ID: 987616003

View in Genome Browser
Species Human (GRCh38)
Location 5:20275877-20275899
Sequence AGGGAGAGTGCAGTGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 1, 2: 22, 3: 126, 4: 507}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987616003 Original CRISPR AGGGAGAGTGCAGTGATTTG GGG Intronic
901282747 1:8051924-8051946 GGGGAAAGTGCAGTGAGGTGAGG - Intergenic
901753612 1:11427472-11427494 AGGGAGGGTGCAGGGTGTTGAGG + Intergenic
903049449 1:20589779-20589801 AGGAAGAGAGCAGGGCTTTGGGG - Intronic
903139218 1:21328693-21328715 ATGGAGGTTGCAGTGAGTTGAGG + Intronic
903769132 1:25753114-25753136 AGGGAGAAAGCAGTGAGGTGCGG - Intronic
904421687 1:30398355-30398377 AAGGAGAGTGAAGTGACCTGGGG + Intergenic
905120882 1:35681008-35681030 AGACAGATTGCAGTGATTTGGGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906181248 1:43821550-43821572 AAGCAGAGAGCAGTGACTTGAGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907023635 1:51094212-51094234 AGGAAAAGTGTAGTGATTTTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908918094 1:69156972-69156994 TGTTAGAGTGCAGTTATTTGTGG + Intergenic
909146501 1:71940068-71940090 AGGGGGAGTTCAGTGAAGTGAGG + Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910223898 1:84917017-84917039 AGGGAGAGTGAACTGATGGGAGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
911393186 1:97271736-97271758 AAGGAGAATGCAGCTATTTGAGG - Intronic
911669178 1:100588843-100588865 AGGGAGAGTGAACAGAGTTGAGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912258019 1:108080893-108080915 AGACAGAGTGAAGTGAGTTGAGG - Intergenic
912519605 1:110236029-110236051 AGGGAGAGGGGAGTATTTTGGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913659824 1:120996836-120996858 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914011181 1:143779974-143779996 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914166653 1:145181162-145181184 AGAGAGAGAGAAGTGACTTGTGG - Intergenic
914649804 1:149688613-149688635 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915655191 1:157353475-157353497 AGTTAGACTGCAGTGTTTTGTGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915931710 1:160064829-160064851 AGGGAGAATGCAGTGCTAAGAGG + Intronic
916682858 1:167120149-167120171 AGGTAGAGAGTAGTGCTTTGGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917632752 1:176905967-176905989 AGGAAGAGACCAGTGATGTGAGG + Intronic
917855087 1:179093110-179093132 GAGGAGAGTGCAGTGAGGTGGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918377930 1:183927907-183927929 AGGGAAAGTTTAGAGATTTGCGG + Exonic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
920432293 1:205926756-205926778 AGGTCGAATGCAGAGATTTGGGG - Intronic
921032910 1:211349717-211349739 AGGGAGAGTGCAGAGTGTAGTGG + Intronic
921270966 1:213469517-213469539 AGGGAGGGAGCCCTGATTTGTGG + Intergenic
921621170 1:217328056-217328078 AAGGAGATTGCAGTCATATGCGG + Intergenic
921713386 1:218395074-218395096 AGGAAAAGTGCAGTCATTTCTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922195915 1:223360432-223360454 AGGAAGAGTGCCCTCATTTGGGG - Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922531565 1:226349134-226349156 TGGGAGAGGACAGTGCTTTGTGG + Intergenic
923113654 1:230913972-230913994 ATGGAGAGGGGAGAGATTTGTGG + Intronic
923613206 1:235513549-235513571 AGGGAGAGTACTGTGAGTTGAGG + Intergenic
924244838 1:242074159-242074181 ACGGAGTTTGCAGTGAGTTGAGG - Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924560887 1:245155879-245155901 AGGGGGAGGGCTGTGATTTCAGG - Intronic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1064339800 10:14475701-14475723 TGGGAGGGTGCAGTGGTTTCAGG - Intergenic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065224174 10:23525895-23525917 AGGAAGATTGCAATGATTTTTGG + Intergenic
1065471579 10:26087230-26087252 AAGAAGAGTGTAGTAATTTGGGG - Intronic
1065729720 10:28699848-28699870 CCGGAGTTTGCAGTGATTTGAGG + Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067528897 10:47056101-47056123 AGGTAGGCTGCAGTGCTTTGGGG - Intergenic
1068169815 10:53378705-53378727 ACGGAGAGTGGAGTGATGTGGGG + Intergenic
1068665495 10:59671080-59671102 AGGGAGGGTACAGTCATTTGTGG + Intronic
1068682356 10:59833934-59833956 CGGGAGAGAGCACTGGTTTGGGG - Intronic
1068840861 10:61612430-61612452 AGGGAGAGTGTTGTTATTAGAGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069169896 10:65213642-65213664 AGCGTGAGTGAAGTGGTTTGAGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071717620 10:88113235-88113257 AGGGAGAGGGGAGGGATTTGAGG + Intergenic
1071761969 10:88617954-88617976 AGGGAGAGTGCTGTTATCTTTGG - Intergenic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072621017 10:97079268-97079290 ATGGGGGGTGCAGGGATTTGTGG + Intronic
1072622223 10:97087627-97087649 AGGCAGAGAGCCGTGCTTTGAGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1074147995 10:110733496-110733518 AGGAGGCATGCAGTGATTTGTGG + Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076633528 10:131867732-131867754 AGGGAGAGCGGAGTGGTTTGTGG + Intergenic
1076777668 10:132707042-132707064 ACGGAGAGCGCAGTGATCAGAGG - Intronic
1078606795 11:12784312-12784334 ATGGAGTTTGCAGTGCTTTGGGG + Intronic
1078639838 11:13084363-13084385 AAGGAGAGTGGAGTGCTCTGGGG + Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079746533 11:24139067-24139089 ATGGAGAATGCAGTGGTCTGTGG - Intergenic
1081997067 11:47372592-47372614 AGGGTGAGTGCATGGATGTGGGG + Intronic
1084605180 11:70168135-70168157 AGGGAGAGTCCAGAGCTGTGCGG - Intronic
1084806329 11:71581684-71581706 AGAGAGAGTGAAGATATTTGAGG + Intronic
1085031249 11:73272160-73272182 AGGGTGAATGAAGTGACTTGCGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085727525 11:78967165-78967187 AGGGAGAGTCCAGGGAGTTGTGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087534470 11:99425550-99425572 AGGGAGTGTGCACACATTTGGGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1089769493 11:120793203-120793225 AGGCAGAGTGCAGTGGGTCGAGG + Intronic
1089791239 11:120945769-120945791 AGAGAGAGAGCAGTGAGTTCAGG - Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1092797037 12:12121985-12122007 AGGGAAATTGCTGTGATTGGGGG + Intronic
1094226251 12:28049423-28049445 CTGGAGAGTGGAGTGATTTTTGG + Intergenic
1094270385 12:28608164-28608186 AGGTTGAGTGCTGTGATTTTGGG + Intergenic
1094425707 12:30315081-30315103 AGGTTGAGTGCAGAGTTTTGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096487927 12:51996195-51996217 AGAATGAATGCAGTGATTTGAGG - Intronic
1096548948 12:52359732-52359754 AGGGTGAGAGCAGTGAGTTTGGG + Intergenic
1097247631 12:57615293-57615315 GGGGAGATTGCGGGGATTTGAGG + Exonic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098032782 12:66271541-66271563 AGGAAGAGTTCAGTGCATTGCGG - Intergenic
1098060201 12:66553750-66553772 AGGAAAAGTGCTGTGATTTTGGG + Intronic
1098286005 12:68907590-68907612 AAAGGAAGTGCAGTGATTTGGGG + Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1098434751 12:70456852-70456874 GGGGATATTGCAGTGATTTATGG - Intergenic
1098513996 12:71352746-71352768 GGGGAGATTGCAGTGAGTCGGGG - Intronic
1098996689 12:77128771-77128793 ACGGAGACTGCAGTGAGCTGAGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099635504 12:85206376-85206398 AGTGAGAGTGCAGGGATATGGGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100818862 12:98412471-98412493 AGAGAGACTGCTGAGATTTGAGG - Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1102032350 12:109748496-109748518 TGGGCTAGTGCAGTTATTTGGGG + Intronic
1102480765 12:113221660-113221682 AGGGAGAGGGCAGGGATCAGGGG + Intronic
1102574606 12:113848433-113848455 AGTGTGAGGACAGTGATTTGAGG + Intronic
1103532516 12:121612244-121612266 AAGGAGGCTGGAGTGATTTGGGG - Intergenic
1103700568 12:122846912-122846934 TGGGAGAGTGCAGTGGTGTCTGG + Intronic
1105977878 13:25489289-25489311 AGGGAAAGTGCCGTGATTAAAGG - Intronic
1106033776 13:26025759-26025781 TGGGAGAATTTAGTGATTTGTGG + Exonic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106757120 13:32833112-32833134 AGAGTGAAGGCAGTGATTTGAGG - Intergenic
1107582571 13:41806808-41806830 GGGGAGATTGCAGTGAGCTGAGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107924094 13:45241111-45241133 TTGGAGAGTGCAGTGGTCTGTGG - Intronic
1108741253 13:53340930-53340952 AGGGAGAATACAGTTATTTCAGG + Intergenic
1109849888 13:68048612-68048634 AGGGAAAATGCTGTAATTTGAGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111745575 13:92264965-92264987 ATGTAGAGAGCAGAGATTTGAGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113154480 13:107302818-107302840 AGAGAGAGAGCAGTCATATGTGG - Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113444244 13:110353273-110353295 AGGGGGTGAGCAGAGATTTGAGG + Intronic
1113909986 13:113837114-113837136 AGGGATAGAGCAGTGATGGGAGG + Intronic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1114551571 14:23535387-23535409 AAGGAGAGAGCAGTGCTGTGAGG + Intronic
1114595673 14:23909693-23909715 AAGGAGAGTGCTGTGTGTTGAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117371230 14:55080140-55080162 AGGGAAATTGAAGTGACTTGGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118285703 14:64469940-64469962 ATGGAGATTGGAGTGCTTTGGGG + Exonic
1118590633 14:67398290-67398312 AGGGAGGCTGCAGTGAGCTGAGG - Intronic
1119556373 14:75556399-75556421 AGGGAGCACGCAGAGATTTGGGG - Intergenic
1119769224 14:77210051-77210073 AGAGAGGGTGGAGAGATTTGGGG - Intronic
1121472499 14:94166166-94166188 AGGGAGAGGGCAGTGAGATGGGG - Intronic
1121803556 14:96795559-96795581 AGGGAGGATGCAGTAACTTGTGG + Intergenic
1122014408 14:98781931-98781953 AGGGAGCATGCCGTTATTTGTGG + Intergenic
1122138919 14:99650505-99650527 AGGGAGGGTGCTGTGGTGTGGGG + Intronic
1122593625 14:102873163-102873185 CAGGTGAGTGCAGTGATTTGAGG + Intronic
1123561835 15:21501487-21501509 AGGAAGATTTCAATGATTTGGGG + Intergenic
1124014957 15:25866135-25866157 AGGGAGCGTTCAGGGATTTCAGG + Intergenic
1124456316 15:29846032-29846054 GGTGTGAGTGCAGTGAGTTGGGG - Intronic
1125409630 15:39392032-39392054 AGGGAGAGTGGAATGAGATGAGG - Intergenic
1125409719 15:39393200-39393222 ATGGACAGAGCAGAGATTTGTGG - Intergenic
1125585427 15:40816021-40816043 CGGGAAAGTGCTGTGACTTGGGG - Intronic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126694968 15:51318054-51318076 AGGGAGAGTGCTCTGAGTTAAGG - Intronic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1128601311 15:68997697-68997719 AGGCAGGGTGGAGTGCTTTGTGG - Intronic
1129753345 15:78081319-78081341 GGGGAGGTTGCAGTGAGTTGAGG - Intronic
1130367452 15:83253236-83253258 AACAAGAGTGCAGTGATTAGGGG + Intergenic
1130645702 15:85724772-85724794 AGAGACTGTGCAGTGCTTTGGGG + Intronic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1133466179 16:6029161-6029183 AGTTAGTGTGCTGTGATTTGTGG + Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134631934 16:15762648-15762670 AGGGGGAGGCCAGTGAGTTGGGG - Intronic
1135927486 16:26708352-26708374 TGGGAGAGGGCAGGGATTTGAGG - Intergenic
1136467620 16:30455875-30455897 AGGGAGAATGGAGGGATGTGGGG + Intergenic
1136922410 16:34343974-34343996 AGGGAGTGTGCAGTGGTGGGGGG - Intergenic
1136982163 16:35067832-35067854 AGGGAGTGTGCAGTGGTGGGGGG + Intergenic
1137320910 16:47380629-47380651 AGGGAGAGTGGGGTGAGTTGTGG + Intronic
1137367369 16:47872461-47872483 AGGCAGGGTGCAGCGATATGGGG + Intergenic
1137554702 16:49463265-49463287 AGGGAGAGTGCACTGAGGTGAGG - Intergenic
1137560129 16:49497078-49497100 GAGGAGAAAGCAGTGATTTGTGG - Intronic
1137596508 16:49727581-49727603 GGGGAGAGTGCTGTGTGTTGGGG - Intronic
1138163002 16:54773802-54773824 AGGGAGTGTACAGAGCTTTGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141934533 16:87228545-87228567 AGGGTGGGTGGAGTCATTTGGGG - Intronic
1142784499 17:2209995-2210017 TGGGAAGGTGCGGTGATTTGGGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143766412 17:9140657-9140679 ATTGAGAGTGCAGTGCTTTAGGG - Intronic
1144225508 17:13141120-13141142 TGGCAGAGTGCATTGATCTGAGG - Intergenic
1144472434 17:15556686-15556708 AGGGGAATTGCAGTGAATTGAGG - Intronic
1144924042 17:18788002-18788024 AGGGGAATTGCAGTGAATTGAGG + Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145246659 17:21274050-21274072 AGGGTGGGTGCAGTGGCTTGGGG - Intergenic
1145811423 17:27766484-27766506 AGGGAAAGTGCAGGGCTTCGTGG - Intronic
1147272951 17:39289576-39289598 ATGGAGGGTGCAGTGAGCTGTGG + Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149416553 17:56465850-56465872 AGGGAATGTGCAGTCATTTGGGG + Intronic
1149525092 17:57349210-57349232 AGGGAGAAGGCAGTGAGCTGAGG - Intronic
1150555740 17:66252614-66252636 ACGGAGATTGCAGTGAGTAGAGG + Intronic
1150655487 17:67036488-67036510 AGGCAGACTGCAGTAAATTGAGG - Intergenic
1150986870 17:70208107-70208129 AAGAAGACTGCAGTGGTTTGTGG + Intergenic
1151094997 17:71486791-71486813 TGGCAGAGTGCAGAGATTAGAGG + Intergenic
1151249474 17:72822626-72822648 AGGGAGAGAAGGGTGATTTGAGG + Intronic
1151359947 17:73582811-73582833 AGTGAGAGTGCAATGCTGTGGGG - Intronic
1153169900 18:2303661-2303683 AGGGAGGTTGCAGTGAGCTGTGG + Intergenic
1153326559 18:3826629-3826651 AAGGTGAGGACAGTGATTTGGGG + Intronic
1153587864 18:6642220-6642242 AGGAAGAGAGAAGTGTTTTGAGG + Intergenic
1155207358 18:23571797-23571819 GGCTAGAGTGCAGTGGTTTGTGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155679311 18:28470198-28470220 AGGGAGAGTGCTGAGATGAGTGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156045219 18:32870456-32870478 AGGTACAGTGCAGTGACTTAGGG - Intergenic
1156172878 18:34507130-34507152 GGGGAGAGAGAATTGATTTGGGG - Intronic
1157446162 18:47748371-47748393 AGGCAGAGGGGAGAGATTTGGGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158123412 18:54075807-54075829 TGGGAGCGTTCAGTGATTTGAGG - Intergenic
1158942548 18:62418941-62418963 AGGGAGAATGCAAAGATTAGTGG - Intergenic
1159269149 18:66126510-66126532 CAAGAGACTGCAGTGATTTGAGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1159890422 18:73948192-73948214 AGGCAGCGTGGAGTGACTTGGGG + Intergenic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1161666657 19:5581235-5581257 ATGGAGGGTGCAGTGAGCTGAGG - Intergenic
1161996808 19:7718109-7718131 GGGCAGAGTGCTGTGATGTGAGG - Intergenic
1164505004 19:28852659-28852681 AGGGTGAGTAGAGTGCTTTGTGG - Intergenic
1166214097 19:41324589-41324611 TGGGACAATTCAGTGATTTGGGG - Exonic
1166301563 19:41914377-41914399 AGGGAGAGGGCAGTGAGGTGGGG - Intronic
1166326592 19:42054561-42054583 GGGGAGAGGGAAGTTATTTGAGG - Intronic
1166983721 19:46647919-46647941 AGGGAAGGAGCACTGATTTGGGG - Exonic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
1167407837 19:49325293-49325315 GGGGAGAGAGCAGGGAGTTGGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926345601 2:11942226-11942248 AGGGAGAAAGCAGTGAGCTGGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
928565571 2:32544050-32544072 ATGGAAAGAGCAGTGTTTTGAGG + Intronic
929486771 2:42361578-42361600 GGGGAGAGGGCGGTGATTGGTGG + Exonic
929769627 2:44880803-44880825 AGGGAAAATGCAGAGATTTAAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930363929 2:50415266-50415288 AGGGAAAGTGCATTAATCTGTGG - Intronic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933338275 2:80987575-80987597 AGGGAGAATTCCCTGATTTGGGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935332607 2:101988144-101988166 TGTGAGAGTGCCATGATTTGGGG + Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941228937 2:162884631-162884653 AGGAAGATTGCAGTGATCTGAGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944739328 2:202596178-202596200 AGGGAGAGAGATGTGAGTTGAGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945469842 2:210215186-210215208 AGAGAGGGGGCAGTGGTTTGAGG - Intronic
947247489 2:228065766-228065788 AGAGACAGTGCATTGATTTGAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948156855 2:235790463-235790485 AGGGAGTGTGCAGGGGTGTGGGG - Intronic
948516380 2:238506318-238506340 AGGGCCAGTGCAGTGCTCTGGGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948996396 2:241582065-241582087 AGGGTAAGTGCAGTGGTGTGAGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169341756 20:4801804-4801826 AGGGAGGTTGCAGTGAGCTGAGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170292197 20:14782997-14783019 AGGGAGATTGCTGAGAGTTGGGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171964497 20:31519167-31519189 ATGGAGCGTGCAGTGAGCTGAGG - Intronic
1172695553 20:36820247-36820269 AGGGAGTCTGCAGTCATTGGTGG - Intronic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175483249 20:59326546-59326568 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175483314 20:59326811-59326833 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175770259 20:61618999-61619021 AGGAAGAGGGCAGTGAACTGGGG - Intronic
1176075305 20:63245547-63245569 AGGGAGAGGGGAGAGCTTTGGGG - Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1179944960 21:44666912-44666934 AGGCAGAGGGCAGTGATGTCTGG + Exonic
1179946588 21:44682149-44682171 AGGCAGAGGGCAGTGATGTCTGG + Exonic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180692244 22:17727115-17727137 AGGGAGGTGGCAGTGATATGTGG - Exonic
1181519169 22:23435481-23435503 AGGGAGTGTGCAGTGACATTGGG + Intergenic
1181669319 22:24418813-24418835 AGGGAGAGTGGAGAGATTCCAGG + Intronic
1182399681 22:30066174-30066196 AGGGAGATTGCAGTGAGCCGAGG - Intergenic
1182722040 22:32410988-32411010 AGGGAGAGCGCAGTGGTTCATGG - Intronic
1182873046 22:33665232-33665254 GAGGAGAGTGTTGTGATTTGTGG - Intronic
1183096721 22:35556479-35556501 TGGGAGAGTCCAGTGAGTTGGGG + Intergenic
1185043113 22:48515753-48515775 AGGGACAGTGCGGGGACTTGGGG + Intronic
949533249 3:4977785-4977807 AGTGAGATTGCAGAGATCTGGGG + Intergenic
949828228 3:8185442-8185464 AGGGACAGTGCAATGATCTGTGG - Intergenic
949928484 3:9060074-9060096 AGGGGAAGGGCAGTGATTTGGGG - Intronic
950881705 3:16327807-16327829 AGGGAGAGAGCCCTGATGTGAGG + Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952093183 3:29916200-29916222 AGAGAGAGTACAGGGATATGAGG - Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953544390 3:43853693-43853715 AGGGAGAGTGAGGAGAATTGAGG - Intergenic
953581323 3:44159762-44159784 ATGAAGACTGCATTGATTTGAGG - Intergenic
953783050 3:45888389-45888411 AGGGAAAGTGCTATGAGTTGTGG - Intronic
954415680 3:50392195-50392217 GGGGAGGGTGCAGGGACTTGAGG - Intronic
954493591 3:50930942-50930964 CAGGAGAGGGCAGTGACTTGGGG + Intronic
954991512 3:54844350-54844372 AGGCAGAATGCAGTGGGTTGAGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956519940 3:70093026-70093048 AAAGAGAGTGGAGTGATCTGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960304993 3:116050327-116050349 GGGGATAGTGCAGTGCTCTGGGG - Intronic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
960924921 3:122785194-122785216 AGGGAGAGAGGAATGTTTTGAGG + Intronic
961751015 3:129094941-129094963 AGGCAGAGTGATGGGATTTGTGG + Intronic
961799408 3:129433782-129433804 AGGGAGAAAGCACTGAATTGAGG - Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962827667 3:139111762-139111784 AGGCAGAGAGCAGGGATTTGGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965403756 3:168245960-168245982 AGGGAGAGTGAAGTGGCATGTGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
966872530 3:184300134-184300156 AGGCAGGGTGCAGGGAGTTGAGG + Intronic
967463915 3:189780305-189780327 AAGAAGGGTACAGTGATTTGGGG - Intronic
967655233 3:192040280-192040302 AGGGAGAGAGTAGTGAGGTGGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967954299 3:194865933-194865955 AGGGACACTGCAGTGCTGTGGGG + Intergenic
969327423 4:6452039-6452061 AGGAGGGGTGCTGTGATTTGTGG - Intronic
970924604 4:21436505-21436527 AGGGAATGTGTAGTGATTTTTGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971114509 4:23629280-23629302 ATGGTGAGTTCAGTGAGTTGGGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972457507 4:39269034-39269056 AGCCAGAGTGCTGGGATTTGGGG + Intronic
972726444 4:41749928-41749950 AAGGAGCGAGCAGTGATTTGTGG + Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975746578 4:77481024-77481046 AGGGAGAGTTTGTTGATTTGAGG + Intergenic
976706536 4:88025544-88025566 ATGGAGACTGCAGTGAGCTGTGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977544609 4:98362713-98362735 AGGGAGAGAACAATAATTTGTGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978072207 4:104488185-104488207 TGGCTGAGGGCAGTGATTTGGGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978925611 4:114239392-114239414 AGTGAGACTGCAGTGAGTTGTGG - Intergenic
979184522 4:117772046-117772068 AGGGAGAGTGCAGACATTAAGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979958243 4:126982121-126982143 AGAGAGAGTGAAGAGATTTGAGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981872496 4:149503774-149503796 ATGTAGATTGCAGTGAATTGAGG + Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982782589 4:159506785-159506807 ATGGCGAGTGCAGTGAGCTGAGG + Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983276538 4:165624377-165624399 AGAGAAAGTACTGTGATTTGGGG - Intergenic
983319017 4:166171251-166171273 TGGGAAAGAGCAGTGATGTGGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983772338 4:171567142-171567164 AGGGAGATTGAAGTGGTTTTAGG - Intergenic
984855234 4:184189380-184189402 AGGGAAAGTGGCCTGATTTGAGG - Intronic
985097115 4:186423922-186423944 AGGGAGAGAGCAGTCATAGGTGG - Intergenic
985249114 4:188005451-188005473 AGGCAGAGTGAAGGGATGTGGGG - Intergenic
986034754 5:3926974-3926996 AGAGAGACTGCAGTGCTGTGTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986558215 5:9033117-9033139 AGGGAGGGTGATGTGTTTTGTGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986989332 5:13533288-13533310 AAGGCAAGTGCAGTGATGTGAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988167006 5:27605974-27605996 AGGGAGATTGCAGTGAAGTAAGG - Intergenic
989272431 5:39549014-39549036 ATCGGGAGTGCAGTGCTTTGAGG + Intergenic
990132264 5:52600492-52600514 AGAGAGAGTGCACTGCATTGTGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991915071 5:71597481-71597503 AGGGCGATTGCAAGGATTTGAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992561767 5:77959094-77959116 ATGGAGAGTGGTGTTATTTGGGG + Intergenic
992995004 5:82323952-82323974 AGGGATAGTGTAGTGACCTGGGG - Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995278760 5:110308617-110308639 AGGGTGAGAGCAGTGAGTTGGGG - Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996854202 5:127986939-127986961 AGGGAGAGTCCAAGGACTTGGGG + Intergenic
997508752 5:134438662-134438684 AGGGAAAGTGATGTGATTAGAGG + Intergenic
997921987 5:137989753-137989775 AGGGAGGTTGCAGTGAGCTGTGG + Intronic
999257947 5:150220275-150220297 GGGGAAAGAGCAGTGATTTGGGG - Intronic
999316015 5:150584707-150584729 AGGCAGCGTGCAGGGAGTTGGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001074956 5:168619352-168619374 AGGGAGAGTGGAATGAAGTGGGG - Intergenic
1001202467 5:169730694-169730716 AGGGATTGTTCACTGATTTGAGG - Intronic
1001484994 5:172113281-172113303 TGGGTGTGTGCAGTGAGTTGGGG - Intronic
1002022265 5:176371440-176371462 AGGGAGAGAGCATTGAGTTTAGG + Intronic
1002097218 5:176838673-176838695 AGGGAGAGTGTAGAGATGTTAGG - Intronic
1003286475 6:4738474-4738496 TGGGAAAGTGAAATGATTTGTGG - Intronic
1003346433 6:5272218-5272240 AGGGTGAGTGCAGTGGGATGAGG + Intronic
1004187921 6:13437359-13437381 AGGGAGTGTGGAGGGATTTCAGG - Intronic
1004425334 6:15503241-15503263 AGGCAGAGTGCAATGAGTGGAGG - Intronic
1005211382 6:23468298-23468320 AGGGAGAATGGAGAGTTTTGAGG + Intergenic
1005735139 6:28738648-28738670 ATGGAGAGTGCAGTGCAGTGAGG - Intergenic
1006143849 6:31946592-31946614 AGGCAGAGTGCAGAGGTTTGAGG + Exonic
1006297367 6:33175819-33175841 AGGGATAGTGTAGTGATGGGAGG + Intronic
1006519459 6:34562973-34562995 AGGGTGTGAGCAGTGATGTGGGG - Intergenic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008565252 6:52761812-52761834 AGGTAGAGGGCAGGGATGTGTGG + Intronic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088564 6:71951746-71951768 TGGGAGAGTGCTGGGATTTGAGG - Intronic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011479046 6:87776128-87776150 AGGGAAAGTGCAGTGTGTTTAGG + Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012305953 6:97657537-97657559 TGGGAGAGTGCATTGCTTTGTGG + Intergenic
1012716243 6:102675079-102675101 ATAGAGAGTTCAGGGATTTGTGG - Intergenic
1012749607 6:103140701-103140723 CTGGAGAGTGCAGTGATGTCTGG + Intergenic
1012902303 6:105020420-105020442 AGGGAGGCTGCAGTGAGCTGAGG - Intronic
1013174392 6:107664846-107664868 TGGGAGTGTGCAGTGAAGTGTGG - Intergenic
1013267229 6:108512006-108512028 GGGGAGAGTGCACTGATCTATGG + Intronic
1014259391 6:119198320-119198342 AGGGAGGTTGCAGTGAGCTGAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015745751 6:136507914-136507936 AGGGAGCTTGCAGTGTGTTGTGG - Intronic
1015907173 6:138129277-138129299 AGGGAGAGCGCAGTAGTTTTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016602248 6:145875539-145875561 AGGGAGAATGTAGTACTTTGAGG + Intronic
1016998225 6:149976217-149976239 AGGCAGAGCGCAGGGAGTTGGGG + Intergenic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1018992520 6:168684884-168684906 AGGCAGAGTGCAGGGAGATGAGG - Intergenic
1019179523 6:170177639-170177661 AAGGAGAGTGGCGTGATCTGTGG - Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019592112 7:1840845-1840867 AGGGAGTGTGCAGTGACATTGGG - Intronic
1019770811 7:2882764-2882786 AGGGGGAGCGTAATGATTTGTGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022095302 7:27136991-27137013 ATGGAGAGTGCAGAGCATTGTGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022725724 7:32979778-32979800 AGTGAGATAGAAGTGATTTGAGG + Intronic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023257068 7:38322747-38322769 AGGGAGAGAGCAGTGAGGTAGGG + Intergenic
1023352294 7:39332844-39332866 ATGGAGAGCTCAGTGTTTTGGGG + Intronic
1023420884 7:39978422-39978444 AGCCAGATTGTAGTGATTTGAGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024603984 7:51010251-51010273 CGGGAGAGTGGAGTCATTGGCGG - Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025047888 7:55707919-55707941 AGTGAGATAGAAGTGATTTGAGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025206173 7:56994446-56994468 AGGGAGGGAGCAGAGAGTTGGGG + Intergenic
1025665767 7:63582493-63582515 AGGGAGGGAGCAGAGAGTTGGGG - Intergenic
1026128888 7:67604215-67604237 AAGCTGAGTGCAGTGGTTTGAGG + Intergenic
1026289743 7:68995814-68995836 TGGCAGGGTGCAGTGATTTCTGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029367311 7:100124933-100124955 AGGGAGAGTGCAGGCTTTAGAGG - Exonic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032391827 7:131560073-131560095 AGGGAGAATTCATTGTTTTGGGG + Intergenic
1032590241 7:133185382-133185404 AGTGAGAGTGCACAGATGTGGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034823772 7:154241490-154241512 AAGGAGGTTGCAGTGAGTTGTGG + Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035917427 8:3640184-3640206 AGGGATATTGCAGTCATGTGGGG + Intronic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1036967496 8:13316798-13316820 AGGGATACTGCAGTCAGTTGGGG - Intronic
1038515639 8:28185575-28185597 AGAGAGAGTGCTGTGAATTCTGG + Intronic
1038841668 8:31189968-31189990 AGAGAGAATGTATTGATTTGTGG + Intergenic
1040386106 8:46916086-46916108 GGGGAGGGTGCAGTGTTGTGTGG + Intergenic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1042338848 8:67657834-67657856 AGGGAGAGTGCACTGGCATGAGG - Intronic
1042649695 8:71025733-71025755 AGGCACACTGCAGTGGTTTGAGG - Intergenic
1042737462 8:72005098-72005120 AGCGCGAGGGCAGTGACTTGAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044313771 8:90726531-90726553 AGGGAGACTGCAGTGTTGGGAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1044949830 8:97424964-97424986 AGGGTCAGTGCAGTGATTAAGGG + Intergenic
1044987900 8:97771157-97771179 AAGGAGAGTTCAGAGATTAGAGG + Intergenic
1046153859 8:110262134-110262156 AAGGAGAATGCAGAGATATGTGG + Intergenic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046504674 8:115122224-115122246 AGGGAGATTAAAGTGATTTGGGG - Intergenic
1046764716 8:118057086-118057108 TTAGAGAGGGCAGTGATTTGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046913817 8:119658786-119658808 AGGGACAGTGCTGGGGTTTGGGG - Intronic
1048217994 8:132514249-132514271 AGAGAGATTGGAGTGATGTGGGG - Intergenic
1049662484 8:143825869-143825891 TTGGTTAGTGCAGTGATTTGGGG - Intronic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050174119 9:2852393-2852415 AGCAAGAGTGCATTGACTTGGGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050694029 9:8259636-8259658 AGGGAGAAAGCAATGATTTGTGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051507592 9:17843319-17843341 AGGGAGAGGGCACAGCTTTGAGG - Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052150927 9:25114757-25114779 AGGGAGGGTGCACTTAATTGAGG - Intergenic
1053650585 9:40164747-40164769 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1053755153 9:41299177-41299199 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054331095 9:63756518-63756540 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054533998 9:66211455-66211477 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1056267807 9:84916853-84916875 AGAGAGATGGCAGTGATTTACGG + Intronic
1056657658 9:88522489-88522511 AGGGAGGGTGCAGTCAACTGTGG - Intergenic
1056779948 9:89541827-89541849 AGGCAGGTTGCAGGGATTTGGGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057593665 9:96395676-96395698 AGGAAGAATTCAGTTATTTGGGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058704682 9:107628516-107628538 AGGCAGTGTGCGGTGAGTTGTGG + Intergenic
1058915070 9:109557648-109557670 AAGGAGAGGGCAGTGAGTCGAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060029520 9:120202418-120202440 AGGGAGGTTGCAGTGAGCTGAGG - Intergenic
1060060756 9:120457310-120457332 AGGGAGAGTGCAGTGGGCTGTGG - Intronic
1060210957 9:121710125-121710147 AGGGAGAGGGCAGTACTGTGGGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061211946 9:129198791-129198813 AGGGTGTGTGCTGTTATTTGGGG + Intergenic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1202798469 9_KI270719v1_random:149438-149460 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185728512 X:2442633-2442655 AGAAATAATGCAGTGATTTGGGG - Intronic
1185750419 X:2606596-2606618 AGGAAAATTCCAGTGATTTGGGG + Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187284781 X:17894545-17894567 TGAGAGAATGCAGTGATTTGGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189928962 X:45987563-45987585 AGGGAGAGTGGACTGATTTAAGG - Intergenic
1190213626 X:48466617-48466639 AGGTAGAGTGTAGTGGTCTGGGG + Intronic
1190224236 X:48533335-48533357 AGAGTGAGTGAAGTGATTAGGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192544361 X:72001056-72001078 AGGGAGAGCACAGAGATGTGTGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194401837 X:93446935-93446957 AGGGCAAGTCCAGGGATTTGAGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196584212 X:117410240-117410262 AGGGCTAGTGCAGTCATTTGGGG - Intergenic
1196780096 X:119376032-119376054 AGGGAGAGTTTATTGATTTGGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198156001 X:133961454-133961476 TGGGAGAGTGTAGTGATCTGGGG - Intronic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198988725 X:142486070-142486092 TGGGAGAGTGAAGAAATTTGAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199694780 X:150336170-150336192 CAAGAGAGTGGAGTGATTTGAGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1199975291 X:152891637-152891659 AGGGTGAGAGCAGTGAGGTGTGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic