ID: 987631501 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:20478430-20478452 |
| Sequence | CCTTGGGCCTTGAGTGAACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987631496_987631501 | 11 | Left | 987631496 | 5:20478396-20478418 | CCTGACAGCATTCATCACAAGCT | 0: 7 1: 41 2: 308 3: 584 4: 976 |
||
| Right | 987631501 | 5:20478430-20478452 | CCTTGGGCCTTGAGTGAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987631501 | Original CRISPR | CCTTGGGCCTTGAGTGAACA TGG | Intronic | ||
| No off target data available for this crispr | |||||