ID: 987618341

View in Genome Browser
Species Human (GRCh38)
Location 5:20305474-20305496
Sequence CGCTGCACTCGCTGGGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987618332_987618341 6 Left 987618332 5:20305445-20305467 CCATGTTTTCGAACCTCCTCAGC 0: 1
1: 2
2: 0
3: 6
4: 247
Right 987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG 0: 3
1: 0
2: 1
3: 7
4: 85
987618334_987618341 -7 Left 987618334 5:20305458-20305480 CCTCCTCAGCGGCCGCCGCTGCA 0: 1
1: 3
2: 4
3: 48
4: 587
Right 987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG 0: 3
1: 0
2: 1
3: 7
4: 85
987618335_987618341 -10 Left 987618335 5:20305461-20305483 CCTCAGCGGCCGCCGCTGCACTC 0: 1
1: 3
2: 0
3: 26
4: 325
Right 987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG 0: 3
1: 0
2: 1
3: 7
4: 85
987618331_987618341 22 Left 987618331 5:20305429-20305451 CCTTCTCGGCTTTTGGCCATGTT 0: 1
1: 0
2: 2
3: 11
4: 127
Right 987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG 0: 3
1: 0
2: 1
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987618341 Original CRISPR CGCTGCACTCGCTGGGTCTT GGG Intronic
900612612 1:3550743-3550765 GGCTGCAAGGGCTGGGTCTTCGG - Intronic
902847236 1:19121309-19121331 CGCTGCACTGGCAGCCTCTTCGG - Exonic
903517839 1:23924240-23924262 CGCTGGACTGGCTGGGTCACTGG + Intergenic
904556244 1:31366649-31366671 GGCTGCTCTCCCTGGGTCTGGGG + Intronic
908543986 1:65147433-65147455 CGCAGCCCTCGCTGGGTCGCAGG + Intergenic
910251537 1:85202101-85202123 CGCTGCACGAGGTGTGTCTTAGG + Intergenic
916577748 1:166082290-166082312 CACTGGACTTGCTGGGCCTTTGG + Intronic
919578682 1:199343386-199343408 CAATGCACTCCCTGTGTCTTAGG + Intergenic
923741682 1:236660278-236660300 CTCTGCACTCGCAGGTTCTTTGG + Intergenic
923755178 1:236785468-236785490 CTCTGCACTCTCTGGGGCCTGGG + Intergenic
1065926129 10:30434738-30434760 AGCTGCACTCACCGGGTCTCGGG - Intronic
1066052552 10:31648874-31648896 CACTGGCCTCGCTGGGTCTGCGG - Intergenic
1067098368 10:43317090-43317112 GGCTGCACTTGCTGGGGCTCTGG - Intergenic
1067205680 10:44210027-44210049 CGCTGCAGTGTCTGGGCCTTAGG + Intergenic
1067278458 10:44853981-44854003 TGCTGCCCACTCTGGGTCTTTGG + Intergenic
1070431983 10:76349536-76349558 CGCTGCACTTCCTGGTTATTTGG + Intronic
1073535722 10:104275094-104275116 CACTGCCCTCTCTGGGACTTGGG + Intronic
1073827174 10:107337140-107337162 AGCTGCACTCTCTGGGTTTGGGG + Intergenic
1074112086 10:110429859-110429881 CTCTGCACTCGCTGAGTGCTTGG + Intergenic
1078549574 11:12270926-12270948 CGCGGCACTCCCTGGTTCTGCGG - Intergenic
1083487767 11:62994410-62994432 CCCTGCACTCTCTGGGGCTCAGG - Intronic
1083854543 11:65386345-65386367 GCCTGCCCACGCTGGGTCTTCGG - Intergenic
1084172599 11:67407714-67407736 AGCTGGACTCCCTGTGTCTTTGG + Intronic
1089808523 11:121113248-121113270 CGCTGCACTCTCTGCTTCTGTGG + Intronic
1091710786 12:2738565-2738587 AGCTGCAATAGCAGGGTCTTTGG - Intergenic
1092048959 12:5454525-5454547 CCCTGCACTCTGTGGGTGTTTGG - Intronic
1103580099 12:121908532-121908554 CGCTGCACATGCTGGGTCCTGGG + Intronic
1105604845 13:21918564-21918586 CTCTGCACTCACTCGGTTTTTGG + Intergenic
1113737428 13:112689041-112689063 CGCTGCCCCGTCTGGGTCTTAGG - Intergenic
1114405343 14:22451171-22451193 CCCTGCCCTGGCTGGGACTTTGG + Intergenic
1117039872 14:51760065-51760087 CGCGGCCCCCGCTGGCTCTTAGG - Intergenic
1118299367 14:64601671-64601693 CGCTGCACTCGCTGGGTCTTGGG + Intergenic
1119207051 14:72802237-72802259 CTCTGCACTCGCTGGTCCTGTGG - Intronic
1121676650 14:95758971-95758993 CGCTGCCCTGGCTGGGACTTGGG + Intergenic
1122271629 14:100570925-100570947 CGCGGCGCTGCCTGGGTCTTGGG + Intronic
1125499151 15:40227551-40227573 CCCTGGACTCGCTGGGACTCTGG - Intergenic
1132558009 16:580925-580947 CGCTGTACTCACTGGGTCTTCGG + Exonic
1132977994 16:2720042-2720064 CGCTGCACTGCCTGGGGCTCCGG - Intronic
1134615910 16:15650795-15650817 CGCTGCAATCGAGGGGTCTGGGG - Intronic
1152112980 17:78367342-78367364 CACTGTACTCACTGGGCCTTAGG + Intergenic
1152187763 17:78868896-78868918 CGCTCCAGTCGCGGGGTCTCTGG - Intronic
1165399042 19:35586045-35586067 GGCTGCACTCTCTGTGTCTTGGG + Intergenic
1165772148 19:38386100-38386122 GGCCGCACTCTCTGGGCCTTGGG - Exonic
927647670 2:24888265-24888287 CTGTGCACTGGCTGGGTTTTGGG + Intronic
929983138 2:46699310-46699332 CGCTGCGCTCGCTGGGCAGTCGG + Intronic
936557933 2:113512089-113512111 CTCTCCCCTCCCTGGGTCTTGGG - Intergenic
948929779 2:241124500-241124522 CCCTACACACGGTGGGTCTTCGG + Intronic
1182114351 22:27746814-27746836 CTCTGCAGTCACTGGGTCTCCGG - Intergenic
1184531853 22:45061405-45061427 CGCTAGACTCTCAGGGTCTTGGG - Intergenic
956710449 3:72034606-72034628 GAGTGGACTCGCTGGGTCTTAGG + Intergenic
957086575 3:75684889-75684911 CGCTGCCCTCGCAGAGTCTGGGG - Intergenic
958675679 3:97265608-97265630 CTCTGCACCCTCGGGGTCTTGGG - Intronic
962277882 3:134029717-134029739 CGCTGTGCCCGCTCGGTCTTCGG - Exonic
962389709 3:134960947-134960969 AGCTGGAGTCACTGGGTCTTAGG + Intronic
966256129 3:177918031-177918053 CTCTGCTCTCGCTGAGTCTGGGG - Intergenic
968082076 3:195853387-195853409 AGCTGCCCTCGCTGGAACTTGGG + Intergenic
970967413 4:21944479-21944501 CGCTGCAATCTCTGCCTCTTGGG - Intronic
971236300 4:24845228-24845250 CGCTCCCCTCACAGGGTCTTTGG + Intronic
971684410 4:29746404-29746426 GGCTGGACTCCCAGGGTCTTGGG + Intergenic
978711903 4:111792856-111792878 CCCTGCACTGCCTGGCTCTTGGG + Intergenic
985781037 5:1872022-1872044 AGCTGCCCTGGCTGGGTCCTGGG + Intergenic
985890933 5:2714853-2714875 TGCTGCCCCAGCTGGGTCTTTGG + Intergenic
985935662 5:3095906-3095928 CAATGCACATGCTGGGTCTTTGG + Intergenic
986276020 5:6275747-6275769 AGCTGCTCTCTCTGGGTCCTGGG - Intergenic
987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG + Intronic
992370229 5:76135991-76136013 TGCTTCACTGGATGGGTCTTAGG - Intronic
996088637 5:119329071-119329093 TGCGGCACTCGCTGGGTCCTAGG - Intronic
997212166 5:132083245-132083267 CCCTGCCCTCTCTGGGCCTTGGG - Intergenic
999712676 5:154332351-154332373 CCCTGCTGTGGCTGGGTCTTTGG - Intronic
1004243512 6:13950870-13950892 CACTGCAATCTCTGGCTCTTGGG + Intronic
1005371650 6:25139952-25139974 CGCTGCACTCGCTGGGTCTTGGG - Intergenic
1006985619 6:38173695-38173717 CACTGCAGTCCTTGGGTCTTCGG - Exonic
1007745932 6:44042911-44042933 AGCTGCTCTCGCTGGGGCTGGGG - Intergenic
1017819519 6:158039292-158039314 CGCTGCCCTCCCTGGCTCTGCGG + Intronic
1019616208 7:1963725-1963747 CGCTGCCCTCCCTGGGTGTCTGG + Intronic
1019701242 7:2475884-2475906 CCCTCCCCTCGCTGGGCCTTGGG - Intronic
1019934605 7:4246164-4246186 CACTGCAGTCTCTGGGACTTAGG - Intronic
1032642760 7:133788064-133788086 CACTGCACTTGCTGGGTTCTTGG + Intronic
1035266753 7:157693508-157693530 CGCTGCGGTCGCAGGGCCTTGGG + Intronic
1036216665 8:6885160-6885182 TGCTGCACTTGCTGTGTCTCTGG - Intergenic
1045071252 8:98506746-98506768 AGCTGCATTCGTTGAGTCTTTGG - Intronic
1045224703 8:100232936-100232958 CTGTGCACTCGCTGTGTCCTTGG + Intronic
1046949322 8:120004809-120004831 AGATGAACTCACTGGGTCTTGGG - Intronic
1048978725 8:139691246-139691268 CCCTGCACTGGCTGTGTCTGGGG + Intronic
1051170308 9:14314295-14314317 CGCCGCCCGCGCCGGGTCTTCGG + Intronic
1054691223 9:68322632-68322654 CTCTCCCCTCCCTGGGTCTTGGG - Intergenic
1057388988 9:94627537-94627559 CGCTGCATTCGCTAGGGCTCAGG - Intronic
1057524141 9:95784412-95784434 CGCTGCCCACGCGGGGTCGTGGG + Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1058550687 9:106111558-106111580 TGCTGCACACTCTGGGCCTTGGG + Intergenic
1060531010 9:124346992-124347014 CTCTGCACTCGCTGTGTCTCTGG - Intronic
1062207810 9:135346924-135346946 GTCTGGACTCGCTGGGTCTTTGG - Intergenic
1203778460 EBV:87426-87448 CGCTTCACTGGGTGCGTCTTGGG - Intergenic
1198711101 X:139505237-139505259 CCCTGCACAGGCTGGTTCTTTGG + Intergenic
1199601025 X:149541160-149541182 CGGTGGCCTCGCTGGGTCTCGGG + Exonic
1200409475 Y:2847153-2847175 CTCTGAACTCGCTGTGTCCTTGG - Intronic