ID: 987626556

View in Genome Browser
Species Human (GRCh38)
Location 5:20408158-20408180
Sequence TTGTTCTTCAAAAATGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 9, 3: 60, 4: 528}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987626551_987626556 1 Left 987626551 5:20408134-20408156 CCAAGAATCCCATAACCAGCAAA 0: 1
1: 5
2: 60
3: 567
4: 8486
Right 987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG 0: 1
1: 0
2: 9
3: 60
4: 528
987626552_987626556 -7 Left 987626552 5:20408142-20408164 CCCATAACCAGCAAAATTGTTCT 0: 1
1: 0
2: 5
3: 40
4: 254
Right 987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG 0: 1
1: 0
2: 9
3: 60
4: 528
987626550_987626556 5 Left 987626550 5:20408130-20408152 CCAGCCAAGAATCCCATAACCAG 0: 1
1: 0
2: 3
3: 32
4: 342
Right 987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG 0: 1
1: 0
2: 9
3: 60
4: 528
987626553_987626556 -8 Left 987626553 5:20408143-20408165 CCATAACCAGCAAAATTGTTCTT 0: 1
1: 0
2: 5
3: 29
4: 355
Right 987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG 0: 1
1: 0
2: 9
3: 60
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987626556 Original CRISPR TTGTTCTTCAAAAATGAAGA GGG Intronic
900712598 1:4123891-4123913 TTATTCTTCAAAAATTTAAAAGG + Intergenic
901554062 1:10017750-10017772 TTGTTGTTCTGTAATGAAGAGGG - Intergenic
904106114 1:28085906-28085928 TTGTTCTTCTAAAATGACTTTGG - Intronic
904666072 1:32122611-32122633 TTTTTCTTTAAAAATGAGAAAGG - Intronic
905004935 1:34702087-34702109 TTTTTCTTAAAAAATAAAAATGG - Intergenic
906861557 1:49366150-49366172 TCATTCTTCAAAAAAAAAGATGG + Intronic
906872636 1:49500901-49500923 TAGTTCTGTAAAAATGATGATGG + Intronic
906878194 1:49560863-49560885 ATGTCCTTTAAACATGAAGAGGG + Intronic
907331694 1:53676032-53676054 TTCTTCTTCAAAATAAAAGAGGG - Intronic
907363638 1:53942701-53942723 TTGGTGTTCAAAAATGTTGATGG - Intronic
907651549 1:56299751-56299773 TTGTTATTGGAAATTGAAGAAGG - Intergenic
907840239 1:58149980-58150002 TTGTTACTCAAAAAGTAAGAGGG + Intronic
908642939 1:66245376-66245398 AGGTTCTTAAAAAGTGAAGAGGG - Intronic
909195773 1:72620947-72620969 TTTTTCTCCAAAAATCAAAATGG + Intergenic
909306048 1:74078654-74078676 TAGTTCTTCAGAAGTGAATATGG - Intronic
909527187 1:76638545-76638567 TTGTTTTTCATACATGAAGTCGG - Intergenic
910584869 1:88868596-88868618 TTCTTCTTGAAAAATAGAGATGG - Intronic
911748472 1:101467691-101467713 GTGGTCTTAAAAAAAGAAGAGGG + Intergenic
912477949 1:109953543-109953565 TTGGTCTTCAAGAAAAAAGATGG + Intergenic
912714840 1:111975782-111975804 CTGTTCTTGAAAAAGTAAGAAGG - Intronic
912841962 1:113046644-113046666 TTGTTCTTGAACAATTCAGAGGG - Intergenic
913563787 1:120049861-120049883 TAGTTCTCAAAAAATGAACAAGG + Intronic
913634337 1:120743702-120743724 TAGTTCTCAAAAAATGAACAAGG - Intergenic
914284380 1:146209235-146209257 TAGTTCTCAAAAAATGAACAAGG + Intronic
914545412 1:148659976-148659998 TAGTTCTCAAAAAATGAACAAGG + Intronic
914621155 1:149410698-149410720 TAGTTCTCAAAAAATGAACAAGG - Intergenic
915825571 1:159072504-159072526 TTGTTCTTCAGACATAAAGCTGG + Intronic
915986885 1:160475027-160475049 CTGAAATTCAAAAATGAAGAAGG - Intergenic
916453685 1:164948181-164948203 TTATCCATTAAAAATGAAGAAGG - Intergenic
916837689 1:168564973-168564995 TTGTACTTCAAAATTTAAGAGGG + Intergenic
917548755 1:176001829-176001851 CTATTCATCAAAAATGAAGGGGG - Intronic
917602098 1:176586325-176586347 TTTTTCTTCAAAAAAAAATAGGG + Intronic
918605011 1:186414164-186414186 ATGTTTTTCAATAATGAATAAGG - Intronic
918666030 1:187152736-187152758 GTATTCTTCAAACATGAAGGAGG - Intergenic
919008890 1:191934104-191934126 TTGTTCTGAAAAAATAGAGAAGG + Intergenic
919299994 1:195749096-195749118 ATGATCTTCCAAAAAGAAGAAGG - Intergenic
919528856 1:198690195-198690217 TTGTTCTTCACAAACAATGAAGG + Intronic
920913778 1:210241559-210241581 TCGTTCCTCAAAAATTGAGATGG - Exonic
920953648 1:210597872-210597894 TTCTGCTTGAAAAAAGAAGAGGG - Intronic
921794728 1:219329078-219329100 TTGAACTACAAAAATGGAGAAGG - Intergenic
921823388 1:219642657-219642679 ATGTTCTTCAAACATGAAGGGGG + Intergenic
922149391 1:222985029-222985051 TTTTTTTGCAAAAATGAAAAGGG - Intronic
922207706 1:223462759-223462781 CTGTTTTTCAAAAATTAATAAGG - Intergenic
922660662 1:227427704-227427726 TGTTTCTTCAATAATGAAGTAGG - Intergenic
923023317 1:230184167-230184189 TTGATCTTCAAAGATGAAGAAGG - Intronic
923488178 1:234456924-234456946 TAGTTTTTGAGAAATGAAGAAGG - Intronic
923682021 1:236126142-236126164 TTGCTCTTCAAAGAGGGAGAGGG - Intergenic
923696616 1:236258450-236258472 CTGTTCTTCAAAAATAAAAGGGG + Intronic
923772575 1:236950483-236950505 CTGTTATTCAAGAATGAAGGTGG - Intergenic
1063262707 10:4408313-4408335 TTATTTTTCATAGATGAAGAAGG + Intergenic
1063395931 10:5687508-5687530 TGGTTCTTAAAAAGTGTAGAGGG - Intronic
1064590676 10:16887489-16887511 TGGTTCTTCAGAAATGAATGAGG - Intronic
1065665265 10:28052318-28052340 TTGTTTTTAAAAAATGAAAGAGG - Exonic
1066186959 10:33019262-33019284 GGGCTCTTCAAAAATGAAGATGG - Intergenic
1066527745 10:36299709-36299731 TTGTTATTAAAAAATAATGAAGG - Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067179891 10:43977143-43977165 CACTTCTTCAAAAATGAAAAGGG - Intergenic
1067317085 10:45178895-45178917 TTGTGCTTCAATAAAAAAGAAGG + Intergenic
1067835690 10:49639355-49639377 ATATCCTTCAGAAATGAAGAAGG - Intronic
1068061920 10:52079147-52079169 TTGATGTCCAAAGATGAAGAAGG - Intronic
1068878418 10:62022559-62022581 TTGTTGTGCAAAAAGGAAAAAGG - Intronic
1069767657 10:70875248-70875270 CTCATCTTCAAAAAAGAAGAGGG - Intronic
1070325573 10:75386696-75386718 TTGTTCTTCAATAAGCAATAGGG - Intergenic
1070975774 10:80604457-80604479 TGGTTGTTCAACAATGATGAGGG - Intronic
1071021796 10:81065736-81065758 TTGTCTTACAAAAATGAAAAAGG - Intergenic
1071731954 10:88256882-88256904 TTGTTTTTAAAAAACGAAGGAGG - Intergenic
1072859957 10:98993230-98993252 TAGGCCTTAAAAAATGAAGAGGG + Intronic
1073400607 10:103254056-103254078 CTATTCTTCAAAAATGAAGGAGG - Intergenic
1073707955 10:106007837-106007859 CTATCCTTCAAAAACGAAGAGGG - Intergenic
1073790991 10:106940399-106940421 TGGGTATACAAAAATGAAGAAGG + Intronic
1073817101 10:107219891-107219913 AAGTTCTTAAAAAATGAACATGG + Intergenic
1074151581 10:110764114-110764136 CTGTTCCACAAAAATAAAGAAGG + Intronic
1074502383 10:114038181-114038203 TTTTTTTTAAAAAAAGAAGAGGG + Intergenic
1076961601 10:133766584-133766606 TTCATCTTAAAGAATGAAGAAGG + Intergenic
1078878499 11:15423436-15423458 TTATTTTTTAAAAATGAAGGGGG + Intergenic
1078882379 11:15464886-15464908 TCATTCTTCCTAAATGAAGAAGG + Intergenic
1079425756 11:20340940-20340962 TTCTTCTGCAAATATGAATATGG - Intergenic
1079565178 11:21873884-21873906 TTGTAATTCAAAACTGAACATGG - Intergenic
1079619113 11:22531604-22531626 TTTTTTTGAAAAAATGAAGAAGG + Intergenic
1079715891 11:23743896-23743918 ATGTTCTCCACAAATGAAAAGGG + Intergenic
1079985111 11:27192010-27192032 TTGTTATTAAGAAATGAGGAGGG + Intergenic
1080314249 11:30931633-30931655 TTCATCTTCAAATATGAATATGG + Intronic
1080565281 11:33503854-33503876 TTGCTCTTCCAAAATGCAGCAGG + Intergenic
1081292792 11:41347460-41347482 ATGTGCTTCAAAAAGAAAGAAGG + Intronic
1081555391 11:44155968-44155990 ATGTTCTTCAAACATAAAGGAGG - Intronic
1081559753 11:44202781-44202803 TGCTTCTTCAACTATGAAGAAGG - Intronic
1082201506 11:49376449-49376471 TGATTTTTCAGAAATGAAGATGG - Intergenic
1082971296 11:59024316-59024338 TAGTTCTACAGAAGTGAAGATGG - Intronic
1083576081 11:63792693-63792715 GTATTGTTCAAAAATGGAGATGG + Intergenic
1083817643 11:65145397-65145419 TTCATCTTCACAATTGAAGAAGG + Intergenic
1085059296 11:73430172-73430194 TTGTTTTTCAAAAATAATAAAGG - Intronic
1085072352 11:73558772-73558794 TTATTTTTTAAAAAAGAAGAAGG + Intronic
1086092534 11:83019362-83019384 ATGTTCAGCAAAAGTGAAGATGG + Intronic
1086093325 11:83025808-83025830 TTGTTCTTAAAAAATTGAAAAGG + Intronic
1086372273 11:86166834-86166856 TTCTTTTTCAAAAAGGAAGAAGG + Intergenic
1086391336 11:86367193-86367215 TTGAACCTCAAAAAGGAAGAAGG - Intergenic
1086654161 11:89329790-89329812 TATTTTTTCAGAAATGAAGATGG + Intronic
1086703161 11:89922810-89922832 CTGTTGTTTAAAAATTAAGAAGG + Intergenic
1087238259 11:95745784-95745806 TTATCCCTCAAAAATGGAGAGGG - Intergenic
1087484786 11:98747873-98747895 TTGCTCTTCAAAAATACTGAGGG + Intergenic
1087691193 11:101321895-101321917 TTATTCATCAAAGATGAAAATGG + Intergenic
1090330522 11:125927976-125927998 TTGTTTTCCACAAATGAAAATGG + Intergenic
1090552089 11:127831134-127831156 TTAGTCTTCAAAAGTGAAGGAGG + Intergenic
1090622544 11:128573676-128573698 TTGATCTTGAAAAAAGGAGAAGG + Intronic
1091110241 11:132959867-132959889 TTGTTCTTTCAAAATGAAACTGG + Intronic
1091464956 12:675899-675921 TTTATCTGCAAAAATGAGGAGGG - Intergenic
1091608833 12:1985283-1985305 ATGTTTTTTAAAAATGAACAGGG - Intronic
1091868929 12:3870790-3870812 TTGTTATGGAAAAATTAAGAAGG + Intronic
1092275349 12:7056700-7056722 TTGTTGTTCAAATTTGAAAATGG + Intronic
1092399004 12:8156206-8156228 TTGATCTTGAAAAATGAAATTGG - Intronic
1092642585 12:10532034-10532056 ATATTCTTCAAACATGAAGGAGG + Intergenic
1093159474 12:15728981-15729003 TTATCCTTCAAAAGTGAAGGAGG - Intronic
1093466437 12:19454060-19454082 TTCTTTTTTAAAAATGGAGACGG + Intronic
1094505523 12:31057678-31057700 TGGTTTTTTAAAAAGGAAGAAGG - Intergenic
1094697183 12:32831448-32831470 TTTTTCTTTAAACATGAAGATGG + Intronic
1095142947 12:38689116-38689138 TTGTTGTTTATTAATGAAGAGGG + Intronic
1095789640 12:46150741-46150763 TTTGTCTTCAGAAAGGAAGAGGG - Intergenic
1095817376 12:46439590-46439612 TTGTTCTTCCAAAATTATCATGG - Intergenic
1096335888 12:50755888-50755910 CTAGTCTTCAAAAATGAAGGTGG + Intergenic
1096572996 12:52534493-52534515 TTTTTCTTCTTATATGAAGACGG - Intergenic
1097131334 12:56812808-56812830 ATATACTTCAAAAATGAAAAGGG + Intergenic
1098540974 12:71657389-71657411 TTTTTCTTGAAAAATTAAAAAGG - Intronic
1099177794 12:79441768-79441790 TTGTTTCTCAAACATGCAGAAGG + Intronic
1099246200 12:80196353-80196375 TTGTTATTTATAAATGTAGACGG + Intergenic
1099340157 12:81421070-81421092 TTATTCTTTAAAAGTGAAGAAGG + Intronic
1099452644 12:82826077-82826099 TTCTTTTTTAAAAATGAAGTTGG - Intronic
1099604097 12:84779762-84779784 CTGATCTGCAAAAATGAACATGG + Intergenic
1099936313 12:89130044-89130066 TTGGTCTTCAAAATTGGATAGGG - Intergenic
1100078757 12:90822987-90823009 TGGAGATTCAAAAATGAAGAAGG - Intergenic
1100125456 12:91419525-91419547 TTATGCTTGATAAATGAAGAGGG - Intergenic
1100670590 12:96808050-96808072 TTTTTCTTCAGGAAAGAAGAAGG - Intronic
1101933605 12:109036665-109036687 CTATTCTTTAAAAATGAAGGAGG - Intronic
1103086962 12:118068937-118068959 TGGGTCTTCCAAAATGAGGAAGG - Intronic
1104352690 12:128058416-128058438 TTTTTCTTCCAAAATGAAATAGG - Intergenic
1104732398 12:131115143-131115165 TTGTTCTTTAAAACCAAAGAGGG - Intronic
1104840014 12:131819286-131819308 TTGTACTTCAAAATTTAACAAGG - Intergenic
1106399323 13:29413237-29413259 TTGAGCTTTAAAAATGCAGAAGG - Intronic
1106426920 13:29640072-29640094 TTGTTCATCACAAATGGAGCTGG - Intergenic
1106633276 13:31499856-31499878 TTTTTCATCAAAAATCATGAAGG + Intergenic
1107042369 13:35962758-35962780 ATGTTCTGCCAACATGAAGAAGG + Intronic
1107797740 13:44070648-44070670 ATATTCTTCAAAAATCAAGGGGG + Intergenic
1108720926 13:53131317-53131339 AGCTACTTCAAAAATGAAGAAGG - Intergenic
1109228910 13:59731732-59731754 TAGTTATTAAAAAATGAAAAAGG + Intronic
1109912231 13:68929426-68929448 TTGTCCAATAAAAATGAAGAGGG - Intergenic
1110088676 13:71416253-71416275 TTGTTCTTCATAAATAAATAAGG - Intergenic
1110136201 13:72070591-72070613 TTGTCCTACAAAAATGTAGTAGG + Intergenic
1110288922 13:73781437-73781459 TTGTTATTACAAAATGTAGATGG + Intronic
1110424891 13:75355697-75355719 TGATATTTCAAAAATGAAGAAGG + Intronic
1110500044 13:76216493-76216515 TTTATGTTCAAAAATGCAGAAGG + Intergenic
1110797120 13:79652470-79652492 TTCCTCTTCACAAATGAAGAGGG + Intergenic
1112384002 13:98921112-98921134 CTATTCTTTCAAAATGAAGAGGG + Intronic
1112489095 13:99845887-99845909 ATTTTCTTCAAAAATCAACAAGG - Intronic
1112696432 13:101954072-101954094 TGCTTCTTCAAAAATTTAGAAGG - Intronic
1113813460 13:113155806-113155828 TTGTTTTTCAGAACAGAAGAGGG + Intergenic
1114151951 14:20050915-20050937 TTGTTCTCCAAAAATTTATAAGG + Intergenic
1114212768 14:20629799-20629821 TTATTATTCGAAAATGAAAAAGG - Intergenic
1114316825 14:21517107-21517129 TTGTAATTCAAAAATGGAGAAGG - Intergenic
1114355214 14:21900225-21900247 TTGTTTTTTAAAGAAGAAGAAGG - Intergenic
1114363478 14:22002135-22002157 GTGTTCTTCAAAATTGAGTAAGG - Intergenic
1114685263 14:24524196-24524218 TTGTTCATCAAAAGATAAGAGGG - Intergenic
1115019111 14:28653523-28653545 TTATTTTTAAAAAAAGAAGAAGG + Intergenic
1115167325 14:30463676-30463698 TTGATTTTTAAAAATGGAGATGG - Intergenic
1115726462 14:36222594-36222616 TTATTGTTAAAAAATGATGATGG + Intergenic
1115914151 14:38291590-38291612 TTGCACTTCAAAAATGGTGAAGG - Intergenic
1116106455 14:40514045-40514067 TTCTTCTTGAAAAATGCAGAGGG + Intergenic
1116461013 14:45174085-45174107 TTATTATTCAAAAAAGCAGAGGG + Intronic
1116612367 14:47092292-47092314 TAGTTTTACAAAAATGTAGAAGG - Intronic
1116985262 14:51212503-51212525 TTTTTTGTCAAAAATGAATATGG - Intergenic
1117368026 14:55050858-55050880 TGTTTATTCAGAAATGAAGATGG + Intergenic
1117481730 14:56152410-56152432 TTATTCTACTAAAAGGAAGATGG + Intronic
1117704882 14:58454832-58454854 TTATTGTTCAAAAGTGAAGGAGG - Intronic
1118537520 14:66784323-66784345 TTATTCTTCAAGAATGAATAAGG + Intronic
1118567310 14:67156013-67156035 ATGTACTTCAAAAATGAAGGTGG + Intronic
1119073768 14:71615251-71615273 TTGGTTTTCAAAATTTAAGAGGG + Intronic
1119378900 14:74216344-74216366 TTATTTTTAAAAAAGGAAGATGG - Intergenic
1119579209 14:75760684-75760706 TTATTTTTTAAAAATGAGGATGG + Intronic
1119954301 14:78779070-78779092 TTGTTCTTTAGAATAGAAGATGG - Intronic
1120159253 14:81128531-81128553 TGTCTCTTTAAAAATGAAGATGG - Intronic
1120351353 14:83363285-83363307 TTATTCTTAAAATATTAAGAAGG + Intergenic
1120404073 14:84072145-84072167 TTGTTTTACAAAAAGGAAAATGG - Intergenic
1120736831 14:88062808-88062830 ATATCCTTCAAAAATGAAGGAGG + Intergenic
1120755545 14:88240873-88240895 TTTTTCTTCAAAAAAAAAAAAGG + Intronic
1121361349 14:93263630-93263652 TTGTTGTACAACTATGAAGAGGG + Intronic
1121474605 14:94185788-94185810 TTATTTTCCAAAAATGGAGATGG - Intronic
1121793638 14:96718020-96718042 GTGTTCTTTTAAAATGAAGAGGG - Intergenic
1121879974 14:97491231-97491253 TTGGAATTCAAAAAAGAAGAAGG - Intergenic
1123952929 15:25300993-25301015 TTATCTTTCAAAAGTGAAGAGGG + Intergenic
1124682974 15:31752787-31752809 TTTTTTTTCAAAAATGATGAGGG - Intronic
1124933721 15:34149723-34149745 TTGTTCTTTAAAAGTAAAGTTGG - Intronic
1125081522 15:35679107-35679129 TTTTTCTTTAAAAATAAAAAAGG - Intergenic
1125467528 15:39969144-39969166 TTACTCTTCATCAATGAAGAAGG - Intronic
1126916791 15:53474971-53474993 TTGCTCTTGAAAAATGAAAATGG + Intergenic
1127360275 15:58238958-58238980 GTGTGCTTCAAACATGAAGAAGG + Intronic
1128290645 15:66476075-66476097 TCCTTCCTCAAAAATGAACAAGG - Intronic
1128404327 15:67319503-67319525 TTGGTGTTCATAAATGAGGAAGG - Intronic
1129078496 15:73018878-73018900 GTGTTCTTCAAAAATGTTCAGGG + Intergenic
1129223115 15:74145999-74146021 TTTTTCTTCAAAAATTGACATGG - Intergenic
1129809159 15:78492883-78492905 TTGTACCTAAAAAATGAAGAAGG + Intronic
1130311786 15:82762576-82762598 TTGTTCATAAAAAAAGAAAAGGG + Intronic
1130366052 15:83240092-83240114 GTGTTCATCAAGAATGAACAAGG - Intergenic
1130648320 15:85747684-85747706 TTCTTCTTAGAAAATGGAGAGGG + Intronic
1130877978 15:88030755-88030777 TTTTTTTTTAAAAAGGAAGAAGG - Intronic
1131717396 15:95128034-95128056 TTGTTCTCAAAAAATAAATAGGG - Intergenic
1132014099 15:98300611-98300633 TGGTTCTTCCAAAAAGAATAAGG + Intergenic
1132138960 15:99373349-99373371 TTTTTTTTAAAAAATGAAGTTGG - Intronic
1132285959 15:100662610-100662632 TTTTTTTTCAAAAATGAAAAAGG + Intergenic
1132770825 16:1562075-1562097 GTGCTCTTCGGAAATGAAGAAGG + Exonic
1132902460 16:2264979-2265001 TTTTTCTTAAAAAATGGAGATGG + Intronic
1133187694 16:4111974-4111996 TCGAATTTCAAAAATGAAGAGGG - Intronic
1133248668 16:4465841-4465863 TTCTCCTTCAAAGATGAGGAGGG - Intronic
1133647785 16:7780634-7780656 ATGTCCTTAAAAAAGGAAGAAGG - Intergenic
1134057559 16:11180154-11180176 ATGTTCTTCTAAAATGCAGGTGG - Exonic
1134623505 16:15707604-15707626 AGATTCTCCAAAAATGAAGATGG + Intronic
1135075058 16:19386146-19386168 TTATTCTTCAGTGATGAAGAAGG - Intergenic
1135291184 16:21240132-21240154 TTGTTTTTAAAATTTGAAGATGG + Intronic
1137406379 16:48192713-48192735 TTGGTCTTCAAGAAAGAACAGGG + Exonic
1138676896 16:58657869-58657891 TTGTTGGTCAAAAATGAGAATGG - Intergenic
1138939681 16:61775191-61775213 TATTTCTTTAAAAATAAAGATGG - Intronic
1138970658 16:62139123-62139145 TCGTTCATCAAAAATGGAAAAGG + Intergenic
1139115168 16:63942404-63942426 ATATCCTTCAAGAATGAAGAGGG - Intergenic
1139825669 16:69755159-69755181 TTTATCTTCAAAGGTGAAGAAGG - Intergenic
1140288118 16:73623712-73623734 TTATTCTTCCAAAATGAAAATGG + Intergenic
1140310417 16:73842795-73842817 TTGTTTCTCTAAAATGCAGAGGG + Intergenic
1140310700 16:73845531-73845553 TTTTTTCTAAAAAATGAAGATGG - Intergenic
1140616692 16:76673447-76673469 TTGTTCTAAAAAAATGACAATGG + Intergenic
1140681279 16:77387337-77387359 ATGTTTTTCAAAATTTAAGATGG + Intronic
1141612992 16:85194007-85194029 TCCTTTTTCAAAAATGAAGCAGG - Intergenic
1143305724 17:5945204-5945226 TTGCTCCTCCAAAATGGAGAGGG + Intronic
1143802430 17:9395296-9395318 TTGTGCTTAAAACATGAATATGG + Intronic
1144404456 17:14939376-14939398 CTAGTCTTAAAAAATGAAGAAGG + Intergenic
1144743622 17:17598420-17598442 ATATACTTCAAAAATGAAGGTGG + Intergenic
1144904579 17:18630810-18630832 TTGTTATTCAAAATTTGAGAAGG - Intergenic
1145741385 17:27277682-27277704 TTGTTCTTCAAAATTCATGTAGG - Intergenic
1149336129 17:55638076-55638098 TTGTCCTTCAGAAATGGAGCAGG - Intergenic
1150413648 17:64968898-64968920 ATTTTCTTTAAAAAGGAAGAAGG - Intergenic
1150605240 17:66685261-66685283 TTCATCTAGAAAAATGAAGACGG - Intronic
1150798161 17:68256270-68256292 ATTTTCTTTAAAAAGGAAGAAGG + Intronic
1151020135 17:70605652-70605674 TTTATCTTTTAAAATGAAGATGG + Intergenic
1151104958 17:71602515-71602537 TTGTCTTTTAAAAATAAAGAAGG - Intergenic
1152964700 18:104270-104292 TTCATCTTAAAGAATGAAGAAGG - Intergenic
1154929839 18:20981607-20981629 TTTTTCTTTTAAAATGAAGAGGG - Intronic
1154933667 18:21028059-21028081 TAGCTCTTCAAAAATTAAGTGGG - Intronic
1156361080 18:36385281-36385303 TTGTTCTTACAAAATGGAGTTGG + Intronic
1156729722 18:40176907-40176929 TTCTGCTTTAATAATGAAGATGG - Intergenic
1158331870 18:56371262-56371284 GTCTTCCTCAATAATGAAGATGG - Intergenic
1158345735 18:56514904-56514926 CTCTTCTTCACCAATGAAGAGGG - Intergenic
1158616392 18:58991677-58991699 TTGTTTTTTAAAAAAGAACAAGG + Intergenic
1159314564 18:66755090-66755112 TGGTTCTTCAAATATTTAGAGGG - Intergenic
1159411108 18:68075546-68075568 TTGTGTTTTGAAAATGAAGATGG + Intergenic
1159538310 18:69743096-69743118 TTGTAGTTTGAAAATGAAGAAGG - Intronic
1160626284 18:80209265-80209287 TTATTCTTTAAAAATAAACATGG - Intronic
1161402108 19:4071000-4071022 TTATTTTTAAAAAATGGAGATGG - Intergenic
1163235371 19:16026582-16026604 TCGTACTTCAAAAAGCAAGAAGG - Intergenic
1163973043 19:20818948-20818970 TTGTTTTTCAAAAAAGCAAATGG + Intronic
1164945178 19:32287430-32287452 TTGTGCTCCACAAAGGAAGAAGG + Intergenic
1165210236 19:34229955-34229977 GTGTACTACACAAATGAAGATGG + Intergenic
1168465408 19:56597327-56597349 TTGTGTTTCAAAAATGTTGATGG + Intronic
925561077 2:5196189-5196211 TTGTTATTCAAAGATTAAAACGG + Intergenic
926014875 2:9442083-9442105 TTGATTTTTAAAAATGAGGACGG + Intronic
926206680 2:10838771-10838793 TTGGTTTTCAAAAATGGAGCAGG + Intergenic
928042595 2:27893153-27893175 TTATTCTTTAAAATTGAGGAAGG + Intronic
928552188 2:32383490-32383512 AGATTCTTCAAGAATGAAGATGG - Intronic
929368756 2:41195161-41195183 TTGTTCCTGAAAAATAAAGAGGG - Intergenic
930287533 2:49450068-49450090 TTGTTCTTCAAAAAGGCATGTGG + Intergenic
930396693 2:50830331-50830353 TTATTATTCAAAAGTGAACATGG - Intronic
930629908 2:53741695-53741717 TTTTACTTTAAAAATGAATATGG + Intronic
930787823 2:55287906-55287928 TTCTCCTTCAAAAATTAAGTTGG - Exonic
930807103 2:55502127-55502149 TTTGTCTTCAAAATTGAGGATGG - Intergenic
932356446 2:71071903-71071925 TTGTTCTGCAAATATCCAGAAGG + Intronic
932711561 2:74068815-74068837 TGGTTCTTGAAAAATGCAAATGG - Intronic
933057285 2:77686659-77686681 TCGTTCTTCAAAAATTAGGAAGG + Intergenic
933534128 2:83551404-83551426 TGATTCTTCAATAAGGAAGAGGG - Intergenic
933927424 2:87107859-87107881 TCGTTCTTCAAAAATTAGGAAGG + Intergenic
934687146 2:96329568-96329590 TTTTTTTTCAAAAATGACAAAGG + Exonic
934958959 2:98650648-98650670 TTGTAATTCAAAAGTAAAGAAGG + Intronic
934977873 2:98818123-98818145 ATGTTCTGCACAAATGAACAAGG + Intronic
936663933 2:114573288-114573310 TTGTGTTTCAGAAATTAAGAAGG + Intronic
936727532 2:115338679-115338701 ATGCTTTTCAAAAATGAAGTTGG + Intronic
937033041 2:118756798-118756820 TTGTTCTTGAAGAATGCAGGTGG - Intergenic
937658260 2:124401732-124401754 TTGTTCATCAAAGTAGAAGAAGG + Intronic
937732458 2:125250073-125250095 TTCTTGTTCACATATGAAGAGGG + Intergenic
938285048 2:130105827-130105849 TTCTTCTTCAAGAAAGAATAAGG - Intronic
938335691 2:130494376-130494398 TTCTTCTTCAAGAAAGAATAAGG - Intronic
938354130 2:130626288-130626310 TTCTTCTTCAAGAAAGAATAAGG + Intronic
938430557 2:131233065-131233087 TTCTTCTTCAAGAAAGAATAAGG + Intronic
939845446 2:147240227-147240249 ATATCCTTCAAAAATGAAGATGG - Intergenic
940159683 2:150697876-150697898 TTGTTCTTCAAGAGTGATCAAGG - Intergenic
940310983 2:152278908-152278930 TTTTTCTTCAAAAAATAAGGAGG + Intergenic
940433603 2:153624028-153624050 ATTTTCTTTAACAATGAAGATGG + Intergenic
940473814 2:154134304-154134326 TTGGTCTTCAGAGATGAACAAGG + Intronic
941101818 2:161305132-161305154 CTATCCTTCAAAAATGAAGGCGG - Intergenic
941190035 2:162370003-162370025 TGGTTTTTCAAAAATTAAGCAGG + Intronic
941379324 2:164773550-164773572 TTTTTCTACAAAAATGCTGATGG + Intronic
941745960 2:169087532-169087554 TTGTGCTTCAGAAAAGGAGACGG - Intronic
942056346 2:172187178-172187200 TTATCCTTCAAAAATGAAGGAGG - Intergenic
943790329 2:191924187-191924209 ATGTTCATCAAAAATTAAAATGG + Intergenic
945470134 2:210218951-210218973 TTCTTCTTTAAAAATGAGAATGG + Intronic
945535704 2:211015343-211015365 TTACTCTTAAAAAATGAAGATGG + Intergenic
945610003 2:211988594-211988616 TTATTCTTTACAATTGAAGATGG + Intronic
946537235 2:220644949-220644971 TTGTTTTTCAAAAATGAATGAGG - Intergenic
946652078 2:221903445-221903467 TTGTTCTTCAACTATGTAGAAGG - Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
947950516 2:234143080-234143102 GTTTTCTTCAAAAAGGAAGAAGG + Intergenic
1171246033 20:23610437-23610459 TTTTTCTTAAAAATTGAAGACGG + Intergenic
1171288780 20:23967562-23967584 TTGTTCTTCAACCATAATGAAGG + Intergenic
1172203590 20:33145903-33145925 TTCTGCTTGAAAAAAGAAGAGGG - Intergenic
1173039858 20:39452118-39452140 TTGTTCCTCAGAAGAGAAGAGGG - Intergenic
1173175073 20:40758762-40758784 GTGTTATTGATAAATGAAGATGG - Intergenic
1173411236 20:42811092-42811114 TTCTTCTTTAAAAATAAAAAGGG - Intronic
1173780689 20:45754481-45754503 TTATTCTAAAAAATTGAAGAGGG + Intronic
1174479883 20:50823649-50823671 TTATTATTTAAAAATAAAGATGG - Intronic
1174737872 20:52982955-52982977 TTGTATTTCAAAAGTGATGATGG + Intronic
1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG + Intergenic
1175610697 20:60348907-60348929 TTGTTTTTAAAAACAGAAGAAGG + Intergenic
1177050245 21:16224650-16224672 TTGTGCTTCAAACATGAAACTGG + Intergenic
1178331045 21:31691571-31691593 TTGTTTTTCCTAAATGTAGATGG - Intronic
1178378442 21:32088156-32088178 ATTTTGTTCAAAAATTAAGAAGG - Intergenic
1178435053 21:32550862-32550884 TTGTGCTTAAAACTTGAAGATGG - Intergenic
1178593660 21:33933461-33933483 CTGTTCATCAGAAATGAAGTTGG + Intergenic
1178807350 21:35850797-35850819 CTTTTCTTCAGAAGTGAAGATGG + Intronic
1179680866 21:43020488-43020510 TTTTTCTTTTAAAATGAAGTTGG + Intronic
1179927700 21:44546628-44546650 TTATCCTTCAAAAATGAAAGAGG - Intronic
1180250642 21:46585000-46585022 ATATTCTTAAAAATTGAAGAGGG + Intergenic
1181261989 22:21604945-21604967 TTTTTCTTCCAAAAAGAGGAAGG - Intronic
1181380433 22:22498372-22498394 TTATTTTTTAAAAATAAAGAGGG + Intronic
1181734915 22:24874119-24874141 TTCTTCTGCAAAATAGAAGAGGG + Intronic
1181983630 22:26783861-26783883 TTGTTCTCAGAAAAGGAAGAGGG - Intergenic
1184584395 22:45437594-45437616 TTGGACTTCAAGAATGAAGCCGG - Intergenic
1184928703 22:47663610-47663632 TTGTTCTTCTAAAATTGAGATGG - Intergenic
949324398 3:2847479-2847501 TTGTCCTTTACAACTGAAGATGG + Intronic
949468857 3:4372500-4372522 TCCTTCTTCAAAAGAGAAGAGGG + Intronic
949746384 3:7298209-7298231 TTGATCTTTAAAAATAGAGATGG + Intronic
951067506 3:18284144-18284166 TTTTTATTAAAAAATTAAGATGG + Intronic
951135941 3:19104302-19104324 TTCTTCTACAACAATGAAGAAGG + Intergenic
951266257 3:20571160-20571182 TTATCCTTCAAAAGTGAAGAAGG - Intergenic
951952696 3:28218172-28218194 TTTTACTTCAAAAATGAATGTGG + Intergenic
952561571 3:34600263-34600285 ATGTTTTTCAAAAGTGAATATGG + Intergenic
953111484 3:39944359-39944381 TTGTTATTAAAAAAAGAATAAGG + Intronic
954127435 3:48539709-48539731 CTGTTCTCCAAAATTAAAGATGG + Exonic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
955039868 3:55305685-55305707 TTTTTCTTCAAAAGTAAATAGGG + Intergenic
955591565 3:60541324-60541346 TTGTTTTTCAAGAATAAAGATGG + Intronic
956454949 3:69411269-69411291 TTGTTTCTCAAAATTGAAGAAGG + Intronic
956543577 3:70373315-70373337 TTTATCATCAAAAATGATGAAGG - Intergenic
956852861 3:73246837-73246859 TTGTTTGTCACAAATGGAGAGGG - Intergenic
957431117 3:80108455-80108477 TTAATTTTAAAAAATGAAGAAGG - Intergenic
957581648 3:82080713-82080735 TTTTTCCTAAAAAATGAAGTTGG + Intergenic
959114585 3:102161684-102161706 TTGTTCTTGCAAAAGCAAGAGGG + Intronic
959300191 3:104589158-104589180 TTTTTCTTCAAAAGTGAAGAGGG + Intergenic
960144390 3:114184862-114184884 TTGTCCTTCAAAAGTGAAGGAGG - Intronic
960206835 3:114912177-114912199 CTGTCCTTCAAAAATGAAGGAGG + Intronic
960387382 3:117036395-117036417 TGGCTCTTGAAACATGAAGAGGG + Intronic
960463072 3:117960558-117960580 TTGATGTTCAAAATTGATGAGGG + Intergenic
961074607 3:123970307-123970329 TTGCTCTTATAAAATGAAGTGGG + Intronic
961222910 3:125213585-125213607 TTGTTCTTCTAAAAACAAAAGGG + Intergenic
961309072 3:125982158-125982180 TTGCTCTTATAAAATGAAGTGGG - Intronic
961824449 3:129591780-129591802 GTGGTCTTGGAAAATGAAGAGGG - Intronic
961841154 3:129713550-129713572 CTATTCTTCAAAGATGAAAATGG + Intronic
962049599 3:131798895-131798917 TTTTTTTTAAAAAGTGAAGATGG - Intronic
963459868 3:145597930-145597952 CTATCTTTCAAAAATGAAGAGGG - Intergenic
963873302 3:150443431-150443453 TTCTTTTTCAAAAATGGATAAGG + Intronic
964962506 3:162445390-162445412 TTTTTCTTTAAAAAAAAAGATGG - Intergenic
965034728 3:163423872-163423894 ATGTTTTTAAAAAAAGAAGAAGG + Intergenic
966075158 3:175926819-175926841 TTTTTCTTCTAAAATACAGATGG + Intergenic
966395309 3:179495860-179495882 CTGTTCTTCAGAAATGAAGGAGG + Intergenic
967544826 3:190712748-190712770 TTGGTCTATATAAATGAAGAAGG + Intergenic
968014365 3:195315492-195315514 TTGTTCTATCAAAATAAAGATGG + Intronic
969125775 4:4946754-4946776 TTCTTCTCCCAAAAGGAAGATGG - Intergenic
970188614 4:13488251-13488273 TTATTCATCAATAATGAAGGTGG + Intergenic
970322648 4:14890292-14890314 TTGCTCTCCAAAAAGGAATATGG - Intergenic
970902725 4:21178375-21178397 TTGCTTTTCAAATTTGAAGATGG + Intronic
971055936 4:22912428-22912450 TGGTTCCTCAAAAATGGAAAGGG - Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
971923953 4:32981879-32981901 TAGTTCTTGAAAAATGACGTTGG + Intergenic
972977078 4:44649120-44649142 TTGTGTTTCAGAAATTAAGAAGG - Intronic
973796228 4:54429630-54429652 ATTTTCTTGAAAAATCAAGAGGG - Intergenic
973919806 4:55673561-55673583 TTCTGCTTGAAAAAAGAAGAAGG - Intergenic
973981765 4:56313935-56313957 GTGTTCTTGAGAAATTAAGAGGG + Intronic
974442308 4:61935144-61935166 TTCTTTTTCTAAAATAAAGAGGG + Intronic
974546974 4:63323980-63324002 GTTTTCATCAAGAATGAAGAAGG + Intergenic
974598902 4:64050890-64050912 TTTTTCTTCAAAACTAATGACGG - Intergenic
974792494 4:66710527-66710549 TTCTTGTTAAAAAATGGAGAAGG - Intergenic
975046444 4:69809832-69809854 TTATTCTTCCAAAATGAAGAAGG + Intergenic
975089074 4:70379180-70379202 TTGTTACTTAAAAATGATGAGGG - Intronic
975303031 4:72813793-72813815 TTGTTCTACAATAATACAGAAGG + Intergenic
976020934 4:80624891-80624913 CTATTCTTCAGAAATGAAGGAGG + Intronic
976912698 4:90326968-90326990 TTGCTTATGAAAAATGAAGATGG - Intronic
977856151 4:101896802-101896824 ATGTGCTTCAAAAAGGAAGTGGG + Intronic
978202096 4:106034028-106034050 TTTTTCTTAAAAAGTGAATATGG + Intergenic
978741173 4:112139547-112139569 TTGTACTTCAGAAATGAATTAGG + Intergenic
979215598 4:118160313-118160335 TTGTCCTTCAATAATGAAGGAGG + Intronic
980421945 4:132573518-132573540 CTGTTCTTCAGAAATGAGGAAGG + Intergenic
980508480 4:133755072-133755094 TTGTTCTTCAAAAATGAAATAGG - Intergenic
980677684 4:136110324-136110346 CTTTTCTTCAAAAATCCAGAGGG - Intergenic
981180544 4:141737567-141737589 CTGCCCTTCAGAAATGAAGATGG + Intergenic
981653961 4:147090936-147090958 TTTTTCTACAAAGATAAAGAAGG - Intergenic
981793424 4:148566533-148566555 TTGTTTATCAAAAGTGAATACGG + Intergenic
982223200 4:153142064-153142086 TTGTGCTTCAAGAATGAGAAGGG + Intergenic
982343997 4:154335752-154335774 TTGTTTTGCAAATATGCAGAAGG - Intronic
982973009 4:162014856-162014878 CTTTTCTTAAAAAAAGAAGAAGG + Intronic
983291560 4:165813567-165813589 CAGTTCTTCAAAAATCAAGTTGG - Intergenic
983337124 4:166410456-166410478 ATATTCTTTAGAAATGAAGAAGG + Intergenic
983408129 4:167358389-167358411 TTCTTCCACAAAAATGAAGGTGG + Intergenic
983696036 4:170532394-170532416 TTGTTGTTAAGAAAAGAAGAAGG - Intergenic
983856454 4:172652263-172652285 TTTTTCCTCAAAAAAGAACAGGG + Intronic
985464831 4:190184066-190184088 TTCATCTTAAAGAATGAAGAAGG + Intronic
986864698 5:11972801-11972823 TTGTTGTTCAAAAACCAAAAAGG - Intergenic
987091937 5:14515935-14515957 ATATCCTTCAAAAATGAAGGGGG - Intronic
987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG + Intronic
988642175 5:33051787-33051809 TTGTCCTCCAGAAATGAAGGAGG + Intergenic
988899767 5:35719328-35719350 TTTTTTAACAAAAATGAAGATGG - Intronic
989165474 5:38429846-38429868 TTTTTTTTTAAAAATTAAGAAGG - Intronic
989240037 5:39193322-39193344 TTGGTATTTAAAAATGAGGATGG + Intronic
989250375 5:39307371-39307393 CTCTTCTATAAAAATGAAGAGGG - Intronic
989353358 5:40514177-40514199 TTTTTCTTTAAAAAAGAAAATGG + Intergenic
990374308 5:55154064-55154086 CTGTTCTTCAAGAAGGGAGATGG + Intronic
991149990 5:63356498-63356520 TTAATCTTCAAAAATGAAGGAGG - Intergenic
991711893 5:69416036-69416058 TTTTTCTTTAAAAATGGATAGGG + Intronic
992020510 5:72619340-72619362 TGATTCTTCAGAAATGGAGATGG + Intergenic
993135917 5:83963980-83964002 ATATTCTTCAAAAATGAAGAAGG + Intronic
993778152 5:92028816-92028838 ACGTTATTCAAAAATGAAGTAGG + Intergenic
993849224 5:92985341-92985363 TTATTCTTCAAAACTGAACCAGG + Intergenic
994411920 5:99417395-99417417 ATGTTCTTAAAAACTGGAGAGGG - Intergenic
994481902 5:100347845-100347867 ATGTTCTTAAAAACTGGAGAGGG + Intergenic
994729777 5:103477943-103477965 TTGTTCTGCTACAATGTAGAGGG + Intergenic
994852016 5:105067759-105067781 TTGTGCTTTGAAAATGAGGAGGG - Intergenic
994910160 5:105894620-105894642 GGGTTCTTAAAAAATGAACAAGG - Intergenic
997409538 5:133680589-133680611 TTCTTCTGCAATAATGAACATGG - Intergenic
998340916 5:141417370-141417392 TTTTTCTTCAAAATTTAAAAAGG - Intronic
998618095 5:143762986-143763008 TTGGTCTTCAGATCTGAAGATGG + Intergenic
998786352 5:145713938-145713960 TTGTTCTTCAAATATGCATGGGG + Intronic
1000795698 5:165661772-165661794 GTGTCCTTAAAAAAGGAAGAGGG - Intergenic
1000870846 5:166575189-166575211 TTATCCTTCAGAAATGAAGCAGG + Intergenic
1001417807 5:171559627-171559649 TTGATCTCCAAAAATGAGGTAGG + Intergenic
1001834066 5:174815715-174815737 CTTTTCTTCAAAAATGAAGGAGG - Intergenic
1002694520 5:181075702-181075724 TTATTCTTCAAAAGTGAAGAAGG + Intergenic
1002794880 6:464250-464272 TTGTTCTCCAACAAGGAAAATGG + Intergenic
1002946033 6:1762161-1762183 TTTTTCTTAATAAATGCAGACGG - Intronic
1003613246 6:7631885-7631907 TTGATCACCAAAAAAGAAGAAGG - Intergenic
1003656108 6:8010246-8010268 CTCTTCTTGAATAATGAAGAAGG - Intronic
1004055095 6:12128289-12128311 ATGTTCCTCAAAAAGGCAGAGGG - Intronic
1004204510 6:13579580-13579602 TATTTCTCCCAAAATGAAGATGG - Exonic
1004813097 6:19281440-19281462 GTGATCTTCAAATCTGAAGAAGG - Intergenic
1005105156 6:22216271-22216293 TTGTTCTTTTATAGTGAAGAGGG + Intergenic
1005402558 6:25449797-25449819 TTTTTCTTCAACAAAGATGAGGG - Intronic
1005591827 6:27336806-27336828 CTGTTTTTCCAACATGAAGATGG + Intergenic
1007864422 6:44952955-44952977 TTGTGCTTCAAAAGATAAGAGGG - Intronic
1007888432 6:45259805-45259827 TTGGTCTTCAAAACTGATGTTGG + Intronic
1008372508 6:50749938-50749960 GTGTTCTGCAAACATGAATAAGG + Intronic
1008808285 6:55458523-55458545 GTGTTAGGCAAAAATGAAGACGG + Intronic
1009335254 6:62480390-62480412 TTGTCCTTCAAGAAAGAGGATGG + Intergenic
1009551143 6:65093198-65093220 CTGTTCTTCATAAATGAAGGAGG + Intronic
1009561740 6:65254868-65254890 TTATTTTTCAAAAGTGAAAATGG - Intronic
1010087104 6:71933568-71933590 TTGGTCTTCAAAAATTCAAAGGG - Intronic
1010494382 6:76515128-76515150 TTATTTTTTAAAAATCAAGAAGG + Intergenic
1011696208 6:89915851-89915873 ATATTCTTCATAAATGAAGGAGG - Intergenic
1012240808 6:96869672-96869694 TTGTTCTTAACAAATTAGGATGG - Intergenic
1012368927 6:98479065-98479087 TTCTTCTTCATAGATGAACAAGG + Intergenic
1013612900 6:111811764-111811786 TTGGAGTTCGAAAATGAAGAAGG + Intronic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1014720806 6:124916063-124916085 TTTTGCTCCAAAAATGCAGAGGG + Intergenic
1015429106 6:133109428-133109450 ATGTTCTTCAACAGTGAATATGG - Intergenic
1015506008 6:133989245-133989267 TTGATTTTCAAAAATAAAAAGGG - Exonic
1015738988 6:136433120-136433142 TTTTTTTTCAGAAAGGAAGAAGG - Intronic
1016262182 6:142185646-142185668 TTGCTCTGAAAAAATGAAAAAGG + Intronic
1016404564 6:143716644-143716666 TTGTTCTTTAAAAAAGGATAAGG - Intronic
1016446528 6:144138536-144138558 TTGTTCTACAAAATTGAATTTGG + Intergenic
1017381893 6:153840813-153840835 TTGTAAATCAAAAATGAAAATGG - Intergenic
1017616857 6:156255162-156255184 TTGTGCTTAAAACTTGAAGATGG - Intergenic
1017949072 6:159120254-159120276 TTGCTCTTCAAGACTTAAGAAGG - Intergenic
1018526472 6:164715339-164715361 TTGTTCCTCTATAGTGAAGATGG - Intergenic
1019758621 7:2791855-2791877 TTATTCTTCAAAAAAAATGATGG - Intronic
1019821272 7:3244711-3244733 TTGATCCTCAAAAGAGAAGATGG + Intergenic
1020877811 7:13720454-13720476 TTGTTTGTCACAAATGAAGGAGG + Intergenic
1021076768 7:16314644-16314666 TTATTTTTCAAAAGTAAAGAAGG - Intronic
1021138023 7:16990020-16990042 TTACTTTTCAAAAATGAAAAGGG - Intergenic
1021236626 7:18150157-18150179 TCTTTATTTAAAAATGAAGAGGG - Intronic
1021288507 7:18813940-18813962 TTAGTCTTCAGAAATGCAGACGG - Intronic
1023464298 7:40436743-40436765 TTGTTCCTGAAAAATCAATATGG + Intronic
1023469789 7:40504230-40504252 TTGTTTTTTAAAAAAGAAGAAGG - Intronic
1023805081 7:43867208-43867230 TTATTTTACAAAAAGGAAGATGG + Intronic
1024225539 7:47323672-47323694 TTGTACTTTAAAAATGGGGAGGG + Intronic
1024363988 7:48500479-48500501 TTATTTTTCAAAAAGGAAGATGG - Intronic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1024944600 7:54796193-54796215 TGGTTCTTTAATAAAGAAGAGGG + Intergenic
1025169568 7:56744003-56744025 TTGTTTTTCTAAAATTAAGTTGG - Intergenic
1025702325 7:63831713-63831735 TTGTTTTTCTAAAATTAAGTTGG + Intergenic
1026138820 7:67687026-67687048 TTGTTCTTGATACATTAAGAAGG - Intergenic
1027430293 7:78104714-78104736 TGGTTCTTGAAACATGAGGAGGG - Intronic
1027613500 7:80392029-80392051 CAGTTTTTGAAAAATGAAGAAGG + Intronic
1027829340 7:83157255-83157277 CTGATCTTCAATAATAAAGATGG - Intronic
1028112688 7:86961659-86961681 TTGTTCTTCAAGAATAAATGAGG + Intronic
1028151720 7:87381271-87381293 TTGTTCTTCAAAATAGATGATGG + Intronic
1028394862 7:90357613-90357635 TTCTTATTCAAATTTGAAGACGG - Intronic
1028877449 7:95839804-95839826 CTGTCCTTCAGAAATGAAGGGGG - Intronic
1028901677 7:96107824-96107846 CCGTTCCTCAAAAATGAAGAAGG - Intronic
1029340335 7:99938371-99938393 GTATCCTTCAAAAATGAAGGAGG - Intergenic
1029672334 7:102041997-102042019 TTATGCTTCTAAAATGTAGAAGG + Intronic
1031383187 7:121113482-121113504 GGTTTCTTTAAAAATGAAGAGGG + Intronic
1031674928 7:124597872-124597894 TTATTGTTCAAAAAGGGAGATGG - Intergenic
1031692499 7:124806965-124806987 TTGTTTTTCAAAAGTAAAAAGGG - Intergenic
1031955137 7:127935315-127935337 TTCTTATTCAAGAATCAAGAAGG + Intronic
1032617960 7:133495999-133496021 TTTTTCTTTAAAAAAAAAGAAGG - Intronic
1033723703 7:144088886-144088908 GTGTTCTTCGAAGAAGAAGAAGG - Intergenic
1033884281 7:145926624-145926646 TTGCTCTGCAAAAATGAAGATGG + Intergenic
1035121589 7:156572916-156572938 TTGCTCTTCAAAAGAGAAGTGGG - Intergenic
1035913205 8:3592499-3592521 TTGTCCTTGTAAAATGGAGATGG + Intronic
1036947747 8:13110693-13110715 GTGTTCTTAAAAAATAAAAAAGG + Intronic
1037010713 8:13839081-13839103 TTGTTCCACAAAAATTAACATGG + Intergenic
1037201175 8:16254424-16254446 TTATTTTACAAATATGAAGATGG - Intronic
1037912249 8:22750499-22750521 TTCTTCTTCCAAAATCAAGGTGG + Intronic
1038936494 8:32257566-32257588 TTTTTCTTCAAAAATAAATTTGG + Intronic
1039193286 8:35001565-35001587 TTGGTGTTTAAAAATGAAGTAGG + Intergenic
1039685188 8:39793942-39793964 TTGTTGTCTAAAAAGGAAGAGGG + Intronic
1039942505 8:42103163-42103185 TTGTTCTTGTCAAATGAAGCGGG + Intergenic
1040842891 8:51803520-51803542 TTGTTCTTCAAGAGAGAGGATGG - Intronic
1041782973 8:61597785-61597807 CTATCCTTCAAAAATGAAGGAGG + Intronic
1042154153 8:65823254-65823276 TTTTTCTCCAAAAATGAATTTGG + Intronic
1042192196 8:66198310-66198332 TTAGTCTTCAAATATGGAGAAGG - Intergenic
1042458536 8:69034874-69034896 ATATTCTTTAAAAATTAAGAAGG - Intergenic
1043195895 8:77290932-77290954 ATGTTCTTCTAATATGTAGAAGG - Intergenic
1043328803 8:79087159-79087181 TGTTTCTTCAAATATGATGAAGG - Intergenic
1044060906 8:87633836-87633858 TTGCACTTTAAAAATTAAGAAGG + Intergenic
1044770850 8:95631926-95631948 CTATTCTTCTAAAATGAAGATGG - Intergenic
1044821123 8:96156658-96156680 TTGTGCTTTAAAAATGATGTTGG - Intronic
1045399424 8:101797513-101797535 ATGTTCTTTAAAAATGAATGTGG + Intronic
1045812025 8:106232786-106232808 TTATTTTTCACAAATGCAGATGG - Intergenic
1045884104 8:107075964-107075986 TTGTACTTTAAAAATGAGAATGG + Intergenic
1046290136 8:112148453-112148475 TTATTTTACAAAAATGAAGGGGG - Intergenic
1046466862 8:114616060-114616082 TTTTTCTTCAAATATCAACATGG + Intergenic
1047692890 8:127374444-127374466 TTCTTCTTCAAAAATCAAGCTGG - Intergenic
1047783358 8:128129160-128129182 TTTTGCTTAAAAAATGAAGGTGG - Intergenic
1048963427 8:139598169-139598191 GTGTTCTTCAGATGTGAAGATGG - Intergenic
1049593896 8:143474716-143474738 TTGTCCATCAAAAAAAAAGAGGG - Intronic
1050399607 9:5237913-5237935 TAGTTCTTCAAAATAGAAAATGG + Intergenic
1050722168 9:8602547-8602569 TTGTTTTTCAAAACTGCAGCAGG + Intronic
1050766104 9:9135867-9135889 TTGTTCTTCAAAAGTTGAGCAGG + Intronic
1050881526 9:10705885-10705907 TTATTATTCAAAAATGATCAGGG + Intergenic
1050914147 9:11109820-11109842 ATATTCTTTAAACATGAAGATGG + Intergenic
1051471126 9:17443703-17443725 TATTTCATTAAAAATGAAGAAGG + Intronic
1052446552 9:28568749-28568771 CTGTCCTTCAGAAATAAAGATGG + Intronic
1052649944 9:31290195-31290217 TTGTTTCTGAAAAATCAAGATGG - Intergenic
1052963514 9:34320231-34320253 TAGTTCTTCAAAGATGGGGAGGG + Intronic
1055307837 9:74949352-74949374 TTGTTTTTCATAAATTGAGATGG - Intronic
1055424585 9:76181128-76181150 TAGCTCTTGAAAAATGATGATGG - Intronic
1055624945 9:78166808-78166830 TTCTTCTTCAATAACGTAGAAGG + Intergenic
1055655247 9:78444503-78444525 TCCTTCTACAAAAATAAAGACGG - Intergenic
1055807124 9:80108325-80108347 TTGTTGTTCAAAAAAAAAAAGGG + Intergenic
1056170011 9:83975890-83975912 TTTTTCTTAAAAAATAAAAAAGG - Intronic
1056341104 9:85633008-85633030 TTTTACTGCAGAAATGAAGAAGG - Exonic
1058204186 9:102082378-102082400 TAGTTCTCAAAAAATGATGATGG + Intergenic
1058957536 9:109963100-109963122 TTGTTCTTGAAGAATGAGTATGG + Intronic
1059489275 9:114653764-114653786 CTGCTCTTCAAAAATGGAGCTGG - Intergenic
1059866788 9:118523183-118523205 TTGTTTTTCAAAAATCACGCTGG - Intergenic
1059969829 9:119654573-119654595 TTGTTTTTTAAATATGAACAAGG + Intergenic
1059970314 9:119660710-119660732 TTGATCTTCACAAATAAAGCAGG + Intergenic
1060716973 9:125941075-125941097 TTGCTCTTGACAAATGAAGGAGG + Intronic
1061381460 9:130261073-130261095 TTGTTCTTGAAACATGGGGATGG + Intergenic
1061432564 9:130540501-130540523 TTTTTCATGACAAATGAAGATGG - Intergenic
1062596539 9:137302302-137302324 TTGTTATGCAAATATAAAGAAGG - Intergenic
1185882682 X:3755412-3755434 TTGTCTTTCAAAAAGAAAGAAGG - Intergenic
1186723739 X:12334596-12334618 TTTTTTTTCACCAATGAAGAGGG - Intronic
1186822265 X:13302526-13302548 TTATCCTTCTAAAGTGAAGAAGG - Intergenic
1187429032 X:19204564-19204586 TTTTTCTTCAAATTTGAAAATGG + Intergenic
1187616832 X:21004587-21004609 TTATTTTGCCAAAATGAAGATGG - Intergenic
1187934657 X:24324006-24324028 TTGTTGTTTTAAAATGAAGTAGG + Intergenic
1188073944 X:25752876-25752898 TTGTTCTTCTAAAATGGGAATGG + Intergenic
1188138162 X:26515047-26515069 TTGCCCTACAAAAATGCAGAAGG + Intergenic
1188163872 X:26837180-26837202 TTGTTTTTCATAAATGATGTAGG + Intergenic
1188573622 X:31619271-31619293 TTATTCTTCTCAAATGAAAATGG + Intronic
1188677841 X:32965049-32965071 TGTTTCTTCAAAAATGAAAAGGG + Intronic
1188775096 X:34207047-34207069 ATGTGCTTGAAAAATGAATAAGG - Intergenic
1188996097 X:36887805-36887827 TTATTCTTCAGAAAAGAAGAGGG + Intergenic
1189855564 X:45221487-45221509 TGGTTCTTCAAAAATCTAAAAGG - Intergenic
1191837046 X:65475386-65475408 TTATCCTTTAAAAATAAAGAAGG - Intronic
1192382237 X:70629554-70629576 TTGTCTTTCAAAAAGGAAAAGGG + Intronic
1192677395 X:73212664-73212686 TTGTTATTGCAAAATGAAGCAGG + Exonic
1193810410 X:86044047-86044069 ATGGTCTTCAAAAAGAAAGAAGG + Intronic
1193874501 X:86844999-86845021 TTATTCTTCAAAAGTGAAGGAGG - Intergenic
1193887363 X:86998931-86998953 GTATTCTTCAATAATGAAGGTGG - Intergenic
1194284800 X:91996448-91996470 TTGATTTTTAAAAATGAAGAAGG - Intronic
1194675645 X:96790518-96790540 TTGTTCTTCCAAAAGCAACAAGG - Intronic
1194693162 X:97011577-97011599 TTGTTTTTCAAGAATGAAGAGGG + Intronic
1194766677 X:97849770-97849792 CTGTTCTTCAAACATAAACAAGG + Intergenic
1195219053 X:102729212-102729234 TTTTTTTTAAAAAATGAAGAAGG - Intronic
1195486291 X:105410674-105410696 TTATCCTTCAGAAATGAAGTAGG + Intronic
1195639960 X:107162614-107162636 ATGTCCTTCAGAAATGAAGGGGG + Intronic
1196971495 X:121114244-121114266 CTTTTCTTCAAAATTGAAGTCGG + Intergenic
1197081305 X:122420776-122420798 TTCTGCTTCAAACATGAAGCAGG + Intergenic
1197104129 X:122693563-122693585 ATATTCTTCAAAAATGAAAGAGG + Intergenic
1197646764 X:129026509-129026531 TTTTACTTCAAAAAAGAAGCAGG + Intergenic
1198201289 X:134421604-134421626 TTTTTCTTCCAAAATGAAAATGG - Intronic
1199348950 X:146776822-146776844 ATATTTTTCAACAATGAAGATGG - Intergenic
1199388139 X:147247300-147247322 TTGCTCTTCAAAAAAGAAAATGG + Intergenic
1200602367 Y:5221018-5221040 TTGATTTTTAAAAATGAAGAAGG - Intronic
1200782292 Y:7227722-7227744 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200782314 Y:7227902-7227924 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200893560 Y:8349694-8349716 CAGTTATTAAAAAATGAAGATGG - Intergenic