCACTGGG + Intronic
1057968746 9:99532036-99532058 GGAAAGGCTATGTCCTCACATGG - Intergenic
1059881592 9:118696413-118696435 ATAAACACTGTGTCCTCAAATGG + Intergenic
1060356853 9:122916549-122916571 GTCAACATCATTTCTTCACAGGG - Exonic
1062339498 9:136087672-136087694 GCAAACACCATGGCCTCCCTGGG - Intronic
1185542031 X:910217-910239 AGAAACACCTTGTCCTTACATGG + Intergenic
1185636100 X:1553248-1553270 CTTCTCACCATGTCCTCACATGG - Intergenic
1188755390 X:33955195-33955217 GTAAACCCAATGTAGTCACATGG - Intergenic
1189254251 X:39625235-39625257 ATGAACACTATGTCCTCACGTGG + Intergenic
1190074412 X:47305674-47305696 GGGAACACTGTGTCCTCACATGG - Intergenic
1192249543 X:69400129-69400151 ACAAACACTGTGTCCTCACATGG + Intergenic
1194344341 X:92744649-92744671 GTAAAGCCTGTGTCCTCACACGG + Intergenic
1195549882 X:106156194-106156216 AGAAACACTGTGTCCTCACATGG + Intergenic
1195571135 X:106399758-106399780 GTAACCATCATGACTTCACAGGG + Intergenic
1195872383 X:109499909-109499931 AGAAACACCATGTCTTCACCTGG + Intergenic
1196046473 X:111261027-111261049 GCAAACACCATGCTCTCAAACGG + Intronic
1196538035 X:116870685-116870707 ATAACCATTATGTCCTCACATGG - Intergenic
1196567227 X:117222404-117222426 ATAAACTCTGTGTCCTCACATGG + Intergenic
1196760445 X:119196403-119196425 GCAAACGCCGTGTCCTCACATGG + Intergenic
1198578228 X:138034809-138034831 GTAAGCACTATCTCCTAACAAGG - Intergenic
1198578266 X:138035170-138035192 GTAAGCACTATCTCCTAACAAGG - Intergenic
1198891846 X:141405003-141405025 ATAAACACTGTGTCCTCACATGG - Intergenic
1199378226 X:147137465-147137487 GGAAACACTGTGTCCTCCCATGG - Intergenic
1199923191 X:152431667-152431689 GTAAACACAATGTAATCACAAGG + Intronic
1199971665 X:152866209-152866231 CTTTTCACCATGTCCTCACATGG + Intronic
1200580729 Y:4947274-4947296 GAGAACACTGTGTCCTCACATGG + Intergenic
1200652686 Y:5861290-5861312 GTAAAGCCTGTGTCCTCACACGG + Intergenic