ID: 987619519

View in Genome Browser
Species Human (GRCh38)
Location 5:20322260-20322282
Sequence CATTATGAACAATTGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987619519 Original CRISPR CATTATGAACAATTGGTGTT TGG (reversed) Intronic
905966171 1:42098077-42098099 CAGTGTGAACATGTGGTGTTTGG - Intergenic
908373420 1:63506653-63506675 CATTAGGAACACTGGGAGTTAGG + Intronic
909219256 1:72933848-72933870 AATTTTAAACAAATGGTGTTTGG + Intergenic
909499015 1:76312187-76312209 CCTAATTAACAAATGGTGTTGGG + Intronic
909813869 1:79965505-79965527 CCTACTTAACAATTGGTGTTGGG - Intergenic
913013001 1:114703095-114703117 TATTATAAACTACTGGTGTTGGG - Intergenic
916048094 1:161015824-161015846 CATTAGAAACTATTGGGGTTTGG + Intronic
916437237 1:164788437-164788459 CACTATTAAGAATGGGTGTTGGG - Intronic
917983936 1:180295581-180295603 CAAAATGAACAAATGCTGTTGGG - Intronic
920140354 1:203806601-203806623 CATTAAGAAAAAAAGGTGTTAGG - Intronic
922672964 1:227527716-227527738 CATTTTCAACACATGGTGTTGGG - Intergenic
1063555765 10:7078115-7078137 CATGATGAACAACTTGGGTTTGG + Intergenic
1064467362 10:15597666-15597688 CATTATGATCATTTTGTTTTTGG - Intronic
1065175781 10:23073544-23073566 CATGATGAACAATAGGCGTCTGG - Intergenic
1065465911 10:26021698-26021720 CATGATGAACACTTGGTGGCTGG - Intronic
1065473884 10:26113168-26113190 CATTTTTAAAAATTGGTTTTAGG + Intronic
1067846759 10:49729991-49730013 CCTAATCAACAAATGGTGTTGGG + Intergenic
1068979684 10:63049120-63049142 CAGTCTTAACAAATGGTGTTGGG + Intergenic
1070578443 10:77698656-77698678 AATTATGAACAATTTGTGTATGG - Intergenic
1071485077 10:86095114-86095136 CATTTTCAACAATTGGTGCTGGG + Intronic
1071804215 10:89099096-89099118 CATTGGGGCCAATTGGTGTTGGG - Intergenic
1075982348 10:126751094-126751116 CATTTTCAACAAATGGTGCTGGG - Intergenic
1076578410 10:131489244-131489266 CATTTTCAACAAATGGTGCTGGG + Intergenic
1078742088 11:14076301-14076323 CATTTAGAGCAATTAGTGTTTGG + Intronic
1079641977 11:22816770-22816792 CATTTTCAACAAATGGTGCTGGG - Intronic
1080366514 11:31580203-31580225 CTGGAAGAACAATTGGTGTTTGG - Intronic
1083390407 11:62345567-62345589 CCTTTTCAACAATTGGTGCTGGG - Intronic
1086211994 11:84331877-84331899 GTTTCTGAAAAATTGGTGTTGGG + Intronic
1086641196 11:89157967-89157989 CATTTTCAAGACTTGGTGTTGGG - Intergenic
1088450545 11:109977226-109977248 CATTATAACCACTTGTTGTTTGG + Intergenic
1091857908 12:3753755-3753777 CATGAAGAACAGCTGGTGTTTGG - Intronic
1092598998 12:10038203-10038225 TATTATTAAGAATTGGTTTTTGG + Intronic
1093792441 12:23268348-23268370 CATTATCAACAAATGAAGTTTGG + Intergenic
1095560439 12:43558484-43558506 CATTTTCAACAAATGGTGCTGGG - Intergenic
1096841616 12:54383354-54383376 CATGGTGACCAACTGGTGTTTGG - Intronic
1096935443 12:55268843-55268865 CAATATCAAGAATTGGGGTTTGG + Intergenic
1097893628 12:64802729-64802751 GATTAAGAACATGTGGTGTTTGG + Intronic
1097939988 12:65293687-65293709 CATTATGAACAAGTGCAGTAAGG - Intronic
1098787252 12:74775723-74775745 AATTATGAACCTTTGGTCTTTGG + Intergenic
1100960172 12:99954513-99954535 AATTGTGAACAATTGGTCATTGG - Intronic
1102255185 12:111410879-111410901 CTCTATGAACAGTTGGTGCTAGG + Intronic
1102784497 12:115593256-115593278 CATTGGGAACAGGTGGTGTTTGG + Intergenic
1104313968 12:127679899-127679921 AATTTGGTACAATTGGTGTTTGG - Intergenic
1105827106 13:24132647-24132669 CATTAAGAAAATGTGGTGTTTGG + Intronic
1106089600 13:26578373-26578395 AATTACGAACAATTTATGTTAGG - Intronic
1107067457 13:36230441-36230463 TATTGTGAACAATTGCAGTTTGG + Intronic
1107449916 13:40498934-40498956 CATTAAGTAAAACTGGTGTTAGG + Intergenic
1109478000 13:62910201-62910223 CATTGTCAACAAATGGTGCTGGG + Intergenic
1110325895 13:74215091-74215113 CATTATCAAAAATTAGTGTAAGG - Intergenic
1112035102 13:95489949-95489971 CATTTTCAATAAATGGTGTTGGG - Intronic
1112756182 13:102636453-102636475 CATAATAAAGAATTGCTGTTTGG + Intronic
1113170599 13:107498364-107498386 GATTAAGAACAATTTATGTTGGG + Intronic
1114934814 14:27520947-27520969 CATTTTTAACAAATGGTATTAGG - Intergenic
1116985950 14:51220558-51220580 CAGTAAGAACATGTGGTGTTTGG + Intergenic
1117191258 14:53293967-53293989 CTTTGTGCATAATTGGTGTTCGG + Intergenic
1119688556 14:76652757-76652779 CATTGTGAACTATGGGTTTTGGG - Intergenic
1120059400 14:79964506-79964528 CATTTTGAACCATTGTTATTTGG + Intergenic
1122014357 14:98781388-98781410 TATTTTGAACAATTGATGATTGG - Intergenic
1123779506 15:23612275-23612297 AACAATGAACAATTCGTGTTGGG + Intronic
1123898488 15:24851750-24851772 CATTATGAGGAATTGGTTCTAGG + Intronic
1124073481 15:26419069-26419091 CGTTTTCAACAAATGGTGTTGGG + Intergenic
1124897240 15:33788593-33788615 CAGCAGGAACCATTGGTGTTGGG - Intronic
1125547967 15:40522189-40522211 TATTTTTAACAAATGGTGTTGGG - Intergenic
1126205654 15:46042049-46042071 CATTATGAACAGTTAGGGATGGG + Intergenic
1126275705 15:46877636-46877658 CCTTATGATCAATTAGTTTTTGG + Intergenic
1126289918 15:47062754-47062776 CCTTATGAACAAATGAAGTTGGG + Intergenic
1128757057 15:70190244-70190266 CATTAGGAAAAATTCCTGTTTGG - Intergenic
1130973484 15:88754638-88754660 CAGTCTCAACCATTGGTGTTTGG + Intergenic
1131705918 15:94995968-94995990 AATTATGTACAATTGATATTTGG - Intergenic
1133725698 16:8535469-8535491 CATAATGAATAATTGCAGTTTGG + Intergenic
1137258128 16:46795030-46795052 TATCATCAACAAATGGTGTTGGG + Intergenic
1145692571 17:26758346-26758368 CTTTATGCATAATTGGTTTTTGG - Intergenic
1145732360 17:27200387-27200409 AATTATGAACATTTGCTGTTTGG - Intergenic
1146152140 17:30483225-30483247 TATTGTGAAGAATTAGTGTTTGG + Intronic
1148448868 17:47760807-47760829 GATTATACAGAATTGGTGTTAGG + Intergenic
1149019787 17:51950010-51950032 AATTAGGAACAATTAGTATTGGG + Intronic
1149121910 17:53179418-53179440 ATTTAGGAACAAGTGGTGTTTGG + Intergenic
1149751404 17:59149011-59149033 CCTTATCAACACTTGGTATTAGG - Intronic
1151050072 17:70967980-70968002 CAATATAAACAAATGCTGTTGGG + Intergenic
1153175698 18:2370418-2370440 TATTCTGAACAATTAGTGTTTGG + Intergenic
1164319681 19:24132363-24132385 CCTTTTCAACAATTGGTGCTGGG - Intergenic
1164955620 19:32380964-32380986 AATTATGAATAATTGGTGATAGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165298847 19:34954341-34954363 TCTTTTGAACAAATGGTGTTAGG + Intergenic
1165911132 19:39228616-39228638 CCTTTTCAACAAATGGTGTTTGG + Intergenic
1167118985 19:47505554-47505576 GATTTTTAACAATTGGGGTTTGG + Intronic
925125397 2:1451576-1451598 CATCATGGACAACTGGTATTGGG - Intronic
927288470 2:21380850-21380872 CTTTTTCAACAACTGGTGTTGGG + Intergenic
931877556 2:66530157-66530179 CATTTGGAAAAATTGCTGTTGGG + Intronic
933155598 2:78969674-78969696 CATTATAAACATCTTGTGTTGGG - Intergenic
935243339 2:101196831-101196853 CATGCTGAACCATTGGGGTTTGG - Intronic
935454318 2:103249656-103249678 CATTCTGAACACTAGGAGTTAGG + Intergenic
936517311 2:113190246-113190268 CTTTTTCAACAAATGGTGTTGGG - Intronic
942910959 2:181244231-181244253 CATTATGCACAGTGGTTGTTAGG - Intergenic
1169335683 20:4754374-4754396 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1170862744 20:20123485-20123507 CCTTATCAACAAATGGTGCTGGG - Intronic
1170964723 20:21056822-21056844 CATTTTGAACAGTGTGTGTTCGG + Intergenic
1171192927 20:23172669-23172691 CATTTTCAACAAATGGTGCTAGG - Intergenic
1171200829 20:23240939-23240961 CTTAAAAAACAATTGGTGTTTGG + Intergenic
1172078517 20:32318649-32318671 AATAAAGAACAATTGATGTTGGG - Intronic
1173299873 20:41793026-41793048 AGATATGAATAATTGGTGTTTGG + Intergenic
1174315282 20:49695144-49695166 GATTATGAAAAATTGGAGTTAGG - Intronic
1175510742 20:59523700-59523722 CCTTACAAATAATTGGTGTTTGG - Intergenic
1175629519 20:60523030-60523052 CATTTTCAACAAATGGTGCTGGG + Intergenic
1177460142 21:21398170-21398192 GAGTATGAACATTTGATGTTTGG - Intronic
1177548703 21:22593413-22593435 CCTTATCAACAAATGGTGCTGGG + Intergenic
1178450411 21:32693217-32693239 CATGATCAACAGTGGGTGTTTGG - Intronic
1180970620 22:19813114-19813136 CAATATGAACAACGAGTGTTTGG + Intronic
1184941810 22:47773397-47773419 GATTTTCAACAAATGGTGTTGGG + Intergenic
949528082 3:4925909-4925931 CCTTTTCAACAAATGGTGTTGGG + Intergenic
950911434 3:16598394-16598416 CATTATGAATAATGGGATTTGGG - Intronic
952027611 3:29101728-29101750 CATTATAAACATTTTATGTTAGG - Intergenic
953089527 3:39710360-39710382 GATTATGACCAATAGCTGTTAGG - Intergenic
953539874 3:43808229-43808251 CCTTTTCAACAAATGGTGTTGGG + Intergenic
956940508 3:74155653-74155675 CCTTAGGAAAAATAGGTGTTAGG - Intergenic
957685159 3:83494530-83494552 CATTTTCAACAAATGGTGTTGGG + Intergenic
957846653 3:85745198-85745220 CATTATGAACAATTATTTTATGG - Intronic
957846739 3:85746158-85746180 CATTATGAACAATTATTTTATGG + Intronic
958447273 3:94231325-94231347 CATTGTGAAAATTTGATGTTTGG - Intergenic
958525133 3:95247789-95247811 CATTATGAACAAGTTTTGTGTGG + Intergenic
959508455 3:107180890-107180912 CTTGATGGACAATTGGTTTTTGG + Intergenic
959643094 3:108663800-108663822 CAAAATGAACATTTCGTGTTGGG + Intronic
960332049 3:116372325-116372347 CAGTATTAACAAATGGTGCTGGG + Intronic
964194753 3:154049619-154049641 AATTAAGAACATGTGGTGTTTGG + Intergenic
965591369 3:170363024-170363046 CATTTTAAACACTTAGTGTTAGG - Intronic
967745278 3:193048084-193048106 AATTCAGAACAATTGCTGTTGGG - Intergenic
969164291 4:5293024-5293046 AAGTGTGAACATTTGGTGTTTGG + Intronic
970639767 4:18051186-18051208 CATCATTATCAATTGGTTTTGGG - Intergenic
972448621 4:39172832-39172854 TTTTTTCAACAATTGGTGTTGGG - Intergenic
973001328 4:44955173-44955195 AATTAAGAACATGTGGTGTTTGG + Intergenic
974945996 4:68529679-68529701 GAGTGAGAACAATTGGTGTTTGG - Intergenic
975757208 4:77582749-77582771 CAATATGAAGAATTGGTGCAGGG + Intronic
977418997 4:96773710-96773732 CATTATGAGCAATTTCTGTGAGG - Intergenic
977834034 4:101627941-101627963 CTTTTTGAACAAATGGTGCTGGG - Intronic
977883098 4:102228678-102228700 CATTAGGAACAGTTAGTATTTGG - Intergenic
978024213 4:103851578-103851600 CAGTAAGAACATGTGGTGTTTGG - Intergenic
978462808 4:108976318-108976340 CATTTTCAAGAAATGGTGTTTGG - Intronic
978777714 4:112519751-112519773 GAGTATGAACAGTTGGTCTTTGG - Intergenic
979066441 4:116141630-116141652 GATTATGAACAGTTTTTGTTAGG + Intergenic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
982528970 4:156514467-156514489 CTCTATGAACAATCTGTGTTTGG - Intergenic
983052671 4:163067097-163067119 CCTTTTCAACAATTGGTGCTGGG + Intergenic
983246824 4:165297333-165297355 CCTTATAAACAATTCATGTTTGG - Intronic
986168981 5:5300330-5300352 CATTATGAAAAATTGATTCTTGG - Intronic
987619519 5:20322260-20322282 CATTATGAACAATTGGTGTTTGG - Intronic
987778187 5:22396681-22396703 CAATATGACCCATTGGAGTTTGG - Intronic
994050291 5:95355020-95355042 CTTTATGAACAATTGCTATTTGG + Intergenic
996809519 5:127500284-127500306 TGTTATGAACACATGGTGTTGGG - Intergenic
998959986 5:147475553-147475575 CATTTTGAGCAATTTGTTTTAGG - Intronic
999346745 5:150829186-150829208 CATTCTGGACAATTGGCTTTGGG + Intergenic
1000363505 5:160469533-160469555 CGTTATTAACAATGGGTTTTTGG + Intergenic
1000861742 5:166464114-166464136 CATTTTCAACAAATGGTGCTGGG - Intergenic
1001969673 5:175944611-175944633 CCTTCTTAACAAATGGTGTTAGG + Intronic
1002247761 5:177899154-177899176 CCTTCTTAACAAATGGTGTTAGG - Intergenic
1002768797 6:269421-269443 TATTTTCAACAAATGGTGTTGGG - Intergenic
1003124708 6:3346999-3347021 AAATATGAACACTGGGTGTTTGG - Intronic
1005314568 6:24592262-24592284 TATTTTCAACAAATGGTGTTAGG - Intronic
1005909600 6:30296977-30296999 CATTAAGAGCAATTTCTGTTTGG - Intergenic
1007305982 6:40905245-40905267 CACTATGAACATTTTGTCTTTGG - Intergenic
1007320600 6:41026361-41026383 CATTTTGAGAAATTGGAGTTGGG + Intergenic
1007891963 6:45303027-45303049 CCTATTGAACAAATGGTGTTGGG + Intronic
1008520383 6:52357444-52357466 CATTATCACTTATTGGTGTTGGG - Intergenic
1009347619 6:62635451-62635473 CATTAAGAACCACTGGTCTTGGG - Intergenic
1009362572 6:62833672-62833694 GAATAAGAACAATTGATGTTTGG + Intergenic
1009790604 6:68396949-68396971 CATTTTCAACAAATGGTGCTAGG + Intergenic
1011164976 6:84436692-84436714 AAGTAAGAACAAGTGGTGTTTGG - Intergenic
1011815325 6:91183100-91183122 CATTTTAAACAATTGAGGTTTGG - Intergenic
1011898670 6:92264166-92264188 CACTGTGAACCAATGGTGTTTGG + Intergenic
1011945819 6:92901473-92901495 CATTATGAACAATTATTTATAGG - Intergenic
1012214048 6:96560046-96560068 CAGTAAGAACATGTGGTGTTTGG - Intergenic
1012978984 6:105810420-105810442 CACTCTGAACATCTGGTGTTTGG - Intergenic
1013384682 6:109614429-109614451 CAATATGAAAAAATGGAGTTTGG - Exonic
1014285451 6:119492086-119492108 CATTTTCAACAAATGGTGCTGGG + Intergenic
1016197047 6:141357043-141357065 CCTTATCAACAAATGGTGCTGGG - Intergenic
1016289568 6:142513826-142513848 CATATTCAACAAATGGTGTTGGG - Intergenic
1017190086 6:151643938-151643960 CCTTTTGAACAAATGGTGCTGGG - Intergenic
1017534872 6:155336298-155336320 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1028823061 7:95234924-95234946 CATTACTAACAAATGGTGCTGGG + Intronic
1028880564 7:95875196-95875218 CTTTTAGAACAATGGGTGTTTGG + Intronic
1030326156 7:108220606-108220628 CCTTTTCAATAATTGGTGTTGGG + Intronic
1030595696 7:111536273-111536295 CAATATGAAATATTGGTGGTGGG + Intronic
1031360451 7:120843504-120843526 CAGTTTGAACAATTGGCCTTGGG - Intronic
1032351654 7:131169847-131169869 CATTATGAACAATATTTCTTGGG - Intronic
1032941778 7:136801524-136801546 CCTTGTGAACAATTTGAGTTTGG + Intergenic
1037204844 8:16304387-16304409 CATTCTGAGCAACTGGGGTTGGG - Intronic
1038238898 8:25789366-25789388 CATTTTCAACAAATGGTGTTGGG - Intergenic
1038346754 8:26740122-26740144 AATTTGGAACAATTGGGGTTTGG + Intergenic
1038656168 8:29454094-29454116 CATATTTAACAAATGGTGTTGGG + Intergenic
1038771894 8:30490387-30490409 CATTATAATCAATGGATGTTGGG - Intronic
1039119378 8:34128946-34128968 CCTTAAGAACAATTGTGGTTTGG - Intergenic
1042326585 8:67534944-67534966 ACTTATGAACATGTGGTGTTTGG + Intronic
1043248740 8:78040956-78040978 AGTTATTAACAATTGTTGTTTGG - Intergenic
1044228055 8:89741751-89741773 CCTTTTCAACAATTGGTGCTAGG + Intergenic
1044560785 8:93610106-93610128 CATTATCATCAAATGGTATTTGG - Intergenic
1044807604 8:96023863-96023885 CATAATTACCATTTGGTGTTTGG + Intergenic
1048540125 8:135334748-135334770 CAATATGAGCAATTGGTACTGGG - Intergenic
1050699181 9:8318080-8318102 CACTATAAACAATTGGTCATTGG - Intronic
1051190252 9:14504050-14504072 CATATTCAACAAATGGTGTTGGG - Intergenic
1051807635 9:21013260-21013282 CTTTTTCAACAAATGGTGTTGGG - Intronic
1056059822 9:82872757-82872779 GAGTAAGAACATTTGGTGTTTGG + Intergenic
1056572389 9:87827092-87827114 CTATATGAACAACTGTTGTTTGG + Intergenic
1058893004 9:109376999-109377021 CATAATAAACAATTTGTTTTTGG + Exonic
1191778058 X:64839846-64839868 CCTTTTGAACAAATGGTGCTAGG - Intergenic
1191796163 X:65024014-65024036 GAATAAGAACAAGTGGTGTTTGG - Intronic
1191954575 X:66630099-66630121 CATTTTCAACAAATGGTGCTGGG + Intronic
1192820642 X:74641593-74641615 CCTTTTCAACAAATGGTGTTGGG + Intergenic
1193054817 X:77138549-77138571 AGTTCTGAACAACTGGTGTTTGG - Intergenic
1193298945 X:79866046-79866068 CATTATGAATATTTTGTGTATGG + Intergenic
1193784969 X:85749853-85749875 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1195686703 X:107593627-107593649 CCTTTTCAACAAATGGTGTTGGG - Intronic
1195731830 X:107976269-107976291 CATTAACAAGAATTTGTGTTTGG + Intergenic
1196784902 X:119413274-119413296 CATTATAATCCATGGGTGTTGGG - Intronic
1201557647 Y:15281374-15281396 TATTAAGAACTATTGGTGGTGGG - Intergenic