ID: 987612155

View in Genome Browser
Species Human (GRCh38)
Location 5:20219798-20219820
Sequence CCTCAAAAACTGAATATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987612153_987612155 -5 Left 987612153 5:20219780-20219802 CCTTCATGATAAAAAAATCCTCA 0: 2
1: 2
2: 13
3: 81
4: 483
Right 987612155 5:20219798-20219820 CCTCAAAAACTGAATATAGAAGG No data
987612152_987612155 -4 Left 987612152 5:20219779-20219801 CCCTTCATGATAAAAAAATCCTC 0: 2
1: 2
2: 28
3: 107
4: 580
Right 987612155 5:20219798-20219820 CCTCAAAAACTGAATATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987612155 Original CRISPR CCTCAAAAACTGAATATAGA AGG Intronic
No off target data available for this crispr