ID: 987617231

View in Genome Browser
Species Human (GRCh38)
Location 5:20291979-20292001
Sequence TGGACATGATGACATGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987617231_987617233 23 Left 987617231 5:20291979-20292001 CCTCTGTCATGTCATCATGTCCA 0: 1
1: 0
2: 0
3: 25
4: 210
Right 987617233 5:20292025-20292047 AAACTCTCTGAAGCTTTAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987617231 Original CRISPR TGGACATGATGACATGACAG AGG (reversed) Intronic