ID: 987623819

View in Genome Browser
Species Human (GRCh38)
Location 5:20371292-20371314
Sequence ATGGATCAACAGTTCTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987623819 Original CRISPR ATGGATCAACAGTTCTCTAT TGG Intronic
909132231 1:71752036-71752058 ATGTAGAAACATTTCTCTATAGG + Intronic
910851399 1:91652532-91652554 ATGAATGGACAGTTCACTATAGG + Intergenic
912003746 1:104867142-104867164 ATAGATCAAAAATTCTCTCTGGG - Intergenic
913120284 1:115733973-115733995 AAGGATCAATAGCTCTCTCTAGG - Intronic
913712401 1:121498561-121498583 ATAGAGCAACAGTTCTGGATTGG - Intergenic
915478845 1:156171326-156171348 TTGGACCAACTGTTCTCTAAAGG - Intronic
918836885 1:189476847-189476869 ATGAAGTAACAGTTGTCTATAGG + Intergenic
919995594 1:202746094-202746116 AAGGATCAACTGTTTTCCATAGG + Intronic
1066588880 10:36970430-36970452 TTGGATCAACAGTTACCTTTTGG + Intergenic
1080038862 11:27738064-27738086 ATGGCTCAAGAATTTTCTATGGG - Intergenic
1085899194 11:80677506-80677528 TTGGATCAACAGTTACCTTTTGG - Intergenic
1088692755 11:112341927-112341949 GTGGACTTACAGTTCTCTATAGG + Intergenic
1091038175 11:132252505-132252527 CTGGAACAACAGTTTTCCATGGG + Intronic
1093767414 12:22981092-22981114 ATTGTTCAATAGTTCTCTCTTGG - Intergenic
1097010148 12:55947614-55947636 ATTTATAAACAGTTCCCTATTGG + Intronic
1098756907 12:74375505-74375527 TTGGTTTAACAGTTCTCTTTTGG - Intergenic
1104394544 12:128421117-128421139 ATGGATGAAAAGTTACCTATTGG - Intronic
1106009831 13:25809411-25809433 AAGAATCAACAGCTCTCTTTTGG - Intronic
1111879726 13:93941156-93941178 ATAGAACAAAAGTTTTCTATAGG - Intronic
1113476217 13:110583160-110583182 AAGGATCAACATTTCACTAAAGG + Intergenic
1114983733 14:28198315-28198337 ATGGATCAAAAGTACAATATTGG + Intergenic
1116947135 14:50846384-50846406 TTGGAGAAACAGTTCTCTGTGGG + Intergenic
1117088432 14:52224973-52224995 ATGTATCAAAAGGTCTTTATAGG - Intergenic
1118121981 14:62855973-62855995 AAGGATGAATAGTTTTCTATAGG - Intronic
1119934466 14:78578439-78578461 ATGCATCAACATCTGTCTATAGG + Intronic
1128338613 15:66804314-66804336 TTGGAGAAACAGTTCTTTATGGG - Intergenic
1133748241 16:8703702-8703724 ATGGATCACCAGTTTGTTATTGG + Intronic
1137013943 16:35353846-35353868 ATGGATAAACAGGTATCCATAGG - Intergenic
1138862925 16:60780708-60780730 AGGTATTAATAGTTCTCTATTGG + Intergenic
1139153003 16:64407151-64407173 ATAGATCAAGAGTTCTCCACGGG - Intergenic
1140740810 16:77939470-77939492 ATGTAACAACAGATCTCTAAAGG - Intronic
1144606812 17:16673734-16673756 ATGGATCAAGATTATTCTATAGG - Intergenic
1147648416 17:42048212-42048234 ATAGATCAACAGTTCTGTCTAGG - Intronic
1151952898 17:77364934-77364956 ATGGAAAACCAGTTCTCTAAAGG + Intronic
1152189393 17:78879318-78879340 ATGGACCACCAGTTCTGTAGGGG + Intronic
1157886862 18:51377078-51377100 ATGGCTCAATAGTACTCCATTGG - Intergenic
1158169333 18:54578618-54578640 ATGGAACAACAGTTACCCATGGG - Intergenic
926598867 2:14820311-14820333 ATGGCTGAATAGTTCTCCATTGG - Intergenic
929393217 2:41495170-41495192 ATGCAACAACAGTTCTCCCTTGG - Intergenic
930400589 2:50879769-50879791 TTGGATCCACAGTTACCTATAGG - Intronic
932730527 2:74218490-74218512 ATAGATCTCCAGTTTTCTATAGG + Exonic
935109786 2:100081900-100081922 GTTGATCAACAGTTCTCAGTAGG + Intronic
935690786 2:105730635-105730657 ATTGAGGAACAGTTCTCCATGGG - Intergenic
936125189 2:109783309-109783331 GTTGATCAACAGTTCTCAGTAGG - Intergenic
936219504 2:110588159-110588181 GTTGATCAACAGTTCTCAGTAGG + Intergenic
938095523 2:128459258-128459280 CAGGAAAAACAGTTCTCTATGGG + Intergenic
939081775 2:137671458-137671480 TTGACTCAACAGTTCTATATAGG + Intronic
940156923 2:150666716-150666738 ATGAAGCAATAGTTCTCAATAGG + Intergenic
940823904 2:158388127-158388149 ATGGCTTAACAGTTTTCTATTGG + Intronic
943001232 2:182330898-182330920 ATGGAGCAAGATTTCCCTATGGG - Intronic
947822488 2:233081790-233081812 ATGGATCAGCTCTTCTCTGTGGG + Intronic
1169814624 20:9643277-9643299 ATTGCCCAAAAGTTCTCTATGGG - Intronic
1169869315 20:10234382-10234404 ATGGAACACTAGTGCTCTATAGG + Intronic
1170904339 20:20498966-20498988 AAGGATCAAGAGTTCAGTATGGG + Intronic
1171368141 20:24640779-24640801 ATGGATCCACACATCTCTAGAGG + Intronic
1180747314 22:18098933-18098955 TTGTATGCACAGTTCTCTATTGG - Exonic
1181411549 22:22725276-22725298 ATGGATCAAGATTATTCTATAGG - Intergenic
1181418482 22:22778867-22778889 ATGGATCATGATTTTTCTATAGG - Intronic
954094008 3:48308421-48308443 ATGGATGAAAAGTTAACTATAGG - Intronic
955945918 3:64193442-64193464 ATGGTTCGATAGTTTTCTATTGG - Intronic
961294189 3:125870967-125870989 ATGGAAAAACAGCTCTCTCTGGG - Intergenic
965380355 3:167980677-167980699 ATGGATTAACAGTTTTTTAAGGG + Intergenic
966620609 3:181959506-181959528 ATGAAGCTAAAGTTCTCTATAGG + Intergenic
969003168 4:3998940-3998962 ATGGAAAAACAGCTCTCTCTGGG + Intergenic
969810759 4:9645876-9645898 ATGGAAAAACAGCTCTCTCTGGG - Intergenic
977892734 4:102330563-102330585 ATGGATTCACAGCTCTGTATCGG + Intronic
979662114 4:123269071-123269093 ATGGAGAAACAGTTCTGGATTGG - Intronic
980176763 4:129355302-129355324 ACGGATGAGCAGTTCTCTCTTGG - Intergenic
987623819 5:20371292-20371314 ATGGATCAACAGTTCTCTATTGG + Intronic
989965235 5:50459116-50459138 ATAGAGCAACAGTTCTGGATTGG + Intergenic
990075129 5:51835947-51835969 CTGGACCAAAAGTTCACTATGGG - Intergenic
995660357 5:114475752-114475774 CTGGATCCATAGTTCTCTAAAGG - Intronic
996428833 5:123347589-123347611 TTTGATCAACAGTATTCTATTGG - Intronic
996734078 5:126742828-126742850 GTGGAATAACAGTTCTCTACTGG - Intergenic
998412481 5:141922305-141922327 ATGGCTCAAAAGTTCTTTAACGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000097087 5:157980927-157980949 ATGCACCAACAATTCTCTGTAGG - Intergenic
1000409191 5:160919882-160919904 ATGGATGAACAGCTTTCCATTGG - Intergenic
1006343855 6:33464013-33464035 ATGGATCAAGAGTTTTGTATAGG + Intergenic
1006674137 6:35750009-35750031 AAGGATCAACAGTTCTTCCTTGG - Intergenic
1008468412 6:51855892-51855914 TTGGATCAACAGATCTCTGCAGG - Exonic
1008523170 6:52381789-52381811 ATGCATACACAGCTCTCTATGGG + Intronic
1015553410 6:134435702-134435724 ATCGATCAACAGTGCGCTGTTGG + Intergenic
1015658621 6:135547727-135547749 ATTCATCAGCAGTTCTCAATCGG + Intergenic
1015680853 6:135806947-135806969 ATGCATCAACAAATCTTTATAGG - Intergenic
1016882888 6:148928503-148928525 ATGTAATAACAGTTCCCTATAGG + Intronic
1024481135 7:49864544-49864566 ATGTCTCAACAGTTGTCTTTTGG + Intronic
1028433769 7:90778189-90778211 ATGTATCAAGAGTTCTGTTTGGG - Intronic
1031799046 7:126219426-126219448 ATGAATAAACAATTCTCTAAAGG - Intergenic
1033488591 7:141817217-141817239 TTGGGTCTACAGTTCTCCATAGG - Intergenic
1041139620 8:54802837-54802859 AAGGATCTACAGTTCTCTCTTGG + Intergenic
1048392797 8:133984165-133984187 ATTGATCACCAGTTCTCTTTGGG - Intergenic
1048759365 8:137775466-137775488 ATTTATCAACAGTTTTCTACTGG - Intergenic
1050382578 9:5045352-5045374 AAGGAAAAACATTTCTCTATTGG + Intronic
1054747194 9:68866601-68866623 TTGTATGCACAGTTCTCTATCGG - Intronic
1058983176 9:110188845-110188867 AAGGATCAAGAGATCTCTCTGGG - Intergenic
1194156751 X:90399624-90399646 ATGGATCTACAGTGATTTATAGG - Intergenic
1195614985 X:106905062-106905084 ATGGATAAACATTTCTTTGTTGG - Intronic
1196380955 X:115088849-115088871 CAGAATCAACAGTTCTTTATTGG + Intergenic
1200503098 Y:3976610-3976632 ATGGATCTACAGTGATTTATAGG - Intergenic
1200874870 Y:8143290-8143312 AGGGATGAACAGTCCTCTAGAGG + Intergenic