ID: 987617231 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:20291979-20292001 |
| Sequence | TGGACATGATGACATGACAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 236 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 25, 4: 210} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987617231_987617233 | 23 | Left | 987617231 | 5:20291979-20292001 | CCTCTGTCATGTCATCATGTCCA | 0: 1 1: 0 2: 0 3: 25 4: 210 |
||
| Right | 987617233 | 5:20292025-20292047 | AAACTCTCTGAAGCTTTAAGTGG | 0: 1 1: 0 2: 2 3: 13 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987617231 | Original CRISPR | TGGACATGATGACATGACAG AGG (reversed) | Intronic | ||