ID: 987631501

View in Genome Browser
Species Human (GRCh38)
Location 5:20478430-20478452
Sequence CCTTGGGCCTTGAGTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987631496_987631501 11 Left 987631496 5:20478396-20478418 CCTGACAGCATTCATCACAAGCT 0: 7
1: 41
2: 308
3: 584
4: 976
Right 987631501 5:20478430-20478452 CCTTGGGCCTTGAGTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987631501 Original CRISPR CCTTGGGCCTTGAGTGAACA TGG Intronic
No off target data available for this crispr