ID: 987617226

View in Genome Browser
Species Human (GRCh38)
Location 5:20291955-20291977
Sequence GAGGCTAGGAAGGAAATTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987617226 Original CRISPR GAGGCTAGGAAGGAAATTAC GGG (reversed) Intronic
902499291 1:16897816-16897838 GAGGCTATGAAGTGAATTTCTGG + Intronic
904610678 1:31724645-31724667 GAGTCCAGGAAAGAAATGACAGG + Intergenic
904692500 1:32304284-32304306 GAAGCAAGGAAGGAAAGTAGAGG + Intronic
904773091 1:32891936-32891958 GAGGCTCAGAAGGAAATTGATGG - Intronic
908295597 1:62709568-62709590 GAGGATAGGAAGTAAAGTATAGG - Intergenic
908436369 1:64110796-64110818 GAGAGTAGGTAGGAAATTAAGGG + Intronic
909455075 1:75841145-75841167 GAGGGAGGGAAGGAAATGACTGG - Intronic
910326689 1:86016857-86016879 GAGGCTTGGAACCAAATTTCAGG - Intronic
910689690 1:89953431-89953453 TAGGTTAGGAATGAAATCACAGG - Intergenic
911564777 1:99450951-99450973 GAGGCTAGGAAGGGTATTAGTGG + Intergenic
915337804 1:155157265-155157287 GAGGCTGGGAAGGATAGTAGGGG + Intergenic
915693402 1:157714261-157714283 GAGGCTGGGAAGGATAGTAGAGG - Intergenic
916208703 1:162340662-162340684 GAGGATAGGAAGGAAATGGGAGG + Intronic
916283740 1:163081533-163081555 GACACAAGGAAGGAAAATACTGG + Intergenic
916670693 1:167016978-167017000 GAGGCTAGGAAGGGTACTAGAGG + Intronic
918234729 1:182569703-182569725 GAGTGTAGGAAGAAAATAACAGG - Intergenic
920811541 1:209290420-209290442 GAGGCTAGAAAGGGCATTCCTGG - Intergenic
921731709 1:218586346-218586368 GTGGCCAGGAAGGAAGTTCCTGG - Intergenic
922061423 1:222096336-222096358 GAGGCAAGGAGGGGAATTGCGGG - Intergenic
922843778 1:228666579-228666601 GAGGCTAGGAAGGATAGGAAGGG - Intergenic
923057686 1:230439685-230439707 GAGGCAGGGAAGGAAATCATTGG - Intergenic
923505785 1:234605968-234605990 CATGTTAAGAAGGAAATTACAGG + Exonic
923561217 1:235043331-235043353 GAGACTGGGAAGGAAAGTCCCGG + Intergenic
1063424766 10:5942416-5942438 CAGGCTCGGAAGGAAATCAGGGG - Intronic
1065180704 10:23121723-23121745 GAGAAGAGGAAGGAAAATACAGG + Exonic
1065278460 10:24110551-24110573 GAAGACAGGAAAGAAATTACTGG - Intronic
1068550922 10:58407133-58407155 GAGGTGAGGAAGGAAGTTAGGGG - Intergenic
1069379529 10:67828710-67828732 AAGGCTAGGAAATAAATTAAAGG - Intronic
1070700897 10:78601022-78601044 AATGCTAGGAAGGAAAATACAGG + Intergenic
1071511463 10:86264991-86265013 GTGGCTAGGAAGGAAAAGGCTGG - Intronic
1071617800 10:87092967-87092989 GAAGCTAGAAAGGAAATCAGAGG + Intronic
1071885756 10:89949016-89949038 GAGGCTAGGAAGGGTAGTAGGGG + Intergenic
1072545545 10:96434148-96434170 GAAGCTAGGAAGGAAATGTCAGG - Intronic
1073061125 10:100734528-100734550 GAGGCTATCAAGGAAAGTGCTGG - Intergenic
1074024186 10:109616596-109616618 GAGGAGAGGAAGGAAACTGCAGG + Intergenic
1075199482 10:120390234-120390256 GAGGCTAAGAAGGACATCAGAGG - Intergenic
1077395698 11:2320055-2320077 TAGGCTGGGAAGGAAAGTGCCGG + Intergenic
1079129694 11:17740333-17740355 GAGGCTATGAAGGGATTTCCTGG + Intronic
1079301656 11:19284132-19284154 GAGGGGAGGAAGGAAGTCACTGG - Intergenic
1080304330 11:30820205-30820227 GAGGTTATGAAGGGGATTACAGG + Intergenic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083351610 11:62033464-62033486 GAGGCTGGAAAGGAAGTTAGGGG - Intergenic
1083576640 11:63796604-63796626 GAGACTAGGAAGGAAGTTCATGG + Intergenic
1083863802 11:65442444-65442466 CAGGCTATGAAGGAAATGGCTGG + Intergenic
1084866937 11:72066448-72066470 GAGGCTGGGAAGGAAATTTGAGG - Intronic
1085420680 11:76356210-76356232 GAGGGTTGGAAGGAAAGTAAAGG - Intronic
1085530979 11:77191855-77191877 GAGGCTAGGAAGGCAATGGTGGG + Intronic
1085642918 11:78204269-78204291 GAGGCAAGGCAGCAAATTATAGG + Intronic
1085717213 11:78883064-78883086 CAGACTAGGAAGGACCTTACAGG + Intronic
1086497483 11:87419544-87419566 GAGGCAAGCAATGAAAGTACTGG + Intergenic
1087584007 11:100094805-100094827 GAAGGAAGGAAGGAAATTAAAGG + Intronic
1088747412 11:112815781-112815803 GAGGGTTGGATGGAAATCACTGG - Intergenic
1088909970 11:114183408-114183430 GAGGCCAGGTAGGAAATAAAGGG - Intronic
1088928237 11:114323513-114323535 GAGGCTAGTGAGGAGATGACTGG + Intergenic
1089058325 11:115606028-115606050 GAGGCGAGGATGAAAATTACAGG + Intergenic
1089937855 11:122384267-122384289 GAGGCTGGGAAGGATAGTAGGGG + Intergenic
1091398477 12:168938-168960 GAGGCGAGGCAGGAAATGAGGGG - Intronic
1091566156 12:1649647-1649669 GAGGATAGGAAGGCAGTCACAGG + Intergenic
1092192101 12:6528660-6528682 GAGACTAGGAATGGAATTGCGGG - Exonic
1092272608 12:7035363-7035385 CAGGCAAAGAAGGGAATTACTGG + Intronic
1092891634 12:12974460-12974482 GAGGATAGGAAGGAAAGAAAAGG - Intergenic
1093679191 12:21981466-21981488 GAAGCTAGGAAGGAAAAAAATGG + Intergenic
1096209082 12:49748620-49748642 GAGGCTCTGAATGAAATTAGAGG + Intronic
1097728072 12:63097176-63097198 GAGGCTAGAAGGGAAACTAGAGG + Intergenic
1099100354 12:78432266-78432288 GAGGCTGGGAAGGGTAGTACAGG - Intergenic
1099206620 12:79735948-79735970 GAGGCTAGGAAGGATACCAGAGG + Intergenic
1099206624 12:79735967-79735989 GAGGCTAGGAAGGATACCAGAGG + Intergenic
1100661739 12:96707125-96707147 TAGGATAGGAAGGAAACTAAGGG + Intronic
1100784415 12:98064084-98064106 GAGACCATCAAGGAAATTACTGG + Intergenic
1101483133 12:105122199-105122221 GAAGCTAGAAGGGCAATTACTGG + Exonic
1102611904 12:114119750-114119772 GAGGCTAAGAAGGAACTTCTAGG - Intergenic
1105721340 13:23117961-23117983 GAGGCCAGGAAGGCAAGAACAGG + Intergenic
1106912489 13:34477829-34477851 GAGGGTAGGATGGAAATGAATGG - Intergenic
1107178883 13:37432898-37432920 AAGGCTAGGTAAAAAATTACAGG + Intergenic
1107550418 13:41469345-41469367 GTGGCTAGGAATGAAATTCTGGG + Intronic
1107732709 13:43364864-43364886 GAGTCCAGGAAGGGAATTGCTGG + Intronic
1108171094 13:47742862-47742884 GAGGCTGGGAAGGATAGTGCAGG + Intergenic
1110085816 13:71378225-71378247 GAGCCTATTAAGAAAATTACTGG - Intergenic
1110242687 13:73286436-73286458 CAGGCAGGGAAGGAAATTTCAGG - Intergenic
1110344770 13:74432910-74432932 AAGACAAGGAAGGAAAATACTGG - Intergenic
1112255078 13:97822644-97822666 AAGGCTAGAATGGAAAATACAGG - Intergenic
1112569890 13:100584470-100584492 GAGGCTAGGAAGGGTAGTAGGGG + Intronic
1113084755 13:106556777-106556799 GAGGTTAGGAAAGAAAAAACTGG + Intronic
1115666860 14:35560484-35560506 GAGGATGGGATGGAAATTAGAGG - Intronic
1115850873 14:37588922-37588944 GAGGAGGGGAGGGAAATTACTGG - Intergenic
1116805181 14:49487506-49487528 GAGGCTAGGAAAGAAAGTAGAGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120668971 14:87342087-87342109 GAGGCTAGGAAGGATAGTTGGGG + Intergenic
1120755994 14:88245014-88245036 GAGGCTAAAAAGGAAATTCAAGG - Intronic
1121727544 14:96164062-96164084 GAGGCTGGGAAGGATATTGCAGG + Intergenic
1122791337 14:104185386-104185408 GAGGCTGGGAAGGAATTCCCTGG + Intergenic
1124327657 15:28781672-28781694 GAGGTCAAGAAGGAAATTCCTGG - Intergenic
1125020975 15:34986847-34986869 CAGGCTAGGAAAGAAGTTATGGG + Intronic
1125786293 15:42321358-42321380 GAGGCAAGGAAGTACATGACAGG - Intronic
1126076110 15:44911312-44911334 GAAGGAAGGAAGGAAATTAGGGG + Intergenic
1126469714 15:48995451-48995473 GAGGCCAGGAAGGAGAATATGGG + Intronic
1127018822 15:54722010-54722032 GAGGCTGGGAAGGAAAATAGGGG - Intergenic
1127120933 15:55771543-55771565 GAGGTCAGGAAGGATATTCCTGG + Intergenic
1127592034 15:60434748-60434770 GAGGCTGGGAAGGAAATGGATGG + Intronic
1127750360 15:62033741-62033763 GAGGGAAGAAAAGAAATTACAGG + Intronic
1128802714 15:70507129-70507151 GATGATATGAAGCAAATTACAGG + Intergenic
1128859929 15:71060495-71060517 GAGGCTAGGAAGGGTAGTAGTGG - Intergenic
1129751083 15:78064819-78064841 GAGACTAAGAAGGCAAATACTGG + Intronic
1132290033 15:100693629-100693651 GAGGAAAGGAGGGAAATTCCAGG + Intergenic
1133399792 16:5477246-5477268 GTGGCTAGGAAAAAAAATACAGG - Intergenic
1133727725 16:8553105-8553127 GAGGCCAGGATGGAGATGACAGG + Intergenic
1134407205 16:13970975-13970997 GTACCTAGAAAGGAAATTACTGG + Intergenic
1138100746 16:54250214-54250236 GAGCCTGGGATGGAAATGACGGG + Intronic
1138844534 16:60549363-60549385 GAGGCTAGGAATGGTATTAAGGG - Intergenic
1139260766 16:65591315-65591337 GAGGCTGGGAATTAAATTATGGG - Intergenic
1140891442 16:79288687-79288709 GAGGAAAGGAAGGACATTCCAGG + Intergenic
1141260094 16:82444946-82444968 CAAGCTAGGCAGGAAATTAGGGG - Intergenic
1143266292 17:5640440-5640462 GAGTGAAGGAAGGAAATTGCAGG - Intergenic
1144124999 17:12194986-12195008 GAGGCAGGGAAGGACATTCCCGG - Intergenic
1148997429 17:51723325-51723347 GAGGCTAGGGATGAAATTGGAGG + Intronic
1153120958 18:1726291-1726313 GAGGCTGGGAAGGATAGTAGGGG - Intergenic
1153285208 18:3450145-3450167 GAGGCGAGGAGGGAAGGTACAGG - Intronic
1155217046 18:23652459-23652481 GAGGATAGGAAGGAGGTCACCGG - Intronic
1155534398 18:26802006-26802028 GAGGCTAGGAAGGATAGCAGGGG + Intergenic
1156697459 18:39784011-39784033 GAGGGTAGAAAGGAAAATAAAGG + Intergenic
1158261942 18:55616129-55616151 GCGGCTGGGAAGGAAAGTAATGG - Intronic
1160468004 18:79098742-79098764 AAGGCTACAAAGGACATTACTGG - Intronic
1164604983 19:29591364-29591386 GAGTTGAGGAAGGAAATTTCTGG - Intergenic
1164705919 19:30320036-30320058 TTGGACAGGAAGGAAATTACTGG + Intronic
1165357316 19:35312128-35312150 GAGGAGAGGAAGGACATTCCAGG + Intronic
1165816981 19:38648301-38648323 GAGGCTGAGAAGGGAATTTCTGG + Intronic
1165985051 19:39761169-39761191 GAGGCTGGGAAGGATAGTAGAGG + Intergenic
1166630479 19:44402035-44402057 GAGACTAGGAAATAAATTACAGG - Intergenic
1168487518 19:56776938-56776960 GAGGCTGGGATGCAAATTTCAGG + Intronic
925254651 2:2472769-2472791 TAGGCAAGGCAAGAAATTACGGG + Intergenic
925441476 2:3890338-3890360 GAAGCTAGGAAGGGTATTAGAGG - Intergenic
926731973 2:16042362-16042384 AAGTCTAGGAAGGAAAAGACTGG + Intergenic
928126071 2:28617551-28617573 TGGGCTAGGAGGGAAATTAAAGG - Intronic
929581702 2:43085530-43085552 GAGCCCAGGAAGGAACTTGCAGG - Intergenic
931062661 2:58548410-58548432 GAGGATAGTAAGGAAATGAAGGG - Intergenic
931432681 2:62221080-62221102 AAGGATAGGAAGGAACTTCCTGG - Intronic
931854625 2:66288981-66289003 GAGGCTGGGAAGGATATTGGGGG - Intergenic
932304766 2:70694291-70694313 CAAGCTGGGAAGGAAATTCCGGG - Intronic
932501830 2:72189108-72189130 GAGGCTATAAAGGACATTACTGG - Intronic
932907025 2:75765233-75765255 GAGGCTAGGAATAAAATGAGGGG - Intergenic
933183977 2:79258682-79258704 CAGACTAGGAAGAAAAATACAGG + Intronic
933261583 2:80137280-80137302 GCTGCTAGGAAGGAAGTTATAGG + Intronic
933818341 2:86087020-86087042 GAGCATAAAAAGGAAATTACTGG + Intronic
935461319 2:103338350-103338372 GAGGCTGGGAAGGATAATAGGGG + Intergenic
937579054 2:123461409-123461431 GAAGGAAGGAAGGAAATTAAAGG - Intergenic
937627322 2:124057751-124057773 GAGGCTGGGAAGGTAATGAGAGG + Intronic
938543263 2:132304337-132304359 GAGACTAGGAAAAAAATTACAGG + Intergenic
939212464 2:139194309-139194331 AAGGTTAGGAAAGAAATTAGAGG + Intergenic
939423506 2:142004134-142004156 AAGGTTAGGAAGAAATTTACAGG + Intronic
941047763 2:160695702-160695724 GAGGCTGGGGAGGAAATTTCAGG - Intergenic
941640571 2:167983501-167983523 GAAGGAAGGAAGGAAATTATAGG + Intronic
942397600 2:175568213-175568235 GAGGATAAGAAGGAGATAACTGG + Intergenic
942876673 2:180808158-180808180 CAAGCAAGAAAGGAAATTACCGG + Intergenic
943214789 2:185016514-185016536 GAAGCTATGAAAAAAATTACAGG + Intergenic
944544123 2:200782256-200782278 AAGACTTGGAGGGAAATTACAGG - Intergenic
944873565 2:203938496-203938518 GAGGCTGGAAAGGAAAGTAGAGG + Intronic
946353687 2:219171828-219171850 GAGGCTTGGAAGGCAGATACAGG + Intergenic
946824810 2:223666569-223666591 GTGGTTAAGAAGGCAATTACAGG - Intergenic
1169621841 20:7515681-7515703 GAGGCTGGGAATGAAGTTTCAGG - Intergenic
1169979668 20:11370353-11370375 GAAGTTAGAAAGGAACTTACTGG + Intergenic
1171469289 20:25357047-25357069 GAGTCTGGGAAGGAAATATCGGG - Intronic
1171872145 20:30537171-30537193 GAGACTAGGAAAAAAATTACTGG + Intergenic
1172794362 20:37527063-37527085 GAGGCCTGGAAGGAAACTAAAGG + Intronic
1173361964 20:42352571-42352593 GAGGCTGGGAAGGGCAGTACCGG + Intronic
1174296472 20:49548746-49548768 GAAGGAAGGAAGGAAATTGCTGG + Intronic
1174671183 20:52309031-52309053 GAGGTTGGGAAGGGAATAACTGG + Intergenic
1177750268 21:25273178-25273200 GAGAGTAGGAAGGAGGTTACAGG + Intergenic
1178698827 21:34816697-34816719 GAGGAGAGGAAGGAACTTTCTGG + Intronic
1179600464 21:42474287-42474309 GAAACCAGGAAGGAAATTCCAGG - Intronic
1179629786 21:42669253-42669275 GAGGCAAGGAAGGGAATCTCCGG - Intronic
1180595860 22:16972820-16972842 GAGGTTAGGAAGGTAATAGCAGG - Intronic
1181271619 22:21661933-21661955 GAGGATAGAAAGGAAATCTCAGG + Intronic
1181848343 22:25731316-25731338 GAGGCTAGGAAGGGTAGTATGGG - Intergenic
1182173735 22:28261076-28261098 AAGGCTAGGAAGAAAGTTACAGG - Intronic
1182618149 22:31602530-31602552 GAAGCCAGGAAAGAATTTACAGG - Intronic
1183201647 22:36388673-36388695 GAGGCTCGGAAGGGTATTCCAGG - Intergenic
1183225887 22:36549570-36549592 GAGTCTAGAAAGGACATAACTGG - Intergenic
1183487815 22:38098788-38098810 GAAGATAGGGAGGAAATTCCAGG - Intronic
1183709463 22:39494245-39494267 GAGGCAGGCAAGGAATTTACTGG + Intergenic
950024255 3:9809915-9809937 GAGCCTAGGCAGGAACTTCCCGG + Intronic
950415621 3:12867509-12867531 GGGGCTAGGAAGGAAACACCAGG - Intronic
950579513 3:13853282-13853304 AAGGCTAGGAAGGAATGTAAAGG + Intronic
952549118 3:34456026-34456048 GAGGCTAGGAAGAATAGTAGGGG - Intergenic
953565043 3:44025043-44025065 GAGGTTGGGAATGAAATTACTGG + Intergenic
953725800 3:45397529-45397551 GATGCTAGTAAAGAAATTACAGG + Intronic
955456456 3:59126803-59126825 GAGGCTAAGAAGGAAAGAAAGGG + Intergenic
955725711 3:61930572-61930594 GAGGAAAGGATGGAAAATACAGG + Intronic
957617015 3:82542854-82542876 GAGACTAGGAGAGAAATTAGAGG + Intergenic
960703332 3:120458532-120458554 TGGGCCAGGAAGGAACTTACTGG + Intergenic
960964924 3:123098023-123098045 GAGGCGAGGAGAGAAATGACAGG + Intronic
961713965 3:128846412-128846434 GGGGCTAGGAAGGAAACACCAGG + Intergenic
961785240 3:129343515-129343537 GGGGCTAGGAAGGAAACACCAGG - Intergenic
963359595 3:144253808-144253830 GAGGCTGGGAAGGATAGTAGGGG - Intergenic
964523772 3:157595276-157595298 GATGAGAGGAAGGAAATTAGAGG + Intronic
964912081 3:161795060-161795082 CAGGTTAGAAAGAAAATTACAGG + Intergenic
965011687 3:163101220-163101242 GAGGGTAGGATGGAAATCATCGG + Intergenic
965630951 3:170732032-170732054 GAAGTTGGGAAGGAAATTATAGG + Intronic
966433835 3:179861313-179861335 GAGGCTAAGGAGGAAGTTATAGG + Intronic
967591379 3:191278619-191278641 GATGCTTTGAAGGAAATTCCCGG - Intronic
969752045 4:9118970-9118992 GAAGTGAGGAAGGAAAGTACTGG + Intergenic
970878214 4:20897276-20897298 GTGGCAAGGAAAGAAATTAGAGG - Intronic
973216642 4:47676483-47676505 GAGGCTAAGAAGGGAAATTCAGG - Intronic
974095822 4:57362655-57362677 GAGACTAGCAAGGAAATAGCAGG - Intergenic
975978547 4:80127818-80127840 GAGGCTTTGAAGAAAATAACAGG - Intergenic
977440285 4:97057602-97057624 GATGCTAGAAAAGAAATTTCTGG + Intergenic
978097559 4:104796880-104796902 GAGGCTAGGAAGGACAGTTGGGG - Intergenic
978400182 4:108322865-108322887 GAGGCTGGGAAGGATAGTAGAGG + Intergenic
981940917 4:150280781-150280803 GAGGCGAGGAAGGAAGCCACAGG - Intronic
982440898 4:155434538-155434560 GAGCCCAGGAAGGAAACTTCTGG - Intergenic
987617226 5:20291955-20291977 GAGGCTAGGAAGGAAATTACGGG - Intronic
988491187 5:31706866-31706888 AGGTCTAGGAAGGAAATGACAGG - Intronic
989050379 5:37314416-37314438 GGGGCTAGGAAGAAAACAACAGG - Intronic
990661575 5:58021492-58021514 GATGCTAGAAAGGAAAATATTGG - Intergenic
990903321 5:60777087-60777109 GAGGCTAGGAAGGGTACTAGGGG + Intronic
991133856 5:63157557-63157579 GAGGCTAAGGATGAAATAACTGG - Intergenic
993231682 5:85245872-85245894 TAGGCTAAGAAGGGAGTTACAGG - Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
995963068 5:117868395-117868417 CAGCCTAGGGAGGATATTACAGG - Intergenic
997060463 5:130495359-130495381 GAGGCTGGGAAGGGAAGTAGGGG + Intergenic
999202400 5:149825602-149825624 AAGGCTAGGAAGAAAATAAAAGG - Intronic
999741620 5:154559317-154559339 GAGGCTCTGAAAGAAATGACGGG - Intergenic
1000838131 5:166181267-166181289 GAGGCTAGAAAGGAGATTTCAGG - Intergenic
1001326046 5:170725509-170725531 GAGGCTGGGAAGGATAGTAGGGG + Intronic
1002010014 5:176271565-176271587 GAGGCTAGGAAGGGGAGTAGGGG + Intronic
1002216720 5:177640739-177640761 GAGGCTAGGAAGGGGAGTAGGGG - Intergenic
1003501295 6:6705075-6705097 GAGCCTAGTAAGGAAAATAAAGG + Intergenic
1007617126 6:43186723-43186745 GAGGCTAGGAAGGAATGTCGAGG + Intronic
1008806524 6:55436044-55436066 GAGTCTAGGAAGGACAATAATGG + Intronic
1009038746 6:58151643-58151665 GAGACTGGGAAGGGAATTCCTGG - Intergenic
1009214637 6:60906500-60906522 GAGACTGGGAAGGGAATTCCTGG - Intergenic
1009845513 6:69129868-69129890 GAGTCTAGGAAAGATATTCCAGG - Intronic
1011535577 6:88372418-88372440 GAGAGTAGGAAGGAAATTAAGGG + Intergenic
1012373813 6:98537397-98537419 GAGGGAAGGAAGGAAATGAAAGG + Intergenic
1013549638 6:111194856-111194878 GAGCCTAGCAAGGAAATATCTGG - Intronic
1014864744 6:126514912-126514934 GAGGCTGGGAAGGGAAGTAGGGG - Intergenic
1015219351 6:130786395-130786417 GAGGCTGGGAAGGGAAGTACGGG - Intergenic
1015911154 6:138168836-138168858 AACGCCAGGAAGGAAAATACAGG - Intronic
1016728003 6:147397375-147397397 CAGGCTAAGAAGGAAATGAAGGG - Intergenic
1017496402 6:154987536-154987558 GAGGCTTGGAAGGAAGTCAAAGG + Intronic
1018463221 6:164018747-164018769 GAGGAGAGGATGGGAATTACAGG - Intergenic
1021650589 7:22829045-22829067 GAGATAAGGAAGGGAATTACTGG + Intergenic
1021664350 7:22960573-22960595 GAGGCTAAGAGGGAAATTCATGG + Intronic
1021879086 7:25076534-25076556 GAGGCTAGGAACCAACTTCCTGG - Intergenic
1022052516 7:26691764-26691786 GAGGATAAGAAGGATATTTCCGG + Intronic
1022486371 7:30781362-30781384 TAGGCAAGGATGGAAAATACTGG + Intronic
1022821004 7:33961010-33961032 GAGGCAAGGAAGGAAAGTTTGGG + Intronic
1023622024 7:42083191-42083213 GAGGCTAGGAAGGATAGTGGGGG - Intronic
1026165724 7:67907563-67907585 GAGGCTAGGAGGATACTTACAGG - Intergenic
1028289770 7:89050266-89050288 GAGACCAGAAAGGAAATTATAGG - Intronic
1028768832 7:94591706-94591728 GAGGCTAGAAAAGAAACGACAGG - Intronic
1030547616 7:110917207-110917229 GAGGCAAGGAAGGGAATCTCTGG + Intronic
1030989770 7:116286431-116286453 GAGGCTAGGAAGGAGAAGAAAGG + Intergenic
1031014315 7:116556708-116556730 AAGGTTAGGAAGCAATTTACCGG - Intronic
1031277458 7:119747029-119747051 AAGCCTAGGAGGGAAATTGCTGG - Intergenic
1032501118 7:132400671-132400693 GAGGCTAGGAAGTAAATGCGTGG - Intronic
1035028240 7:155841042-155841064 CAGGCAAGGAAGGAAAGAACGGG - Intergenic
1037484394 8:19333832-19333854 AAGGCCAGGAAGGAAAGTGCAGG + Intronic
1038119463 8:24596350-24596372 GAGGCTATGCAGTAAGTTACTGG - Intergenic
1038181495 8:25232937-25232959 GAGGCTAAGAAAAAAATCACTGG - Intronic
1042263587 8:66885753-66885775 GAGGGAAGGAGGGAAATTTCTGG - Intronic
1043478153 8:80625523-80625545 GAGGTTGGGAAGGAAATGATTGG - Intergenic
1043796527 8:84548873-84548895 TTTGCTTGGAAGGAAATTACTGG + Intronic
1044957540 8:97496956-97496978 GAGGCTAGGAAGTACAGTGCTGG + Intergenic
1046077418 8:109330135-109330157 ATGCCTAGGAAGGAAATTGCCGG + Intronic
1047936479 8:129785381-129785403 GAGGCTGGGAAAGATATTAGGGG + Intronic
1051154812 9:14130118-14130140 GAGACTAGGAAGAAAATTTTTGG - Intronic
1053091107 9:35277672-35277694 GAGGCTAGGAAAGAATTAATGGG + Intronic
1054909254 9:70438842-70438864 GAGGCTGGGAAGGAAGGTTCTGG + Intergenic
1055012027 9:71577595-71577617 GAGGCTGGGAAAGCAATTATTGG - Intergenic
1056241280 9:84649168-84649190 GAGGCTGGGAAGGAAAGGAAAGG - Intergenic
1056696854 9:88864815-88864837 GAGGAAAGGAAGGAAATAAAAGG + Intergenic
1056815653 9:89799014-89799036 GATGCTGGGAAGGAAAGTGCAGG + Intergenic
1057111516 9:92476584-92476606 TATGCTAGGAAGGAGGTTACAGG + Intronic
1058085257 9:100741280-100741302 GAGGCTGGGAAGGAAAGTTGGGG - Intergenic
1059025392 9:110622434-110622456 GAGGCAAGGAAATAAATAACTGG - Intergenic
1059631266 9:116125355-116125377 GAGGCTGGGAAGGGTATTAGGGG - Intergenic
1060088870 9:120725470-120725492 GATTCTAGGAGGGAAATTCCTGG - Intergenic
1060899879 9:127247926-127247948 GAGGCTGGGAAGGATAGTAGGGG - Intronic
1061901764 9:133676524-133676546 GAGGCTAGGAACTAAGTGACCGG + Intronic
1185822971 X:3222316-3222338 GAAGCTTGGAGGGATATTACTGG + Intergenic
1186252526 X:7683885-7683907 GTGCTTAGGAAGGGAATTACTGG + Intergenic
1187243913 X:17537436-17537458 CAGGCTAGGAAGCATATTACTGG - Intronic
1187470805 X:19568089-19568111 GAGGCTGGGAAGGGTAGTACAGG + Intronic
1193192398 X:78586713-78586735 GAGGCTGGGAAGGGAAATAGAGG - Intergenic
1193794213 X:85853314-85853336 GAGGATAGGAAAAAAATTACAGG - Intergenic
1195634980 X:107103833-107103855 GAGGGTAGGATGGGAATTACTGG + Intronic
1195940658 X:110165007-110165029 AAGGTAAGGAAGGAAATTCCAGG - Intronic
1199367862 X:147008187-147008209 GAGGCTAGGAAGGATAATGGGGG - Intergenic
1200374723 X:155767610-155767632 GAGGAGGGGAAGGAAAATACTGG + Intergenic