ID: 987606625

View in Genome Browser
Species Human (GRCh38)
Location 5:20144166-20144188
Sequence TGCCCTCTGGAACCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987606625_987606632 6 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606632 5:20144195-20144217 CACGGACAGCCTGGGAAACTGGG 0: 1
1: 0
2: 3
3: 60
4: 1425
987606625_987606635 22 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606635 5:20144211-20144233 AACTGGGCTACCTCTCTAGGAGG 0: 1
1: 0
2: 2
3: 18
4: 74
987606625_987606634 19 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606634 5:20144208-20144230 GGAAACTGGGCTACCTCTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 135
987606625_987606631 5 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606631 5:20144194-20144216 CCACGGACAGCCTGGGAAACTGG 0: 1
1: 0
2: 1
3: 17
4: 219
987606625_987606629 -2 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606629 5:20144187-20144209 CAGACTTCCACGGACAGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 139
987606625_987606636 30 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606636 5:20144219-20144241 TACCTCTCTAGGAGGCATCTCGG 0: 1
1: 0
2: 2
3: 8
4: 95
987606625_987606628 -3 Left 987606625 5:20144166-20144188 CCTCTTTGAGGTTCCAGAGGGCA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 987606628 5:20144186-20144208 GCAGACTTCCACGGACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987606625 Original CRISPR TGCCCTCTGGAACCTCAAAG AGG (reversed) Intronic
902883360 1:19387437-19387459 GGCCATCTGGGACCTGAAAGAGG + Intronic
903017915 1:20373631-20373653 CTCCCTCTGGAACTTCAAAAAGG + Intergenic
903383978 1:22914969-22914991 GGCACTCAGGAGCCTCAAAGGGG - Intronic
903976613 1:27154510-27154532 TGCAATCTGGAACTCCAAAGTGG + Exonic
904305493 1:29586032-29586054 TGCCCTATGGTACCTGAAACAGG - Intergenic
904768469 1:32868307-32868329 TGCCCTCTGGGACCTGGAGGAGG - Exonic
905301018 1:36986140-36986162 TTCCCTCTGGAAGCTCAGAGAGG - Intronic
905348037 1:37324883-37324905 TGAGCTCTGGAATTTCAAAGAGG - Intergenic
907486903 1:54784339-54784361 TGACCTCTGGCACCACAGAGAGG + Intronic
907592850 1:55692197-55692219 CACCCTCTGGCCCCTCAAAGTGG + Intergenic
910205566 1:84745746-84745768 TGGCCTCTGGAAGCTGAAAAAGG + Intergenic
910567854 1:88665577-88665599 TGCCCTCTGTAACATCATATAGG + Intergenic
912971653 1:114289477-114289499 AGACCTCTGGAATCTCAATGTGG - Intergenic
913172197 1:116243115-116243137 TGCCCTCTGGGAGCTCAGAGAGG - Intergenic
913977921 1:143479429-143479451 TGCCATTTGGAGCATCAAAGTGG - Intergenic
914072324 1:144305058-144305080 TGCCATTTGGAGCATCAAAGTGG - Intergenic
914106831 1:144661298-144661320 TGCCATTTGGAGCATCAAAGTGG + Intergenic
917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG + Intergenic
920606230 1:207389878-207389900 TGCCTTCTGTAACCTGAAATTGG + Intergenic
921780830 1:219161358-219161380 TTCCTTTTTGAACCTCAAAGGGG + Intergenic
921848949 1:219913658-219913680 TGCCCTTTATAAGCTCAAAGGGG - Intronic
922544395 1:226445073-226445095 TTCTCTCTGCAACCTCAAGGTGG - Intergenic
922668608 1:227492574-227492596 TGACCTCTGTAACTTAAAAGTGG - Intergenic
1065592939 10:27284104-27284126 TGCTCTCTGGACCCTGGAAGAGG - Intergenic
1065657429 10:27966182-27966204 TGCTCTCTGGACCCTGGAAGAGG + Intronic
1065895120 10:30156447-30156469 TGGCTTCTGGAAGCTCAGAGTGG + Intergenic
1069756895 10:70778966-70778988 TGGCCTCAGGGACCTAAAAGAGG - Intronic
1070472936 10:76801806-76801828 TGGCCTCTGGAAACTGAAAAAGG + Intergenic
1071443546 10:85725621-85725643 TGGCCTCTTGACCCTCAAAGTGG + Intronic
1073621451 10:105053043-105053065 GGCCCTCTGCAACCTGGAAGAGG - Intronic
1074629118 10:115230455-115230477 TGTCATCTGGAACAGCAAAGGGG + Intronic
1074884721 10:117684913-117684935 TGCCCGGTGGACCCTCAAGGGGG - Intergenic
1075564696 10:123494854-123494876 TGCCCTTTTGAATCTGAAAGTGG - Intergenic
1075699426 10:124459577-124459599 TGGCCTCTGGAAGCTAAAAAAGG - Intergenic
1076008504 10:126967636-126967658 TGGCCTCTGGAAGCTGGAAGCGG - Intronic
1077359456 11:2134256-2134278 TGCCCTTTGGCACCCCAAGGTGG - Intronic
1077843231 11:5997431-5997453 TAGCTTCTGGAACCTCAGAGGGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079312475 11:19378841-19378863 TGCCCTCAGGGAGCTCAGAGCGG - Intronic
1080940365 11:36910867-36910889 TGCCCAGTGGAACCTCATAGAGG - Intergenic
1081354625 11:42096940-42096962 TGACTGATGGAACCTCAAAGAGG + Intergenic
1081689376 11:45066848-45066870 TGGCTTCTGGGACCTGAAAGTGG - Intergenic
1087229523 11:95644686-95644708 TGCCCTTTGGAGCCTCCAAAAGG + Intergenic
1087628935 11:100627948-100627970 TGCCATTTGGAAACTAAAAGAGG + Intergenic
1090059293 11:123450103-123450125 TGCTCTCTGGAACCTCATTTTGG - Intergenic
1090488458 11:127136249-127136271 TTCTCTCTGGCTCCTCAAAGTGG - Intergenic
1091184779 11:133637474-133637496 TGCCCTCTGGAACTGTAAATGGG + Intergenic
1092565917 12:9665317-9665339 TGGCCTCTGGAAGCTGAAAAAGG - Intronic
1099378363 12:81922465-81922487 GGCCAGCTGGAAACTCAAAGAGG + Intergenic
1101448027 12:104752001-104752023 TGGCCTCAGGAACCTAAAAGAGG - Intronic
1107413897 13:40183202-40183224 TGCTCTTTGGAACCAGAAAGTGG + Intergenic
1108079664 13:46721748-46721770 CGCCTTCTGGAATCTCAGAGAGG - Intronic
1113926924 13:113946881-113946903 TGCCCTTTGGAGCCCCACAGCGG + Intergenic
1114385920 14:22254436-22254458 TGCACTCAGGAACCTCATAAAGG + Intergenic
1115748699 14:36465733-36465755 TGCCGGCTGCCACCTCAAAGTGG - Intergenic
1117372170 14:55088647-55088669 TGCCCTCTGGAAACTCAGGTAGG + Intergenic
1118277099 14:64394913-64394935 AGCCCTCTGGATCATCAGAGGGG - Intronic
1122297621 14:100714141-100714163 TTCCCTCTGCAACCACAGAGTGG + Intergenic
1122322058 14:100861149-100861171 TGCCCACTGGGCTCTCAAAGGGG + Intergenic
1122652551 14:103233295-103233317 AGCCTCCTGGAACCGCAAAGGGG - Intergenic
1124882665 15:33656756-33656778 TGCCCTCTGGGAGCTGAGAGTGG - Intronic
1128879963 15:71234083-71234105 TACTCTGTGGAACCACAAAGGGG + Intronic
1128894971 15:71364573-71364595 AGCCCTCTTGAACCCCTAAGGGG - Intronic
1129205418 15:74034571-74034593 TGCCCCCTGGGACCTGAAATGGG - Intronic
1129270917 15:74418821-74418843 TGCCCTCGGGGAAGTCAAAGAGG + Exonic
1133107368 16:3521146-3521168 TTACCTCTGGAGCCTCAGAGAGG + Intronic
1135546358 16:23369603-23369625 TGACCTCTGCAACCACCAAGAGG + Intronic
1135678807 16:24439670-24439692 TGGCCTCTGGAACTTCAAGTTGG - Intergenic
1136345740 16:29674572-29674594 TGGGCTCTGGAAACACAAAGAGG - Intronic
1141651388 16:85394909-85394931 GGCACTCTGGAAGCTCAATGGGG + Intergenic
1142100050 16:88266164-88266186 TGCCCTCCTGAGCCTCACAGTGG - Intergenic
1142960005 17:3546728-3546750 AGCCCTCTGGGAGGTCAAAGTGG + Intronic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1144748371 17:17631241-17631263 TGGCCTATGGAACCCCAAAAGGG - Intergenic
1145766343 17:27460646-27460668 TGCCATCTGGAAGGTCAGAGAGG + Intronic
1146381080 17:32327987-32328009 TGCCCTCTCAGACCTCCAAGTGG + Intronic
1146945389 17:36869919-36869941 GGACCTCTGGACCATCAAAGGGG - Intergenic
1147129307 17:38397252-38397274 TCCCCACTGGAACCACAGAGAGG - Intronic
1147920518 17:43913804-43913826 TGTCCTCAGGCACCTCAGAGAGG - Intergenic
1148220123 17:45855268-45855290 TTCCCTCTGGAAGCTCTAGGGGG - Intergenic
1151444098 17:74152109-74152131 TGCCTTGTGCAACGTCAAAGTGG + Intergenic
1151784945 17:76270887-76270909 TGCCTTCTGGAATCTGGAAGAGG + Exonic
1152594741 17:81232668-81232690 GGCCCTCTGGAAGCTCCCAGTGG + Intronic
1152739353 17:82012274-82012296 GGCCCTCAGGTACCTGAAAGAGG - Exonic
1155437498 18:25828159-25828181 TGCCCGCTCCAACCTCAGAGGGG + Intergenic
1157085460 18:44576241-44576263 TTCCTTCTGGAACCTCAGAAGGG + Intergenic
1157493964 18:48142369-48142391 GGCCCTCAGGAACCTCCGAGGGG + Intronic
1157694116 18:49707333-49707355 TGCCTTCTGGGAACCCAAAGGGG - Intergenic
1158519218 18:58156784-58156806 TGCCCTCTGCAACCTCATAACGG + Intronic
1160219124 18:76959715-76959737 TGGCTTCTGGGAGCTCAAAGAGG - Exonic
1160579957 18:79878026-79878048 TGCCATCGGGAACCGCAACGTGG - Intronic
1161801759 19:6420229-6420251 TGCCCTCCTGAACGTCAGAGGGG - Intronic
1162065996 19:8125925-8125947 GGCCCTCTGGACACTCACAGCGG + Exonic
1163879495 19:19904931-19904953 TACCCTCAGGAACCTCACCGTGG + Intronic
1164030469 19:21398822-21398844 TGCCCCCTGGATTCTCTAAGGGG + Intronic
1164101101 19:22055133-22055155 TGCCCCCTGGATTCTCTAAGTGG + Intronic
1165313825 19:35042987-35043009 TGCACTCAGCAACCTCACAGAGG - Intronic
1165823422 19:38691949-38691971 CGCTTTCTGGCACCTCAAAGGGG + Intronic
1167873755 19:52394790-52394812 TGGCCTCTGGAACCTACAAAGGG - Intergenic
1167877212 19:52424239-52424261 TGGCCTCTGGAACCTACAAAGGG - Intergenic
1168366300 19:55790889-55790911 TGCCCTATGGGAGCTCATAGAGG + Intronic
925503190 2:4529928-4529950 TGCTCTCTGGAACCTCACCCAGG - Intergenic
927468560 2:23355118-23355140 TGCAATGAGGAACCTCAAAGTGG + Intergenic
928114829 2:28539128-28539150 AGACCTCTGCAACCTCAGAGAGG - Exonic
929898512 2:45982155-45982177 TGGCCTCTGGAAGCACAAGGTGG - Intronic
932454054 2:71834878-71834900 TGTTCCCTGGAACCTGAAAGAGG + Intergenic
934182629 2:89640437-89640459 TGCCATTTGGAGCATCAAAGTGG - Intergenic
935061727 2:99614495-99614517 TGCTCTCTGGTATCTCAAATTGG - Intronic
935430911 2:102974615-102974637 TGCTTTCTGGAAACTGAAAGGGG + Intergenic
936662650 2:114559405-114559427 TTCCTTCTGGAATCTCTAAGGGG - Intronic
937219686 2:120335360-120335382 TGAGCTCTGGAAGCTCAGAGTGG + Intergenic
938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG + Intronic
938654020 2:133412265-133412287 AGCCATCTGCAACCTCGAAGAGG + Intronic
938973546 2:136454094-136454116 TGGCCACTGAAAACTCAAAGTGG + Intergenic
940402368 2:153262354-153262376 TGTCCTCTGGGACTACAAAGAGG + Intergenic
941347247 2:164385825-164385847 TGCCCTCTGCAACCTTAAAATGG + Intergenic
944970235 2:204984671-204984693 TGACATCTGGCTCCTCAAAGAGG - Intronic
947463561 2:230323084-230323106 TTCCTTCTGGAACCCCAAGGTGG - Intergenic
948203151 2:236144182-236144204 TGCTCTATGGAACCTCAAAGAGG + Intergenic
1168754726 20:308393-308415 TGCCCTCAGGGAGCTCAAAGTGG - Intergenic
1169697969 20:8412367-8412389 CACCCTCTGGAACCCCACAGTGG - Intronic
1169698847 20:8424010-8424032 TGCCCTCTGGAAGAACAGAGGGG + Intronic
1171223133 20:23419783-23419805 TGTCCTCAGGAACCTCTCAGAGG - Intronic
1171399842 20:24865741-24865763 TGCCCTCAGGAAACACAGAGTGG + Intergenic
1171455990 20:25272687-25272709 TGCCCTCTGCAACCTTAGAAAGG + Intronic
1171849045 20:30295203-30295225 TTCCCTCTGGAACCACAGACAGG + Intergenic
1172639420 20:36431951-36431973 TCTCCTCTGGCACCTCGAAGTGG - Exonic
1173306549 20:41856121-41856143 TGCTCTTTGGAAGCTCCAAGTGG - Intergenic
1173578572 20:44129951-44129973 TTCCTTCTGGAGGCTCAAAGGGG - Intronic
1174484036 20:50850401-50850423 TGCCCTTGGGAAGCTCACAGAGG - Intronic
1175270956 20:57733941-57733963 TGACCTCTAGAACCTGAAAAAGG - Intergenic
1176729851 21:10482838-10482860 TGCCATTTGGAGCATCAAAGTGG + Intergenic
1177305559 21:19310826-19310848 TGCCTGCTGTAACCTGAAAGTGG - Intergenic
1178512367 21:33216232-33216254 TGCCATCTGGAACCTCAGCCAGG + Intergenic
1179555959 21:42176278-42176300 TTCTTTCTGGAACCTCAAAATGG + Intergenic
1179796850 21:43789852-43789874 AGCCCTGTGGAACCTCCACGTGG + Intronic
1180158114 21:45987739-45987761 TCCCCTCTGGATCCTCATGGTGG - Intronic
1182571792 22:31244606-31244628 AGCCCTCTGCAACCTCATAGGGG + Intronic
1183439388 22:37814870-37814892 TGCCCTCTGGGACCTTACACAGG + Intronic
1184401943 22:44279548-44279570 TGAACTCTGGGACCTCACAGGGG + Intronic
1184868133 22:47215083-47215105 TACACTCTGGAAGCTTAAAGGGG + Intergenic
956393482 3:68799721-68799743 TAGCCTCTAGAACCTGAAAGGGG + Intronic
956930846 3:74041249-74041271 TTGTCTCTGAAACCTCAAAGTGG + Intergenic
957553481 3:81736187-81736209 TGTCCTCTGGAATCTCAGAAGGG + Intronic
957560568 3:81815539-81815561 TGCCCTCTAGAACCTAAGGGTGG - Intergenic
957648428 3:82966683-82966705 TGCCCTCAAGAACTTGAAAGGGG + Intergenic
957961546 3:87260364-87260386 TGCCCTCTGGTGGCACAAAGTGG - Intronic
960275714 3:115726967-115726989 CGGCCTCTGCAACCTGAAAGAGG + Intergenic
961539906 3:127592194-127592216 TGCCCTCTGGAGGCTAGAAGCGG - Intronic
963006218 3:140728348-140728370 TGCACTCAGCAACCTCATAGTGG + Intergenic
965111654 3:164432374-164432396 TGGCCTCTGGAAGCTGAGAGGGG + Intergenic
965242738 3:166224770-166224792 TGCCCTTTGGAACCCCTAAGGGG + Intergenic
968910949 4:3476710-3476732 TGCCCGCAGGAACCTCAGTGTGG + Intronic
968990779 4:3910162-3910184 TGCCCTTGGGAACCTCCAAAGGG + Intergenic
969553878 4:7892892-7892914 TGCCCTCTGCCATCTCAAGGAGG - Intronic
972161057 4:36227974-36227996 AGACCTCTGGGACCCCAAAGAGG - Intronic
972247704 4:37262806-37262828 TACCCTCTGCAACCTCAGAGAGG - Intronic
972374588 4:38458681-38458703 GGCACTCTGGAGACTCAAAGAGG + Intergenic
973207671 4:47578432-47578454 GGTCCACTGGAACCTGAAAGGGG - Intronic
974761209 4:66276628-66276650 TTCCATCTGGAACCCCAAATAGG - Intergenic
976850186 4:89536143-89536165 TGTCCTCTGGATCCCCACAGAGG + Intergenic
982367278 4:154593161-154593183 TGCCCTCTGGAACCTGGATGGGG - Intergenic
982390885 4:154862753-154862775 TGCCCTCCGGAACCCCAGAATGG - Intergenic
984039119 4:174706746-174706768 TGCTATATGGAATCTCAAAGGGG + Intronic
985969009 5:3360712-3360734 TGGCCTCTGGAAGCTGGAAGAGG + Intergenic
986016040 5:3757889-3757911 TGTAGGCTGGAACCTCAAAGCGG + Intergenic
986339981 5:6780551-6780573 TGCCCTCTAGTAGCCCAAAGGGG - Intergenic
987485308 5:18518878-18518900 TGGCCTCTAGAACCTGAAAAGGG + Intergenic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
991655946 5:68903926-68903948 TGCCCTCTGGAGGATCTAAGAGG - Intergenic
992457270 5:76927339-76927361 TGACACCTGGAACCTCAAAAAGG - Intergenic
992553942 5:77885226-77885248 GGTCCTATGGAACCTCTAAGGGG + Intergenic
994979394 5:106854373-106854395 TGCACTTTTGAACCACAAAGAGG - Intergenic
998312011 5:141142662-141142684 TGCACTCTGAAACCTGGAAGAGG - Intronic
1000719790 5:164692586-164692608 TGCCCTCTAGAAGCTGAAAGTGG + Intergenic
1001588798 5:172851595-172851617 AGACCTCTGGGACCTTAAAGCGG + Intronic
1001738048 5:174023138-174023160 AGCCATCTGGAACCTGGAAGAGG - Intergenic
1002274817 5:178097175-178097197 TGCCGTCTTCAAACTCAAAGAGG - Intergenic
1002905314 6:1443879-1443901 TGCTCTCTGGGACCTCCAGGTGG - Intergenic
1004602890 6:17167551-17167573 TGCCCTCTGGCGTCTCAGAGAGG + Intergenic
1007088844 6:39169453-39169475 TGCCGTCTGGAAGCACAATGGGG - Intergenic
1010092674 6:72003337-72003359 TGCCCTATGGAACTTAAAATCGG - Intronic
1010278383 6:73994988-73995010 TGCACCCTGGAACCTCATGGAGG - Intergenic
1013787662 6:113799774-113799796 AGCCATCTGCAACCTGAAAGAGG + Intergenic
1015265910 6:131292330-131292352 TTCCCTATGGAAACTCAAAGTGG - Intergenic
1016469078 6:144356068-144356090 AGCCTTCTGGAACCTCAAAAGGG + Intronic
1020110247 7:5443691-5443713 TGTCCACTGGAACCTCAGATAGG + Intronic
1020658212 7:10952421-10952443 TGCCCTCTGGACCCTCACAGGGG + Intergenic
1023271335 7:38466250-38466272 TGCCATGTGGAAACACAAAGAGG + Intronic
1023893999 7:44417003-44417025 TGCCGTATAGAACCTAAAAGTGG - Intronic
1024798080 7:53042337-53042359 GGTCCTCTGGAACGTCAAAAAGG - Intergenic
1026512798 7:71041016-71041038 AGCCCCCTGGAAGCTGAAAGAGG + Intergenic
1027185258 7:75967299-75967321 TGCACTCGGGAACCTCAGAAGGG + Intronic
1029341480 7:99948320-99948342 TGCCCTCAGGAAACTCATATAGG - Intergenic
1033126220 7:138709590-138709612 TGTCCCCTGGAAGCTCAATGTGG - Intronic
1033952553 7:146802877-146802899 TGCTCTCTGGAACTTGGAAGAGG + Intronic
1034599736 7:152238706-152238728 TGCCATTTGGAGCATCAAAGTGG - Exonic
1035047247 7:155975718-155975740 TGCTCTTGGGAACCACAAAGAGG + Intergenic
1035051077 7:155999363-155999385 TGCCCGCTGCTCCCTCAAAGCGG + Intergenic
1035183325 7:157106694-157106716 CACCCTCTCGAATCTCAAAGAGG + Intergenic
1038958386 8:32491806-32491828 TGGCCTCACAAACCTCAAAGAGG - Intronic
1040574660 8:48640976-48640998 TGCACTCTGGAAGCTCACATAGG - Intergenic
1041059176 8:54019800-54019822 TGTCCTCTGGAAATTCAAACAGG - Intronic
1041208588 8:55523690-55523712 TGCCCTCTGGTACCTCTACAAGG + Exonic
1042022493 8:64382280-64382302 CGCCCTCTGCTGCCTCAAAGAGG + Intergenic
1044182777 8:89216681-89216703 TGCCCCCTGGCACTTTAAAGAGG + Intergenic
1044206032 8:89492800-89492822 TGTCCTCTGGGACTTCCAAGTGG + Intergenic
1045596204 8:103659486-103659508 GGCCCTCAGACACCTCAAAGTGG + Intronic
1046629087 8:116605697-116605719 TGATCTCTCGAACCTCCAAGTGG + Intergenic
1046691093 8:117285415-117285437 TGCTCTCTGGTAGCTCATAGAGG - Intergenic
1047912992 8:129551483-129551505 TGGCCTCTGGCTCCTAAAAGTGG + Intergenic
1049619553 8:143591903-143591925 TGCACTCTGCAGCCTCTAAGTGG + Intronic
1049915466 9:313207-313229 TGCCCTTTAGATCATCAAAGAGG - Intronic
1053786765 9:41657923-41657945 TTCCCTCTGGAACCACAGACAGG + Intergenic
1054158295 9:61656272-61656294 TTCCCTCTGGAACCACAGACAGG - Intergenic
1054478068 9:65587277-65587299 TTCCCTCTGGAACCACAGACAGG - Intergenic
1055975511 9:81950942-81950964 TGCCCTGGTAAACCTCAAAGGGG - Intergenic
1056310899 9:85339870-85339892 TGCCCACTGGACCCTCAGTGGGG - Intergenic
1056846472 9:90041901-90041923 TGCCTTCTGGAACCTGAGAAGGG + Intergenic
1059807791 9:117822790-117822812 GGACTTCTGGAATCTCAAAGGGG - Intergenic
1060876694 9:127089070-127089092 TGCCCACTCCAACCTCAACGGGG - Exonic
1061398659 9:130356773-130356795 TGCCCTCTCAAAGCTCACAGAGG - Intronic
1061694616 9:132363037-132363059 TGCCCTCTGGCATCCAAAAGAGG + Intergenic
1061730498 9:132610278-132610300 TGCACTCCTGAACCTCAAAATGG + Intronic
1187118193 X:16375168-16375190 TGCCCTCTAGAAGCTGGAAGAGG - Intergenic
1187533357 X:20116268-20116290 TGCCCCCTGGAAACGCCAAGAGG + Intronic
1187583841 X:20638210-20638232 TGTCCTCTAGAAACTGAAAGAGG + Intergenic
1188511880 X:30944965-30944987 TGCCCACTGGATCCACAATGAGG - Intronic
1190042226 X:47080672-47080694 TGGCCTCTGCACCCTCATAGAGG + Exonic
1192961992 X:76140882-76140904 AGCACTCTGCAACCTGAAAGAGG - Intergenic
1198279976 X:135132263-135132285 TGTCCTCTGGAAGCTGAAAAAGG - Intergenic
1198290981 X:135240251-135240273 TGTCCTCTGGAAGCTGAAAAAGG + Intergenic
1198673200 X:139103884-139103906 TGCCTTCTAGAACCTTAAACAGG + Intronic
1198782470 X:140252352-140252374 TGCCCTCTGGGAGCTCACAGTGG + Intergenic
1199652475 X:149960168-149960190 GGCCATCTGCAACCCCAAAGAGG - Intergenic
1201950014 Y:19553275-19553297 TGACCTCTGGAGTCTCAGAGAGG + Intergenic
1202234346 Y:22693092-22693114 TTTCCTCTGAAACCACAAAGAGG - Intergenic
1202308813 Y:23503074-23503096 TTTCCTCTGAAACCACAAAGAGG + Intergenic
1202561988 Y:26167514-26167536 TTTCCTCTGAAACCACAAAGAGG - Intergenic