ID: 987608573

View in Genome Browser
Species Human (GRCh38)
Location 5:20171987-20172009
Sequence AGCTTACAAAATAAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 1, 2: 18, 3: 135, 4: 434}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987608573_987608577 6 Left 987608573 5:20171987-20172009 CCTCATTGCTTATTTTGTAAGCT 0: 1
1: 1
2: 18
3: 135
4: 434
Right 987608577 5:20172016-20172038 AAGGTCAGTTGGTTTAGGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
987608573_987608578 21 Left 987608573 5:20171987-20172009 CCTCATTGCTTATTTTGTAAGCT 0: 1
1: 1
2: 18
3: 135
4: 434
Right 987608578 5:20172031-20172053 AGGTGTGGAACCTTATTTCTTGG 0: 1
1: 16
2: 189
3: 917
4: 1697
987608573_987608576 1 Left 987608573 5:20171987-20172009 CCTCATTGCTTATTTTGTAAGCT 0: 1
1: 1
2: 18
3: 135
4: 434
Right 987608576 5:20172011-20172033 TGTCAAAGGTCAGTTGGTTTAGG 0: 1
1: 1
2: 12
3: 129
4: 327
987608573_987608575 -5 Left 987608573 5:20171987-20172009 CCTCATTGCTTATTTTGTAAGCT 0: 1
1: 1
2: 18
3: 135
4: 434
Right 987608575 5:20172005-20172027 AAGCTTTGTCAAAGGTCAGTTGG 0: 1
1: 7
2: 161
3: 1306
4: 8786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987608573 Original CRISPR AGCTTACAAAATAAGCAATG AGG (reversed) Intronic
901564586 1:10102730-10102752 AGCTTACAATACAATCTATGGGG - Intronic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
906176416 1:43777503-43777525 ACCTGACAAAACAAGCAATGGGG + Intronic
906571065 1:46841028-46841050 GCTTGACAAAATAAGCAATGGGG - Intergenic
906600210 1:47120276-47120298 GCTTGACAAAATAAGCAATGGGG + Intergenic
906897335 1:49790056-49790078 ACCTGACAAAAAAAGCAATGGGG + Intronic
906979663 1:50616119-50616141 GGCCAACAAAACAAGCAATGTGG - Intronic
908735865 1:67276294-67276316 ACCTGACAAAAAAAGCAATGGGG + Intergenic
908933474 1:69344650-69344672 ACCTGACAAAAACAGCAATGGGG - Intergenic
909898238 1:81100748-81100770 AGATTAAAAAATATGCCATGAGG - Intergenic
910103303 1:83601796-83601818 AGCTAACATCATAATCAATGGGG + Intergenic
910563299 1:88616021-88616043 AGCTAACACAATCAGCACTGTGG + Intergenic
911325205 1:96463123-96463145 GGCTTAAAAGAAAAGCAATGTGG - Intergenic
911540915 1:99157419-99157441 ACCTGACAAAAACAGCAATGGGG - Intergenic
911675337 1:100652466-100652488 ACCTGACAAAACAAGCAATGGGG + Intergenic
912034301 1:105291906-105291928 ACCTGACAAAACAAGAAATGAGG - Intergenic
912656943 1:111494872-111494894 AACTGACAAAACAAGCAGTGGGG + Intronic
914842146 1:151257204-151257226 AGCTGACAAAACAAGCAGTGAGG - Intronic
915011508 1:152691084-152691106 ACCTGACCAAAAAAGCAATGGGG + Intergenic
915024851 1:152818015-152818037 TCCTGACAAAATAAGAAATGGGG - Intergenic
915123234 1:153645791-153645813 AGTTTACTAAATTATCAATGTGG - Exonic
915643570 1:157250080-157250102 AAATTAATAAATAAGCAATGTGG - Intergenic
915846657 1:159273422-159273444 ACCTGACAAAAAAAGCAATAAGG + Intergenic
917528604 1:175812191-175812213 ACCTGACAAAAAAAGCAATGGGG + Intergenic
917562390 1:176173010-176173032 AGCTTAAAAAATCAGTAATTGGG + Intronic
917714080 1:177716273-177716295 ATCTGACAAAACAAGAAATGGGG + Intergenic
917856821 1:179108005-179108027 AGCAGACAAAATCAGCAAAGAGG - Exonic
918306986 1:183256069-183256091 AGCTAACATTATAATCAATGGGG - Intronic
918668174 1:187178290-187178312 AGCTTGCAAAAGCAGCCATGGGG - Intergenic
918947875 1:191093236-191093258 AGGCGACAAAATAAGCAATGAGG + Intergenic
919235143 1:194831260-194831282 AGCTGACAAAGAAAGCAATGGGG + Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
919389285 1:196962122-196962144 AGCTTACAATATAAGAAAGCAGG + Intergenic
921434648 1:215104205-215104227 AGCTAAGAAAATAAACAATTTGG + Intronic
923542341 1:234897542-234897564 GGCTTACAAACAAGGCAATGAGG - Intergenic
923581871 1:235225277-235225299 AGCTTACATAATCAGTAAAGTGG + Intronic
924045844 1:240029727-240029749 AGCTTACAAAATTGACAGTGAGG - Intronic
924307485 1:242705668-242705690 ACCTTACAAAAACAGCAATGAGG + Intergenic
924613716 1:245594433-245594455 ACCTGACAAAACAAGCAATGGGG - Intronic
924639597 1:245821272-245821294 ACCTGACAAAAGAAGCAATGGGG + Intronic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
924884106 1:248193826-248193848 ACCTGACAAAAAAAGCAATGGGG + Intergenic
924919015 1:248606485-248606507 AGCTTAAAACATAAGCAATGGGG - Intergenic
1062953143 10:1520640-1520662 AGCAGACAAACTAAGCAATGTGG - Intronic
1063000375 10:1912765-1912787 AGCTTACAAAGTAGGATATGAGG + Intergenic
1063403236 10:5768124-5768146 AGCATACAAAATTAGGAATTTGG + Intronic
1063771230 10:9204223-9204245 AGCTTTGAAAATAGGCAATATGG + Intergenic
1063841338 10:10075403-10075425 AGCTTCCAGCATGAGCAATGTGG - Intergenic
1063902953 10:10753866-10753888 AGCATCCACATTAAGCAATGCGG - Intergenic
1064530272 10:16301893-16301915 AGCTTATAAAACAATCAAGGGGG + Intergenic
1065248348 10:23782943-23782965 AGCTAACATAATAATTAATGGGG - Intronic
1065429922 10:25643210-25643232 AGGTTATAAAAGAAGGAATGTGG - Intergenic
1065460820 10:25962251-25962273 AACTTATAAAATAACAAATGAGG - Intronic
1065471240 10:26083600-26083622 AGCTAACATTATAATCAATGAGG - Intronic
1065691898 10:28342782-28342804 AGCTGACAAAATAAGCGATAGGG - Intergenic
1066608835 10:37212829-37212851 AACTGAAAAAAAAAGCAATGGGG - Intronic
1067207035 10:44227223-44227245 ACTTGACAAAACAAGCAATGGGG - Intergenic
1067997859 10:51295781-51295803 AGCTAACATAATAATCATTGAGG - Intronic
1068260361 10:54572920-54572942 AGGATACAAAATTAGCACTGGGG - Intronic
1068456852 10:57266350-57266372 AGAAAACAAATTAAGCAATGAGG - Intergenic
1068733539 10:60386785-60386807 AGTTTATAAAATAAGGAATTTGG - Intronic
1071503608 10:86219992-86220014 ATTTTACAAAATAAGGCATGAGG - Intronic
1072408197 10:95174516-95174538 ACCTGACAAAACAAGCAATGGGG - Intergenic
1073927127 10:108530184-108530206 ACCTGACAAAACAAGCAATGGGG + Intergenic
1074001248 10:109375571-109375593 AGCTAACAAAACAATGAATGTGG + Intergenic
1074013793 10:109511644-109511666 AGCTGACAAAACAAGCATTAGGG - Intergenic
1074612160 10:115032334-115032356 AGTTGACAAAATAAGCAATGAGG - Intergenic
1074666542 10:115732731-115732753 AGCATATATAAAAAGCAATGTGG - Intronic
1075655567 10:124158825-124158847 ACCTCCCAGAATAAGCAATGGGG - Intergenic
1078278074 11:9870580-9870602 ACCTGACAGAACAAGCAATGGGG + Intronic
1078813628 11:14797128-14797150 ACCTGACACAACAAGCAATGGGG - Intronic
1079418824 11:20266680-20266702 AGCTTACAAAATTATAATTGTGG + Intergenic
1079596674 11:22258351-22258373 AGATTACATAATAATCATTGAGG + Intronic
1080295880 11:30726890-30726912 AGCTTATAATATTAGCAGTGAGG + Intergenic
1080570954 11:33556937-33556959 AGCCTACAAAGTTTGCAATGTGG - Intronic
1080673360 11:34401596-34401618 AACTTATAAAAAAAGCACTGAGG + Intergenic
1080801188 11:35611824-35611846 AGCTTACAAACTAAGGAAGGAGG - Intergenic
1081035027 11:38133474-38133496 ACCTGACAAAATAAGGAATGGGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1081316279 11:41634723-41634745 AGTCAACAAAACAAGCAATGGGG - Intergenic
1081402045 11:42654699-42654721 ACCTGACAAAACAAGCAATGGGG - Intergenic
1082753318 11:57046028-57046050 ACCTGATAAAAAAAGCAATGGGG + Intergenic
1082871698 11:57948817-57948839 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1083056539 11:59826477-59826499 AGTCAACAAAATAAACAATGGGG - Intergenic
1083708341 11:64531844-64531866 AACTTACAAAAAAGGCAGTGAGG + Intergenic
1084437275 11:69151057-69151079 AACTGACAAAAAAAGCAATGGGG + Intergenic
1085833389 11:79927356-79927378 AGTTTGCCATATAAGCAATGTGG + Intergenic
1085979542 11:81707271-81707293 ATCTTACAGAATAAGAAATCCGG + Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086418434 11:86613172-86613194 ACCTGAAAAAATAAGCAATGGGG - Intronic
1086731375 11:90254035-90254057 AGCTAACATAATAATCAACGGGG - Intergenic
1087573686 11:99963423-99963445 ACCTGACAAAAAAAGAAATGGGG - Intronic
1087668251 11:101075196-101075218 ATCTGACCAAAAAAGCAATGGGG + Intronic
1087741907 11:101897620-101897642 ACCTGACAAAAAAAGCAATGGGG - Intronic
1088052118 11:105529709-105529731 AGCTGGCAAAACAAGCAATGAGG + Intergenic
1088061470 11:105656247-105656269 ACCTGACAAAATGAGCAATGGGG + Intronic
1088176344 11:107056747-107056769 AACTGACAAAACAAGCAATGGGG + Intergenic
1088690936 11:112326881-112326903 ACCTGACAAAATAAGCAACAGGG - Intergenic
1089811191 11:121133093-121133115 AGCTAAGAAAATAAGCAAACAGG - Intronic
1091030487 11:132183069-132183091 AGTTGACAATATATGCAATGAGG - Intronic
1091063962 11:132491367-132491389 TGCCTAGAAGATAAGCAATGGGG - Intronic
1091474504 12:758693-758715 ATCCTAAAAAATAAGGAATGTGG - Intronic
1093336718 12:17913594-17913616 AGCTTACATTACAATCAATGAGG - Intergenic
1093544609 12:20331904-20331926 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1093803680 12:23406019-23406041 AGCTAACGTTATAAGCAATGAGG + Intergenic
1094382955 12:29863526-29863548 AGCTTTTAAAATAAGCAGAGAGG + Intergenic
1095914648 12:47465048-47465070 ACCTGACAAAACAAGCAATGGGG - Intergenic
1096277678 12:50224359-50224381 AGCTTACAAAATGATCCATTGGG + Intronic
1096736614 12:53660463-53660485 AACTCAGAAAATAAGCAGTGGGG + Intronic
1097317713 12:58189778-58189800 TTCTTTAAAAATAAGCAATGAGG - Intergenic
1098192621 12:67966557-67966579 TGCTAACATAATAAGCAATCTGG + Intergenic
1098306190 12:69105166-69105188 AGCTTACAGAATCAGGAATCAGG + Intergenic
1098351253 12:69563438-69563460 AGCTAACAAAATACAAAATGGGG - Intronic
1098506652 12:71260132-71260154 AGCTCACATAAAAAGCAAAGTGG - Intronic
1099199011 12:79653777-79653799 TTCTTAAAAAATAAGCACTGAGG - Intronic
1099407026 12:82276729-82276751 TGCATACAAAATACGAAATGTGG + Intronic
1099994065 12:89757662-89757684 ACTGTCCAAAATAAGCAATGAGG + Intergenic
1100024634 12:90112867-90112889 AGTTTACAACATGTGCAATGTGG + Intergenic
1100107215 12:91190605-91190627 TGTTTACAAAATATGCACTGTGG + Intergenic
1100750427 12:97692575-97692597 ACCTGACAAAACAAGAAATGGGG - Intergenic
1101069398 12:101058127-101058149 ACCTGACAAAAACAGCAATGGGG - Intronic
1102307424 12:111815925-111815947 AGCTTTAAAAATAAGCTATTAGG - Intergenic
1103254155 12:119526139-119526161 AGGTGACAAAACAAGCAATGGGG + Intronic
1105299741 13:19121400-19121422 AGCTAACATCATAATCAATGGGG - Intergenic
1105849598 13:24322386-24322408 AGGTTAGAAAATGAGCAAAGTGG - Exonic
1106093564 13:26621729-26621751 AGCTTTAAAAAGAAGCAGTGTGG + Intronic
1107203889 13:37757086-37757108 ACATTAAAAAATATGCAATGTGG + Intronic
1107232665 13:38129398-38129420 AGTTGACAAAACAAGCAATGAGG - Intergenic
1107397924 13:40037463-40037485 ATTTGACAAAACAAGCAATGAGG - Intergenic
1107615698 13:42164770-42164792 AGCTGAGAAAATAAGCATGGGGG + Intronic
1107856482 13:44620440-44620462 GGCTTACAATCTATGCAATGTGG - Intergenic
1108570760 13:51747829-51747851 ATCTTACAAAAAGAGAAATGTGG - Intronic
1108932403 13:55842842-55842864 AGTTCACAAAATGAGCAAAGTGG + Intergenic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1108987663 13:56613837-56613859 AGTTTACAAAAGAAGTAATTTGG + Intergenic
1109388093 13:61658672-61658694 ACCTCGCAAAACAAGCAATGGGG - Intergenic
1109428367 13:62198636-62198658 TGATTACACAATAAACAATGAGG - Intergenic
1109653528 13:65359650-65359672 AGCTAACATAATACTCAATGGGG + Intergenic
1110071711 13:71186002-71186024 ACCTGACAAAACAAGAAATGGGG + Intergenic
1110476277 13:75917818-75917840 AGATTATAAAATAAACTATGAGG - Intergenic
1110989927 13:82027214-82027236 AGTCACCAAAATAAGCAATGGGG - Intergenic
1111434855 13:88193169-88193191 ACCTGACAAAACAAGAAATGGGG - Intergenic
1111578351 13:90189246-90189268 AGCTTACCAAATACTTAATGTGG - Intergenic
1112134462 13:96561260-96561282 AGTCCACAAAATAAGAAATGGGG + Intronic
1112221205 13:97492826-97492848 AGCTTACAAAATAATAAAGTAGG - Intergenic
1113488551 13:110674441-110674463 ACCTGACAAAAAAAGAAATGGGG + Intronic
1114795184 14:25706546-25706568 AGCTTCTACAATAAGCAATAAGG + Intergenic
1115915325 14:38306027-38306049 AGCTGACAGAGCAAGCAATGGGG + Intergenic
1115947251 14:38676024-38676046 ACCTGACAAAACAAGAAATGGGG + Intergenic
1116354050 14:43905107-43905129 ACCTGACAAAACAAGCACTGGGG - Intergenic
1116395264 14:44440872-44440894 AGTTGACAAAATAAGCAAAGAGG + Intergenic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1117030334 14:51662524-51662546 ACCTGACAAAACAAGCAATGGGG + Intronic
1117640249 14:57790860-57790882 ACCTGACAAAAAATGCAATGGGG + Intronic
1117655888 14:57956166-57956188 ACCTAACAAAACAAGAAATGGGG + Intronic
1117764121 14:59062411-59062433 AGCTAACATTATAATCAATGGGG + Intergenic
1118508106 14:66438233-66438255 AGATTACAAAATAATCTATGTGG - Intergenic
1120563397 14:86024734-86024756 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1122833111 14:104413293-104413315 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1123157629 14:106244170-106244192 ACCTGACAAAACAAGAAATGGGG - Intergenic
1123179406 14:106454272-106454294 GGCTGACAAAACAAGCAATGGGG - Intergenic
1123221149 14:106857128-106857150 ACCTGACAAAAACAGCAATGGGG - Intergenic
1123894566 15:24815727-24815749 AACGTAGAAAATAAGCAAGGGGG - Intergenic
1124290238 15:28446029-28446051 AACCTACAAAACAAGAAATGGGG - Intergenic
1125274170 15:37973041-37973063 AGTTGACAAAACAGGCAATGGGG - Intergenic
1127778873 15:62293932-62293954 AGCTGAGAAAACAAGCAATGGGG + Intergenic
1130219049 15:82002019-82002041 AGCTAACATAATACGGAATGGGG + Intergenic
1131726297 15:95229243-95229265 AGCTCACAAAAATAGAAATGAGG + Intergenic
1132199426 15:99939534-99939556 AGCTAACATCATAAACAATGGGG - Intergenic
1132268510 15:100501944-100501966 AGCTTAGAAAATAAGGCAAGAGG + Intronic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1136708499 16:32211591-32211613 AACCTACAAAACAAGAAATGGGG + Intergenic
1136759405 16:32717821-32717843 AACCTACAAAACAAGAAATGGGG - Intergenic
1136808699 16:33152565-33152587 AACCTACAAAACAAGAAATGGGG + Intergenic
1138951832 16:61921296-61921318 AGCTTACAAATGAAACAATCAGG - Intronic
1139090141 16:63635530-63635552 AAATTAAAAAATAAGAAATGCGG - Intergenic
1140354396 16:74292958-74292980 AGCTTTCAAAATATGCAAATGGG - Intergenic
1140511750 16:75513554-75513576 AGCTTACAGAAGAAACATTGAGG - Intergenic
1140666367 16:77231362-77231384 AGCTTACATTCTAAGAAATGAGG + Intergenic
1140669181 16:77258452-77258474 AGCTAACATCATAAACAATGGGG - Intronic
1203061561 16_KI270728v1_random:978130-978152 AACCTACAAAACAAGAAATGGGG - Intergenic
1142526396 17:544774-544796 ATCTAAGAAAATAAGCAATATGG + Intronic
1143650127 17:8258165-8258187 AGCTGACCACATAAGCAAGGAGG + Exonic
1144383084 17:14722317-14722339 AGCTGACAAAACAAGTAATGGGG + Intergenic
1146622477 17:34409783-34409805 AGCTGACAAAAACAGCAATGGGG + Intergenic
1146743698 17:35309066-35309088 ACCTGATAAAACAAGCAATGGGG + Intergenic
1146765537 17:35517774-35517796 AACTGACAAAACAAACAATGGGG + Intronic
1148549932 17:48544289-48544311 AGCTTCCAAAATCAGCCATAGGG + Intronic
1149235447 17:54584970-54584992 AGCTGAGAAAACAAGCAATAGGG + Intergenic
1150271773 17:63871414-63871436 AGATAACAACGTAAGCAATGAGG - Intergenic
1150275323 17:63894311-63894333 AGATAACAATGTAAGCAATGAGG - Intergenic
1150277450 17:63908999-63909021 AGATAACAACGTAAGCAATGAGG - Intergenic
1150512349 17:65768817-65768839 AGCTAACATCATAATCAATGGGG + Intronic
1150885056 17:69075508-69075530 AACAGACAAAATAAGCAATCGGG - Intergenic
1151507067 17:74535863-74535885 TGGTTCCAAAATAAGCAATTAGG + Intergenic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153701921 18:7702943-7702965 ACCTGACAAAAACAGCAATGGGG - Intronic
1153968917 18:10206905-10206927 AGCTTAAAAAACAAGCAACACGG - Intergenic
1154288144 18:13079901-13079923 ACCTGACAAAAAAAGAAATGGGG - Intronic
1154465407 18:14639032-14639054 AGCTAACATCATAATCAATGGGG + Intergenic
1155021623 18:21902003-21902025 AGCTCACAAAGTAAGGAATTTGG - Intergenic
1155609716 18:27652200-27652222 AGTTTACAAAATTAGCAACTTGG - Intergenic
1155735729 18:29220161-29220183 ACCTGACAAAAAAAGAAATGGGG + Intergenic
1155861636 18:30908981-30909003 AGTTGACAAAAAAAGCAATGGGG + Intergenic
1156163396 18:34387082-34387104 AGCTTGCAAAGTAAGCAAGAAGG + Intergenic
1156402315 18:36750749-36750771 AGCTGACAAAACAAGCAATGGGG - Intronic
1156551015 18:38016805-38016827 ACCTGACAAAACAAGCAATGGGG - Intergenic
1156648811 18:39199977-39199999 AGCTTAAAAAATGGGCAATCAGG - Intergenic
1158078347 18:53559017-53559039 AGTTGATAAAATAAGCAATGAGG + Intergenic
1158095776 18:53768953-53768975 ACCTGACAAAACAAGCAATGGGG + Intergenic
1158831591 18:61285368-61285390 AGCTTACAAAATCAGAAAGTTGG + Intergenic
1159101078 18:63959959-63959981 AGCTTATAAACTAAGCAACGCGG - Intronic
1159739247 18:72144805-72144827 GACTTTCAAAATAAGTAATGAGG + Intergenic
1159823956 18:73182367-73182389 AGCTAACATCATAATCAATGGGG + Intronic
1160522723 18:79517976-79517998 GGCTTAAAGAATAAACAATGTGG - Intronic
1162385886 19:10360519-10360541 AGCCTACAAAGTAAGCAACTAGG + Intronic
1164266029 19:23618377-23618399 ACCTGACAAAAAAAGAAATGGGG + Intronic
1166176067 19:41071197-41071219 AGACAACAAAATGAGCAATGGGG - Intergenic
1166632801 19:44422137-44422159 ACCTGACAAAAAAAGCAATGGGG - Intronic
1168392746 19:56024049-56024071 AGCTTACATTATAAGCTAGGGGG + Intronic
925053793 2:839450-839472 ACCTGACAAAAACAGCAATGGGG + Intergenic
925647356 2:6050024-6050046 AGCTGACAAAAAAAGCAATGGGG + Intergenic
926226398 2:10970082-10970104 TGCATTCAAAATAAGAAATGTGG - Intergenic
926381894 2:12299286-12299308 TGCTTAAAAAATCAGCAATGTGG - Intergenic
926503810 2:13685927-13685949 GGCTTAAAAAATAAGCACTTAGG + Intergenic
926854425 2:17238372-17238394 AGCTTACATAATAACCAGTGGGG - Intergenic
927015501 2:18955949-18955971 ATCTGACCAAAAAAGCAATGGGG + Intergenic
928486898 2:31741427-31741449 ACCTGACAAAACAAGAAATGGGG - Intergenic
928488003 2:31752185-31752207 ACCTGACAAAACAAGAAATGGGG + Intergenic
930270173 2:49247045-49247067 ACCTGACAAAATAAAAAATGGGG + Intergenic
930338502 2:50081580-50081602 AGCTTACAAGATACGAAAAGTGG + Intronic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
930598693 2:53418906-53418928 ATCTGACAAAACAAGCAATGGGG - Intergenic
930789184 2:55306213-55306235 ATCTTACCAAATAAGAAATGGGG - Intronic
930799378 2:55427095-55427117 AGTTTACAAAATATGCAAAATGG - Intergenic
930865048 2:56114404-56114426 AGTTTACACAAAAAGCAATTGGG + Intergenic
930933354 2:56916837-56916859 ACCTGACAAAACAAGCAATGGGG + Intergenic
931153810 2:59604922-59604944 ACCTTACATAATTAGAAATGTGG + Intergenic
931420991 2:62127602-62127624 ACCTGACAAAAAAAGCAATGGGG + Intronic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
933212879 2:79591850-79591872 AGCTTCCAAAATAACAAATCAGG - Intronic
933944253 2:87271252-87271274 ACCTGACAAAACAAGAAATGGGG - Intergenic
935003280 2:99042998-99043020 ATCTTACAAAATAAAGAATGGGG - Intronic
935020706 2:99228283-99228305 ACCTGACAAAACAAGAAATGGGG + Intronic
935172781 2:100623631-100623653 AGCTTAAAAAATCAGAAATTTGG + Intergenic
936335963 2:111590327-111590349 ACCTGACAAAACAAGAAATGGGG + Intergenic
938287833 2:130132335-130132357 AGCTAACATCATAATCAATGGGG - Intergenic
938427759 2:131206536-131206558 AGCTAACATCATAATCAATGGGG + Intronic
938468687 2:131540542-131540564 AGCTAACATCATAATCAATGGGG + Intergenic
938636198 2:133229301-133229323 AGAGAACAAAATAAGAAATGAGG + Intronic
939028352 2:137040742-137040764 AGCTGACCACATAAGCCATGGGG - Intronic
940539870 2:154999380-154999402 AGCTCACAAGGTCAGCAATGAGG + Intergenic
940680983 2:156784540-156784562 AGCTGACAAAATCAGCCAGGGGG + Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
942362921 2:175191605-175191627 ACCTGACAAAATAAGAAATGGGG + Intergenic
943052639 2:182934799-182934821 AACTTACAAGAAAAGGAATGTGG + Exonic
943232406 2:185271614-185271636 ACCTGACAAAACAAGCAATGGGG - Intergenic
943557541 2:189424217-189424239 AGCTAACAGAATATTCAATGGGG + Intergenic
945461300 2:210112221-210112243 ACCTAACAAAAACAGCAATGGGG + Intronic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
946019178 2:216628557-216628579 AGTTGAGAAAATAAGCAATGGGG - Intergenic
946643445 2:221808409-221808431 AGCCCACAAAATAGGAAATGAGG + Intergenic
947161276 2:227217376-227217398 TGCTTACAAAAGGAGCAAGGTGG - Intronic
947688204 2:232109603-232109625 ACCTGACAAAATAAGCAAGGGGG + Intronic
947978649 2:234388975-234388997 ACCTGACAAAACAAGCAACGGGG + Intergenic
1169037703 20:2467262-2467284 AGCTTTACAAATAGGCAATGAGG + Exonic
1169678193 20:8178898-8178920 AGTCGACAAAACAAGCAATGGGG - Intronic
1170228933 20:14023665-14023687 ACCTGACTAAACAAGCAATGGGG - Intronic
1173055635 20:39609801-39609823 ACCTGACAAAACACGCAATGGGG + Intergenic
1175556310 20:59860236-59860258 AGCTTACATAATACTCAATGGGG - Intergenic
1176809134 21:13519372-13519394 AGCTAACATCATAATCAATGGGG - Intergenic
1176897613 21:14400706-14400728 AGTTTACAACATAAGAAATCTGG - Intergenic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1177058431 21:16339019-16339041 AGCTGACAAAATAATCATAGTGG - Intergenic
1177388575 21:20438090-20438112 AACTGACAAAAAAAGCTATGGGG + Intergenic
1177463795 21:21447276-21447298 ACCTGACAAAACAAGCAATGGGG + Intronic
1177544579 21:22539908-22539930 GGTTGACAAAAAAAGCAATGAGG + Intergenic
1177574417 21:22932671-22932693 AATCAACAAAATAAGCAATGGGG - Intergenic
1177951361 21:27542079-27542101 ATCTGACAAAACAAGTAATGGGG + Intergenic
1178060223 21:28845381-28845403 AGCTAAGAAAATATGCAAAGGGG - Intergenic
1178345680 21:31826016-31826038 AGCTTAAAAATTACACAATGTGG + Intergenic
1179121775 21:38553559-38553581 AGTAGACAAAACAAGCAATGTGG + Intronic
1179334596 21:40438674-40438696 TGCTAACAACATAAGGAATGAGG + Intronic
1182761742 22:32727966-32727988 ACCTGACCAAACAAGCAATGGGG + Intronic
1183378647 22:37479637-37479659 AGCTTACACAATATGCAACTTGG - Intronic
1184900192 22:47441812-47441834 AGCTTACAAAATACAGGATGGGG + Intergenic
949432773 3:3995601-3995623 ACCTGACAAAACAAGCAATGAGG - Intronic
949627163 3:5879888-5879910 GGCTTAAAAAATAAGCATTTGGG + Intergenic
949889557 3:8723683-8723705 AGCTTGCAAACTGAGCAAGGAGG - Intronic
951070411 3:18321753-18321775 AGCTGATAAAACAAGCAATGAGG - Intronic
951197670 3:19842169-19842191 ACCTGACAAAACAAGTAATGGGG - Intergenic
951263365 3:20538893-20538915 AGCTTACAATATATACAATCTGG + Intergenic
952010010 3:28889874-28889896 ACCTGACAAAAAAAGCAATGGGG - Intergenic
952153994 3:30623327-30623349 TACTTACAAATTAAGCAGTGAGG - Intronic
952290165 3:32007535-32007557 AGGTTACAAGCTAAGAAATGTGG - Intronic
952522235 3:34173086-34173108 ACCTGACAAAACAAGCAATGGGG - Intergenic
952998994 3:38913758-38913780 AGCTGACAAAACAAGCAATGAGG - Intronic
953116620 3:39998903-39998925 ACCTGACAAAACAAGCAATGGGG + Intronic
953721450 3:45358896-45358918 AGTTGACAAAACAAGCAATGGGG - Intergenic
954525460 3:51266554-51266576 ACCTGACAAAAGAAGCAATGGGG + Intronic
955854683 3:63260446-63260468 ACCTGACAAAACAAGAAATGGGG + Intronic
957107869 3:75913720-75913742 AGCTTCACAAATAAGCAATATGG - Intronic
957721855 3:84012473-84012495 ACCTGACAAAATAAGAAATGGGG + Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
959119876 3:102220684-102220706 ACCTGACAAAACAAGCAACGGGG - Intronic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
959947662 3:112144013-112144035 AGTTGACAATACAAGCAATGGGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960343273 3:116501306-116501328 AACTGAAAAAACAAGCAATGGGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
963148394 3:142018242-142018264 AGCTAATAAAATAAACATTGAGG - Intronic
963180770 3:142353559-142353581 AGACAACAAAACAAGCAATGGGG + Intronic
963381859 3:144540676-144540698 AATTGACAAAATAAGCAATGGGG + Intergenic
963387507 3:144615873-144615895 ACCTCAAAAAACAAGCAATGGGG - Intergenic
963694251 3:148544837-148544859 ACCTGACAAAAAAAGCAATGAGG + Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
964448092 3:156781682-156781704 GGCTTAAAACAGAAGCAATGAGG + Intergenic
964780063 3:160327553-160327575 ACCTGACAAAACAAGCAATGAGG + Intronic
965808563 3:172568198-172568220 AGCTGACAAAACAAGCAATGGGG - Intergenic
966016733 3:175148707-175148729 AGTCAATAAAATAAGCAATGGGG - Intronic
966291612 3:178366007-178366029 ACCTGACAAAACAAGAAATGGGG + Intergenic
966357602 3:179097916-179097938 AACTTAAAAAATAATAAATGGGG - Intergenic
966574374 3:181483155-181483177 AGCTTACAAAATAGGTAAAGTGG - Intergenic
970012652 4:11476846-11476868 AGCTGACAAAACAAACAATGAGG + Intergenic
970210003 4:13699631-13699653 AGCTGACAAAATAAGCAATGGGG - Intergenic
970379916 4:15496485-15496507 AGCTTACAATAACAGCAATGGGG - Intronic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
971471098 4:27028006-27028028 CGTTTACAGAATAAGAAATGTGG + Intergenic
971693936 4:29873474-29873496 ACCTGACAAAAGAAGAAATGGGG - Intergenic
971815243 4:31478422-31478444 GGCTGACAAAAAAAGCAATGGGG - Intergenic
971863884 4:32143716-32143738 ACCTGAAAAAACAAGCAATGAGG - Intergenic
972219751 4:36940465-36940487 ACCTGACAAAACAAGCAATGAGG + Intergenic
973015455 4:45132154-45132176 AAATTACCAAATAAGCAAAGAGG - Intergenic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
973938389 4:55876241-55876263 ATCTTCCAAAAGAATCAATGAGG - Intronic
974306429 4:60148172-60148194 AGTTTTCAAAATGAACAATGTGG - Intergenic
974430867 4:61793773-61793795 AGTTTATAAAAAAAGCAATAGGG - Intronic
974539414 4:63214767-63214789 ATATGACAAAACAAGCAATGGGG - Intergenic
974562879 4:63544392-63544414 AGTTGAAAAAATAAGCAATGAGG + Intergenic
974565573 4:63575634-63575656 AGATTACTAAATTAGCCATGAGG - Intergenic
975007150 4:69304215-69304237 ACCATACAAAACAAGAAATGGGG + Intronic
975483734 4:74911458-74911480 ACCTGACAAAAAAAACAATGGGG - Intergenic
975513181 4:75216271-75216293 ACCTGACAAAACAAGCAATAGGG - Intergenic
976262306 4:83157399-83157421 AGCAGTCAAAATAAGCAATAAGG - Intergenic
978117087 4:105032529-105032551 ACCTGACAAAACAAGAAATGGGG + Intergenic
978544283 4:109853851-109853873 ACCTGACAAAACAAGCAATGGGG - Intronic
978657291 4:111079425-111079447 ACCTGACAAAACAAGCAATAGGG + Intergenic
978744632 4:112178470-112178492 AGCAGACAAAACAAGCAATGGGG - Intronic
979998266 4:127459385-127459407 ACCTGACAAAAGAAGCAATGGGG - Intergenic
980198612 4:129624954-129624976 ACCTGACAAAACAAGAAATGGGG - Intergenic
980328963 4:131386550-131386572 AGCTGACAAAAACAACAATGGGG - Intergenic
980688036 4:136255759-136255781 ACCTGACAAAACAAACAATGGGG + Intergenic
980854326 4:138421308-138421330 ACCTTACAAAATAAGGAAGTGGG + Intergenic
981302280 4:143201256-143201278 AGCTGTCAAAACAAGCAATGGGG + Intronic
981372451 4:143974497-143974519 AGCCTACAGAGTAAGCAATGTGG - Intergenic
982143776 4:152359298-152359320 AGGTGACAAGATAAGAAATGAGG + Intronic
982387178 4:154821368-154821390 AGCTCACTAAATAAACCATGTGG - Intronic
982552223 4:156817348-156817370 AATTTACAAAATTAGCAATGAGG + Intronic
982774057 4:159424245-159424267 AGATTAAAAAATAGGCTATGAGG + Intergenic
982810522 4:159820266-159820288 ACCTGCCAAAACAAGCAATGGGG + Intergenic
982851590 4:160323628-160323650 AGCTTTCAACATATGCATTGTGG - Intergenic
983018252 4:162641496-162641518 GGATTAGAAAATTAGCAATGAGG + Intergenic
983018857 4:162649323-162649345 AGCTGACAAAACAAACAATGGGG - Intergenic
983441557 4:167793061-167793083 AGTTGACAAAACAAGCAATGGGG - Intergenic
983958454 4:173724068-173724090 ACCTGACAAAACAAGCAACGGGG - Intergenic
984054901 4:174915722-174915744 AGGTTAAAAACTAAACAATGGGG - Intronic
984372433 4:178884376-178884398 AGCTTACAATGTAAACAAAGTGG + Intergenic
984460439 4:180029691-180029713 AGCTCAAAATATAGGCAATGTGG + Intergenic
986261279 5:6148774-6148796 TGCTTAGAAAATAAGCAACATGG - Intergenic
986409786 5:7465802-7465824 AGCTTAGAATATATGTAATGGGG + Intronic
987019741 5:13857738-13857760 ACCTGACAAAACAAGCAATAGGG + Intronic
987260848 5:16201295-16201317 ATTTGACAAAACAAGCAATGGGG + Intergenic
987608573 5:20171987-20172009 AGCTTACAAAATAAGCAATGAGG - Intronic
987682546 5:21156478-21156500 AGATTTGAAATTAAGCAATGTGG - Intergenic
987975832 5:25013903-25013925 ATCTGACAAAAACAGCAATGGGG + Intergenic
988063926 5:26210176-26210198 AGTTGACAAAATAAGCAATGGGG + Intergenic
988352671 5:30131629-30131651 ACCTGACAAAAAAAGCAATGGGG - Intergenic
988675558 5:33429343-33429365 ACCTGAAAAAACAAGCAATGAGG - Intergenic
989545891 5:42672494-42672516 AGATGACAAAATTAGCAATGGGG + Intronic
989656968 5:43754979-43755001 ACTTGACAAAATCAGCAATGGGG - Intergenic
989848055 5:46171277-46171299 ACCTGACAAAACAAGAAATGGGG + Intergenic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990138628 5:52677916-52677938 ACCTGACAAAAAAAGCAATGGGG - Intergenic
992114427 5:73525896-73525918 TGCTTATAAAATATGCAGTGAGG + Intergenic
992853870 5:80840281-80840303 ACCTGACAAAACAAGCAATGGGG + Intronic
992854077 5:80842170-80842192 ACCTGACAAAACAAGCAATGGGG - Intronic
993023226 5:82617055-82617077 ACCTGACAAAACAAGAAATGGGG + Intergenic
993081080 5:83301840-83301862 ACCTGAAAAAACAAGCAATGGGG - Intronic
993358789 5:86947285-86947307 AGCTTCCACAAGAAGCCATGGGG - Intergenic
994174704 5:96698966-96698988 TGCTTACAAAATGAGGAATTGGG + Intronic
994479053 5:100310019-100310041 ACCTAACAAAACAATCAATGGGG + Intergenic
995586142 5:113650673-113650695 ACCTGACAAAAAAAGAAATGGGG + Intergenic
996178031 5:120384078-120384100 AACTTACACTAAAAGCAATGGGG - Intergenic
996411110 5:123160437-123160459 AGCTCACAAATTAGTCAATGTGG - Intronic
996426201 5:123315789-123315811 ACCTGACAAAATAAGTCATGGGG - Intergenic
997188485 5:131905756-131905778 ATCTACCAAAACAAGCAATGGGG + Intronic
998331793 5:141334272-141334294 TGAATCCAAAATAAGCAATGAGG + Intronic
998718538 5:144914446-144914468 AGTTTACAAACAAAGCAATTAGG - Intergenic
998899582 5:146838641-146838663 AGCATACAAAAAGAGGAATGAGG + Intronic
1000571656 5:162922487-162922509 AGCATAGAAAATAAGAAACGTGG - Intergenic
1001899268 5:175410515-175410537 AGCTTAAAAAACAATCAATATGG - Intergenic
1002257563 5:177969267-177969289 AGCTAACATCATAATCAATGGGG + Intergenic
1004586007 6:17001023-17001045 AACTTGCTAAGTAAGCAATGGGG - Intergenic
1004922012 6:20384590-20384612 AATTTTCAAAATAAGCAATGAGG - Intergenic
1006207033 6:32355801-32355823 AACTTATAAATTAAGCCATGAGG - Intronic
1006712620 6:36088003-36088025 ACCTGACAAAACGAGCAATGGGG + Intronic
1007349865 6:41263232-41263254 ATCTTCCAAAAAAATCAATGAGG + Intergenic
1009161899 6:60293185-60293207 CACCTACAAAACAAGCAATGGGG - Intergenic
1009719905 6:67455276-67455298 AGCTCACAAAAGAATCACTGTGG + Intergenic
1009986487 6:70787175-70787197 ACCTGACAAAAGGAGCAATGGGG + Intronic
1010321557 6:74515986-74516008 ATTTGACAAAACAAGCAATGGGG - Intergenic
1010551204 6:77223968-77223990 AACTTACAAAGTAAGAAAAGAGG + Intergenic
1010556070 6:77281340-77281362 ACCTGACAAAACAAGCAATGGGG + Intergenic
1011123028 6:83975690-83975712 AGTTTGCAAAAAAAACAATGAGG - Intergenic
1011174446 6:84544503-84544525 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1011830834 6:91369468-91369490 ACCTGACAAAACAAGCAATGGGG - Intergenic
1012388714 6:98711498-98711520 AGCTTCCAAAATTAGCAGGGAGG + Intergenic
1012432781 6:99183651-99183673 AACTTACTAAATATGCAAGGAGG + Intergenic
1012591859 6:100991739-100991761 ACCTGACAAAAACAGCAATGGGG - Intergenic
1012613079 6:101240217-101240239 AAATTACAAAATATGCTATGAGG + Intergenic
1012719980 6:102728712-102728734 ACCCGACAAAACAAGCAATGGGG - Intergenic
1012830990 6:104203212-104203234 ACCTGACAAAACAAACAATGGGG + Intergenic
1012901162 6:105008095-105008117 AGCTCACAGATTTAGCAATGTGG - Intronic
1013390750 6:109684124-109684146 ACCTGACACAAAAAGCAATGGGG + Intronic
1013402091 6:109807872-109807894 ATCTGACAAAACAAGCAATGGGG - Intronic
1014533337 6:122587006-122587028 AACAAACTAAATAAGCAATGTGG + Intronic
1014796747 6:125733786-125733808 AGGTTTCAAAATGAACAATGAGG + Intergenic
1014880120 6:126713316-126713338 AGCTTACAAACTGATCAGTGGGG - Intergenic
1015000128 6:128204150-128204172 ACCTGAAAAAACAAGCAATGGGG + Intronic
1015725405 6:136294450-136294472 TTCTTTTAAAATAAGCAATGAGG - Intergenic
1016226176 6:141741224-141741246 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1016612834 6:146011818-146011840 AGCTGACAAAAGAAGCAATGGGG - Intergenic
1016831278 6:148436010-148436032 AGTTTTCAAAATGAGGAATGGGG - Intronic
1017211970 6:151866991-151867013 ACCTGACAAAACAAGCAATGGGG + Intronic
1017662642 6:156688642-156688664 ATATAATAAAATAAGCAATGTGG + Intergenic
1019098298 6:169605833-169605855 AGCTGACAAAATCAACAATGGGG + Intronic
1019116206 6:169764570-169764592 AGCTTAGAAAATAATCAGTGGGG - Intronic
1020614940 7:10447481-10447503 ACCTGACAAAACAAGCAGTGGGG + Intergenic
1020744185 7:12060542-12060564 AGCTAACATCATAAGCAATGGGG + Intergenic
1021294344 7:18886027-18886049 AGCTAACAAAAAAAGCAACATGG + Intronic
1021334192 7:19378189-19378211 AGGTTAAAAAAAAAGCAAGGGGG - Intergenic
1021605876 7:22409177-22409199 AGCAAACAAAATAAACAATCTGG + Intergenic
1021870125 7:24997531-24997553 ACCTGACAAAACAAGCAATGGGG - Intergenic
1022287173 7:28964794-28964816 AGCTTAACAGATAAGCAATTCGG + Intergenic
1022346752 7:29523953-29523975 AGCTAACAACATACTCAATGGGG + Intergenic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1022885334 7:34637729-34637751 ACCTGACAAAACAAGCAATGAGG + Intergenic
1023697262 7:42860401-42860423 ACCTGACAAAAACAGCAATGGGG - Intergenic
1024353012 7:48386611-48386633 AACCTAAAAAACAAGCAATGGGG + Intronic
1024912773 7:54465113-54465135 ATCTTAAACAGTAAGCAATGGGG - Intergenic
1024925894 7:54615269-54615291 AGCTTCCCAAATAAATAATGTGG - Intergenic
1025784186 7:64629185-64629207 ACCTAAAAAAACAAGCAATGGGG + Intergenic
1026934701 7:74247217-74247239 AGCTTACAAGATAACAAAGGTGG - Intronic
1027389947 7:77694892-77694914 AGCTTAAAAGATAAGGAATGTGG - Intergenic
1027389953 7:77694928-77694950 TGCTTCGAAAATAAGCAATTTGG - Intergenic
1027949473 7:84796016-84796038 AATTGACAAAACAAGCAATGGGG - Intergenic
1028080732 7:86572054-86572076 ACCTGAAAAAATAAGCAATAGGG + Intergenic
1028767200 7:94572994-94573016 AGCTGACAAAACATGCAATGGGG - Intergenic
1029035439 7:97515474-97515496 TACTTACAGAAAAAGCAATGAGG - Intergenic
1029035807 7:97520135-97520157 ACCTTACAAATTAAGAAATTGGG - Intergenic
1030390820 7:108926295-108926317 ATCTGACAAAACAAGCAATGGGG - Intergenic
1030806545 7:113927152-113927174 AGCAGACAAAACAAGCAAGGGGG - Intronic
1031179132 7:118392850-118392872 ACCTGACAAAACAAGCAATGGGG + Intergenic
1031192310 7:118569152-118569174 AGCTTACAAAATATTCCTTGAGG + Intergenic
1031270684 7:119645351-119645373 ACGTGACAAAATAAGAAATGGGG - Intergenic
1032769445 7:135034949-135034971 AGTTTACTAAATAAGCACAGAGG - Intronic
1032879400 7:136073114-136073136 AGATTACAAAATATGCATTTGGG - Intergenic
1033565351 7:142573248-142573270 ACCTGACAAAACAAGCAATGGGG + Intergenic
1033873068 7:145781181-145781203 ACCTGAGAAAATAAGCAACGGGG - Intergenic
1033931598 7:146530106-146530128 GTCTTCCAAAATAAGCAATGGGG + Intronic
1033957408 7:146868282-146868304 AGATGACAAAACAAGCAATGAGG - Intronic
1033988080 7:147250794-147250816 GACTTACAAAATCAGCAATGAGG + Intronic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035558368 8:585041-585063 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1035667706 8:1391243-1391265 AGCTTCCAAACTAGGCAATGGGG + Intergenic
1036006305 8:4668034-4668056 ATGTTACAAAATAAGAGATGAGG - Intronic
1036109593 8:5883235-5883257 ACCTGACAAAACAAGCACTGGGG - Intergenic
1036113957 8:5937501-5937523 ACCTGACAAAACAAGCAATGGGG + Intergenic
1038095704 8:24307421-24307443 AGCTGAAATATTAAGCAATGTGG - Intronic
1039371022 8:36983989-36984011 ATTTTACATAATAAGAAATGGGG - Intergenic
1039528005 8:38233118-38233140 ATCTTACAATAAAACCAATGGGG - Exonic
1040608115 8:48955166-48955188 ACCTGACAAAACAAGAAATGGGG - Intergenic
1041837999 8:62238779-62238801 ACCTGACAAAACAAGCAACGGGG - Intergenic
1041876427 8:62692594-62692616 AGTTTCCAGAATAAGAAATGGGG - Intronic
1042220607 8:66469581-66469603 AGTTTATAAAATAAAAAATGAGG - Intronic
1042743065 8:72073343-72073365 AACTTACAAGATGAGAAATGTGG - Intronic
1042758803 8:72249162-72249184 AACTTACAAGATGAGAAATGTGG - Intergenic
1043170740 8:76962821-76962843 TACTTACCAAATAAGCACTGTGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043386137 8:79749510-79749532 AGCTAACATCATAATCAATGAGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1043730810 8:83678070-83678092 ATATGACAAAACAAGCAATGGGG + Intergenic
1044272271 8:90260210-90260232 AAATGACAAAACAAGCAATGGGG + Intergenic
1044349965 8:91152393-91152415 ACCTGACAAAACAAGCAATGGGG - Intronic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1044835489 8:96291666-96291688 ACCCTATAGAATAAGCAATGTGG - Intronic
1045389186 8:101698657-101698679 ACCTCACAAAACAAGTAATGGGG + Intronic
1045610033 8:103828831-103828853 AGTTGACAAAGAAAGCAATGGGG - Intronic
1045742693 8:105380265-105380287 AGCCTACAATATAAGTAAAGTGG + Intronic
1046285370 8:112086678-112086700 ACCTGACAAAAAAAGCAATGCGG + Intergenic
1046355081 8:113072405-113072427 AGCTAACATCATAATCAATGGGG - Intronic
1046410061 8:113830387-113830409 AGTTTGCAAAATCTGCAATGTGG - Intergenic
1048129729 8:131681477-131681499 GGCTTACAAACTTAGCCATGAGG + Intergenic
1050689260 9:8206910-8206932 AACTTACAGATTGAGCAATGCGG - Intergenic
1050838338 9:10112921-10112943 AGCTTTAAAAATAAGCCATGTGG - Intronic
1051524281 9:18025517-18025539 AGTTAGCAAAATAGGCAATGGGG - Intergenic
1051667393 9:19477859-19477881 AGCATACAAAAAAAGGACTGTGG - Intergenic
1051763478 9:20496359-20496381 TGATTACAATATAAACAATGGGG - Intronic
1051962171 9:22780068-22780090 TGCTGACAAAACAAGCAATGGGG - Intergenic
1052047678 9:23813462-23813484 AGCTCACAACATCAGCAATGAGG + Intronic
1054981076 9:71206850-71206872 ATTTTGCAAAACAAGCAATGGGG - Intronic
1055020820 9:71667793-71667815 GGCTTACATAATTAGCAATCAGG + Intergenic
1055162850 9:73152553-73152575 AGCCTACAAGAAAAGGAATGTGG - Intronic
1055378229 9:75674558-75674580 AGCTCACATTATAATCAATGGGG - Intergenic
1055489382 9:76789313-76789335 ATTTTACAAAAGAAGAAATGGGG + Intronic
1055540438 9:77299024-77299046 ACCTGAAAAAACAAGCAATGGGG - Intronic
1056158356 9:83862440-83862462 ACCTGACAAAACAAGAAATGGGG - Intronic
1058327089 9:103711963-103711985 AGATGACAAAAAGAGCAATGGGG - Intergenic
1058549289 9:106096611-106096633 ACCTGACAAAACAAGCAATGGGG + Intergenic
1058926661 9:109671368-109671390 ACCTGACAAAACAAGCAATAAGG - Intronic
1059078689 9:111223648-111223670 ACCTGACAAAACAAGCAATGGGG - Intergenic
1059745763 9:117199387-117199409 AACTGACAAAAAAAGGAATGGGG - Intronic
1059808234 9:117827714-117827736 ATCTTAACAAATAAGCAACGGGG + Intergenic
1060240902 9:121902232-121902254 AGCTTTCAAAATAACAAATACGG - Intronic
1060293628 9:122327821-122327843 AGCTTAAAAATCAAGAAATGGGG - Intergenic
1061318641 9:129814166-129814188 AGGGAACAAAATAATCAATGAGG + Exonic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1061648839 9:132029664-132029686 AGGTTACAAAATAGGGAAGGAGG + Intronic
1185641414 X:1590748-1590770 TGATTACAAAATAATAAATGAGG - Intergenic
1185812433 X:3123157-3123179 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1186581112 X:10819830-10819852 ATGTTACAAAATAAGCCATCTGG - Intronic
1188151757 X:26685033-26685055 AGCTTACATTATATGCAATGAGG + Intergenic
1188159911 X:26786434-26786456 AGGTTACAGAATAACCAACGAGG + Intergenic
1188586350 X:31780328-31780350 AACTTACAAAATAAGTTATTGGG + Intronic
1188645088 X:32555704-32555726 ACCTGAAAAAACAAGCAATGGGG + Intronic
1188771037 X:34154806-34154828 AGCAGACAAAACAAACAATGAGG - Intergenic
1188796787 X:34476801-34476823 AGCAGACAAAACAAGCAATGAGG - Intergenic
1188930959 X:36110377-36110399 AATTGACAAAAAAAGCAATGGGG - Intronic
1190624542 X:52324262-52324284 TGACTACAAAATAAGCTATGAGG - Intergenic
1190880508 X:54488775-54488797 AGTTGACAAAAGAAGCAATAGGG + Intronic
1191099191 X:56706689-56706711 ACCTGACAAAACAAGCAATAGGG - Intergenic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1191628290 X:63292347-63292369 TGCACACAAATTAAGCAATGTGG + Intergenic
1191701729 X:64049142-64049164 ACCTGACAAAACAAGCAATGGGG + Intergenic
1191701887 X:64051220-64051242 AGCTAACATTATAATCAATGGGG + Intergenic
1191831939 X:65424731-65424753 ACCTGACAAAAAAAGCAATGGGG - Intronic
1192593440 X:72381816-72381838 AGCAAAGAAAATAAGAAATGAGG + Intronic
1192714112 X:73620964-73620986 ACCTGAAAAAATAAGCAATGGGG - Intronic
1192957666 X:76090507-76090529 ACCTGACAAAACAAGCAATGGGG - Intergenic
1192964628 X:76164186-76164208 ATCTGACAAAACAAGCAACGGGG + Intergenic
1193018470 X:76762638-76762660 AGCTAACATAATAAGAAATGGGG + Intergenic
1193035102 X:76941371-76941393 ACTATACAAAAAAAGCAATGGGG + Intergenic
1193045133 X:77045769-77045791 AGCTAACATCATAATCAATGAGG + Intergenic
1193199370 X:78670024-78670046 GCCTGACAAAACAAGCAATGGGG + Intergenic
1193270380 X:79522478-79522500 AGTCTACAAGAAAAGCAATGGGG + Intergenic
1193309884 X:79993793-79993815 AGCTAACAATATATTCAATGAGG + Intergenic
1193318809 X:80096350-80096372 CCCTGACAAAAAAAGCAATGGGG + Intergenic
1193367775 X:80655443-80655465 ACCTGACAAAACAAGCAATGGGG + Intergenic
1193598381 X:83477153-83477175 AGTCAATAAAATAAGCAATGAGG + Intergenic
1193634164 X:83927626-83927648 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1193748896 X:85318634-85318656 ATCTACAAAAATAAGCAATGGGG - Intronic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1194485137 X:94477261-94477283 GACTTGAAAAATAAGCAATGGGG + Intergenic
1194551064 X:95300122-95300144 ACCTGACAAAACAAGCAATGGGG + Intergenic
1195098458 X:101529209-101529231 ACCTGACAAAACAAGCAATGGGG + Intronic
1195582535 X:106523893-106523915 AGCTAACATCATAATCAATGGGG - Intergenic
1196367320 X:114938227-114938249 ACCTGACAAAACAAGCAATGGGG - Intergenic
1196584477 X:117413893-117413915 AACTAACAAAAAAAGCAATGGGG + Intergenic
1196767046 X:119255859-119255881 AGCTTAAAAAATAAAAAATTAGG - Intergenic
1196870999 X:120113613-120113635 AACTTAAAAAATTAGCCATGTGG - Intronic
1196971756 X:121117109-121117131 TTCTTACATAAGAAGCAATGAGG + Intergenic
1197298421 X:124748476-124748498 AACTTACAAAATAAATGATGAGG + Intronic
1197512040 X:127381610-127381632 AGTTTACAAAACAAGCAATGTGG - Intergenic
1197532977 X:127653503-127653525 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1197566750 X:128097501-128097523 AGCTAACATTATAAGTAATGGGG - Intergenic
1197680583 X:129379951-129379973 AGTTGACAAAATAAGCAATGGGG + Intergenic
1198222729 X:134617436-134617458 AGCTAACATCATAATCAATGGGG - Intronic
1198375086 X:136031004-136031026 AGCTAACAAAATTAGCATTTAGG - Intronic
1198885042 X:141326441-141326463 AGCTAACATTATAATCAATGAGG + Intergenic
1199235071 X:145482862-145482884 TCCCTTCAAAATAAGCAATGAGG - Intergenic
1199254613 X:145704935-145704957 ACCTGACAAAACAAGAAATGGGG + Intergenic
1199300750 X:146211041-146211063 AGTTGACAAAACAAGCAACGAGG - Intergenic
1199387917 X:147244832-147244854 ACCTGACAAAAACAGCAATGGGG + Intergenic
1200370368 X:155718872-155718894 AAGTTATAAAATAAGCAATGAGG + Intergenic
1200390289 X:155938189-155938211 AGGAGACAAAAAAAGCAATGGGG - Intronic
1200885865 Y:8268960-8268982 ACCTGACAAAACAAGCAATGGGG + Intergenic
1201946740 Y:19518750-19518772 ATCTTACAAAAAAAGCAATGGGG + Intergenic
1202084783 Y:21124790-21124812 ACCTGACAAAATAAGAAATGGGG - Intergenic
1202190598 Y:22239783-22239805 ACCTTACAAGCAAAGCAATGTGG - Intergenic