ID: 987631993

View in Genome Browser
Species Human (GRCh38)
Location 5:20485595-20485617
Sequence CATTATATGAAAAAATTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1372
Summary {0: 1, 1: 0, 2: 8, 3: 140, 4: 1223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987631993_987631995 21 Left 987631993 5:20485595-20485617 CCTTTTAATTTTTTCATATAATG 0: 1
1: 0
2: 8
3: 140
4: 1223
Right 987631995 5:20485639-20485661 CTATCTTCAGAAACAATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987631993 Original CRISPR CATTATATGAAAAAATTAAA AGG (reversed) Intronic
900044715 1:496263-496285 CATTATTTTAAAAAATTGACAGG - Intergenic
900066119 1:731169-731191 CATTATTTTAAAAAATTGACAGG - Intergenic
900066514 1:734577-734599 CATTATTTTAAAAAATTGACAGG - Intergenic
900066910 1:737984-738006 CATTATTTTAAAAAATTGACAGG - Intergenic
901118693 1:6871845-6871867 AATTAAATTAAAAAATGAAATGG - Intronic
901631836 1:10651820-10651842 CATTTTATTAAAAAATAAAACGG + Intronic
902253001 1:15167941-15167963 CATGGTATAAAAAAATCAAATGG + Intronic
903403253 1:23073850-23073872 AATTCTATTAAATAATTAAAAGG - Intronic
903522813 1:23965690-23965712 CAACAGATGCAAAAATTAAAGGG + Intronic
903958702 1:27042648-27042670 TATTAAATTAAAAAATAAAAAGG + Intergenic
904191441 1:28747202-28747224 CATTCTATGAAAACATTAAAAGG - Intronic
904406476 1:30293261-30293283 CAATATATGAAACAAGCAAAGGG + Intergenic
904640599 1:31924728-31924750 GGTTTTATGATAAAATTAAATGG - Intronic
905158102 1:36005399-36005421 CATTGTAATAAAATATTAAAAGG + Intronic
906084927 1:43123709-43123731 AATTATAGCAAAAAGTTAAAAGG - Intergenic
906709571 1:47919199-47919221 AATTATCTGAACAAATGAAAAGG + Intronic
907025920 1:51118432-51118454 CATTTCATGAATAAAATAAATGG + Intronic
907094586 1:51766083-51766105 TATTATTTGGGAAAATTAAAAGG + Intronic
907230996 1:52998432-52998454 CAAAATATTAAAAAATTAACTGG + Intronic
907247243 1:53116018-53116040 CTTTATCTGAAAGAATGAAAGGG - Intronic
907621557 1:55986064-55986086 CAATATGTAAAAAAATAAAAAGG + Intergenic
907913862 1:58851121-58851143 CACTATATTAAAAACCTAAAGGG - Intergenic
908033164 1:60023014-60023036 TATGATCTGAAAATATTAAATGG - Intronic
908363808 1:63396644-63396666 GATTGTTTGAAAATATTAAAGGG + Intronic
908371823 1:63489760-63489782 CATCATGTGCATAAATTAAAGGG - Intronic
908417666 1:63929152-63929174 CATTATATTAAACAAGAAAAGGG - Intronic
908645208 1:66270770-66270792 AATTATAAGAAAAAAGAAAAAGG + Intronic
908901241 1:68958865-68958887 CAATATATAAAATAAATAAAAGG + Intergenic
908980261 1:69948172-69948194 CATAATCTGAAAATATTAAATGG - Intronic
909010954 1:70334463-70334485 CATAAAATGAAAAAATTAGCCGG + Intronic
909148277 1:71966610-71966632 ACTTATATGAAAGAATCAAATGG + Intronic
909154397 1:72053526-72053548 CGTGATGTGAAAAAAATAAAAGG - Intronic
909393364 1:75139552-75139574 CATTTTAGGAAAAAAATATAAGG + Intronic
909568540 1:77082485-77082507 CAATGGAGGAAAAAATTAAATGG - Intergenic
909605290 1:77501679-77501701 TATTAAAAGAAAAAAGTAAAAGG - Intronic
909702469 1:78542696-78542718 TATTATATATAAAAAATAAAAGG - Intergenic
909835775 1:80252677-80252699 CATTAATTCAAAAAATTATATGG - Intergenic
910249185 1:85177003-85177025 GATTATATGAGAAAAGAAAAGGG - Intronic
910484324 1:87695974-87695996 CATTACACGAAAAATTTGAATGG + Intergenic
910570997 1:88702424-88702446 CAAAGTATGAAAAAATAAAAAGG - Intronic
910914194 1:92271833-92271855 GATTATATGACAAAAGTGAAGGG + Intronic
910921631 1:92354594-92354616 CATTAAATGCAAACATTAACAGG + Intronic
910997051 1:93117209-93117231 CTTTATTTGAAAATAATAAAAGG - Intronic
911018148 1:93357324-93357346 CATTATAGCAAAAGATGAAAGGG - Intronic
911700102 1:100942820-100942842 CTGTGTATGAAAAAAGTAAAAGG + Intronic
911942055 1:104058937-104058959 CATAAAATAAAAAATTTAAAAGG + Intergenic
911999639 1:104815467-104815489 CATTTAGTGAAAAATTTAAAAGG + Intergenic
912228170 1:107759904-107759926 GATTTTATGAAAAAATAATAAGG - Intronic
912720337 1:112014702-112014724 CATGAAGTGAACAAATTAAAGGG - Intergenic
912835849 1:112995759-112995781 TAATATATGAAAAAATTAGCTGG + Intergenic
912986925 1:114443071-114443093 CATTATTTAAAAAAAAAAAAAGG - Intronic
913130302 1:115833065-115833087 AATTTTATTAAAAAATAAAATGG + Intergenic
913478951 1:119266382-119266404 CAATATATGAAAGAAGAAAATGG + Intergenic
913543662 1:119845557-119845579 CAATATATGGGAAAATGAAATGG - Intergenic
914324839 1:146602444-146602466 CATTATAACAAATAATTATAAGG + Intergenic
915143871 1:153783259-153783281 CATAACATGTAAAAATTACACGG + Intergenic
915478242 1:156167060-156167082 CAAAATATTAAAAAATTAACTGG - Intronic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916208665 1:162340225-162340247 AATTAAATTAATAAATTAAATGG - Intronic
916437233 1:164788358-164788380 CATTAAATAAATAAATGAAAAGG - Intronic
916539502 1:165739337-165739359 CATTTTTAGAAATAATTAAAAGG + Intronic
916764923 1:167850971-167850993 AATTATGTGAAAGAAATAAAAGG + Intronic
917047109 1:170873109-170873131 CAATATTGAAAAAAATTAAATGG - Intergenic
917464727 1:175266076-175266098 TATGATCTGAAAATATTAAATGG - Intergenic
917945009 1:179960468-179960490 CATTATTTGAGAAATTTTAATGG + Intronic
917994710 1:180423998-180424020 CATTTTTTTAAAACATTAAATGG + Intronic
918062026 1:181070226-181070248 CAATATATGAATAAATTCCATGG - Intergenic
918212211 1:182361111-182361133 TATTAAATGTTAAAATTAAATGG - Intergenic
918391704 1:184071091-184071113 TATTATATGAATCAATTAAATGG - Intronic
918672830 1:187241384-187241406 TAGTAGATGAGAAAATTAAATGG - Intergenic
918691345 1:187483811-187483833 CCTTATTTTAAAAAATTCAATGG + Intergenic
918805066 1:189030140-189030162 CATTACATGAAAATATGATAAGG - Intergenic
918832141 1:189412163-189412185 AATTATATGAAAAAAGTCATTGG + Intergenic
918846417 1:189620776-189620798 TATTTTAAGTAAAAATTAAAGGG + Intergenic
918848348 1:189648520-189648542 CATGAGAGGAAAAAAGTAAAGGG + Intergenic
918878934 1:190088377-190088399 CTTTATATGACATAATGAAATGG + Intergenic
918879666 1:190100773-190100795 CAGTATAAGAAATAATTAAAAGG - Intronic
918917249 1:190659209-190659231 CACAATCTGGAAAAATTAAATGG - Intergenic
919112983 1:193242751-193242773 CAGTATATCTAAATATTAAAAGG + Intronic
919146022 1:193636044-193636066 CATTATATTTACAAATTAAACGG + Intergenic
919291264 1:195634712-195634734 CATTATATGAGAACATAAAAAGG - Intergenic
919353318 1:196488477-196488499 TATTATTTGAAAACATTAAGAGG - Intronic
919382033 1:196871616-196871638 TCATATATGAACAAATTAAATGG - Intronic
919463558 1:197906583-197906605 TATTATAAGCAAAAAATAAATGG + Intronic
919576222 1:199312985-199313007 GATTATATGAACAAATATAATGG - Intergenic
920636685 1:207711063-207711085 AATTATATTGAAAAATTATATGG + Intronic
920989218 1:210920424-210920446 CATAATATGAAAAATTTTAAGGG + Intronic
921389200 1:214602725-214602747 CATTTTATTAAAAAGTTAACAGG - Intergenic
921434856 1:215106746-215106768 CACCATATGCAAAAATTAACAGG - Intronic
921605312 1:217145137-217145159 CTTTTAATGAAAAAATTACAAGG + Intergenic
921695864 1:218209346-218209368 CATTATGTGAAAAAAGGTAAAGG - Intergenic
922993397 1:229936204-229936226 TACTATATATAAAAATTAAATGG + Intergenic
923144346 1:231187387-231187409 CATTTTTTAAAAAAATTAAAAGG - Intronic
923232487 1:231999991-232000013 CATAAAATAAAAAAATTAAATGG + Intronic
923576963 1:235167792-235167814 CATTGTGTGAAAAAAGAAAATGG - Exonic
924003252 1:239577309-239577331 TTTTATTTAAAAAAATTAAAAGG - Intronic
924541992 1:244989865-244989887 CAAGATCTGAAAATATTAAATGG + Intronic
924832489 1:247612633-247612655 CATAATATGAATAAAATAATTGG + Intergenic
924922662 1:248647032-248647054 CATTAGAGGAAAAAAGAAAAAGG + Intergenic
1063242370 10:4184288-4184310 CATTATATGAAAAAGATACTTGG + Intergenic
1063312337 10:4965629-4965651 CATTTTTTGGAAAAATTAACAGG - Intronic
1063444441 10:6101114-6101136 GATTATAGTAATAAATTAAAAGG + Intronic
1063786039 10:9383804-9383826 CATAATATGAGAAATTTAGAAGG + Intergenic
1064637573 10:17385348-17385370 CATTATATGTAAGAAGTAATTGG - Intronic
1064891503 10:20179630-20179652 AATTATATTAAAAAATGAAATGG - Intronic
1065037989 10:21660123-21660145 AATTATAAGAAAAAATTAGATGG - Intronic
1065072905 10:22045895-22045917 CATTAAAGGAAAAATTTATATGG + Intergenic
1065146646 10:22775898-22775920 CTTTTAATAAAAAAATTAAAAGG - Intergenic
1065222686 10:23512479-23512501 CACAATCTGAAAATATTAAATGG + Intergenic
1065263204 10:23947647-23947669 TATTAAATGAAATAATTTAATGG - Intronic
1065461355 10:25968695-25968717 CACTGTTTGAAAATATTAAATGG + Intronic
1065775105 10:29112308-29112330 CAAAATATAAAAAAATTAACTGG + Intergenic
1065862124 10:29880731-29880753 CAAAAAATGAAAAAATTAACTGG + Intergenic
1066055987 10:31680546-31680568 CATGGTCTGAAAATATTAAATGG + Intergenic
1066483716 10:35823453-35823475 CATTATATCATAAAATAAGAAGG + Intergenic
1066530265 10:36330108-36330130 CATTATAAGAAATGTTTAAAAGG - Intergenic
1067011590 10:42719244-42719266 CTTTATATGCAAAAAAAAAAAGG - Intergenic
1067138348 10:43632061-43632083 TTTAATATGAAACAATTAAAGGG + Intergenic
1067355531 10:45521669-45521691 AATTATACGAAATAATTTAAAGG - Intronic
1068054782 10:51998164-51998186 CATTATATTAACCAATTAAAGGG - Intronic
1068207659 10:53877051-53877073 TATTATTTTAAAAAATTATATGG + Intronic
1068865167 10:61887396-61887418 CAAAAAATGAAAAAATTAACTGG - Intergenic
1069153203 10:64992145-64992167 CAAAATGTTAAAAAATTAAAAGG + Intergenic
1069210626 10:65755077-65755099 CAGTAAATGGAAAAATAAAATGG - Intergenic
1070185649 10:74059840-74059862 AAATATATGAAAGAATTTAAAGG + Intronic
1070365000 10:75728307-75728329 CATTATATTGAAAAATGATAGGG + Intronic
1070580985 10:77719333-77719355 CATTATTAGAAAAGATGAAAAGG - Intergenic
1070687657 10:78501194-78501216 CATTATGTGTTAAAATTGAAAGG + Intergenic
1071012821 10:80957666-80957688 AATTAAAATAAAAAATTAAATGG - Intergenic
1071195237 10:83151435-83151457 CAATATATGTAAAAGTTAAAAGG - Intergenic
1071326079 10:84519548-84519570 CACTTAATGACAAAATTAAAAGG - Intergenic
1071744607 10:88402247-88402269 CATTATAAGACAAAATAGAAAGG + Intronic
1071914878 10:90282412-90282434 CATGGTCTGAAAATATTAAATGG - Intergenic
1072064445 10:91852242-91852264 AATAATATAAAAAAATAAAAAGG + Intronic
1072068185 10:91890503-91890525 CATTTTATTAAAAAAAAAAAAGG + Intergenic
1072330733 10:94348808-94348830 CACAATATGAAAAAATAATATGG + Intronic
1072348475 10:94532867-94532889 CATGATTAGAAAAAAATAAAGGG + Intronic
1073113708 10:101078868-101078890 AATTATATGATAAAAATAAGTGG - Intergenic
1073563666 10:104517760-104517782 CAGTATATGAAAATATTCGAAGG + Intergenic
1073720417 10:106163046-106163068 AAATATATCAAAAAACTAAAGGG + Intergenic
1074076225 10:110128372-110128394 CATCAAAATAAAAAATTAAAAGG - Intronic
1074101273 10:110356542-110356564 CATTAAAGGAAAAAAGAAAAGGG - Intergenic
1074810131 10:117096147-117096169 CACTATCTCCAAAAATTAAACGG + Intronic
1074988312 10:118677782-118677804 CATTATGTGTAATAATTAAAAGG - Exonic
1075678018 10:124309812-124309834 AATTATAAAAAAAAATTAAATGG + Intergenic
1075868237 10:125746523-125746545 CATTTTTTAAAAAAAGTAAATGG + Intronic
1076568093 10:131412472-131412494 CTTTATTTGAAAAAAAAAAAAGG + Intergenic
1076971040 11:132738-132760 CATTATTTTAAAAAATTGACAGG - Intergenic
1077432611 11:2523357-2523379 AAAAATATGAAAAAATTAACTGG - Intronic
1078513689 11:12006221-12006243 CATGACATGGAACAATTAAAGGG - Intronic
1078733866 11:14001869-14001891 GATTAGATGAAATAATAAAAGGG + Intronic
1078939629 11:15987514-15987536 CATTCTGTGAAAAAATTATTAGG - Intronic
1079351959 11:19699311-19699333 CATTGTTTGAAGCAATTAAATGG + Intronic
1079678572 11:23263681-23263703 CATTATGTGGAATACTTAAAAGG - Intergenic
1080510812 11:32969060-32969082 CCTCATATGAAAAAAATAGATGG + Exonic
1080580176 11:33635925-33635947 TATGATCTGAAAATATTAAATGG + Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080618262 11:33964511-33964533 CATTTTATGAAAAACAGAAATGG + Intergenic
1080665816 11:34335121-34335143 CATATTATGAAGAAATTAAGTGG - Intronic
1080817062 11:35768588-35768610 CATTATTTCAAAAACTTTAATGG + Intronic
1080975520 11:37335315-37335337 CATTAAATGGAAATATTAAGAGG + Intergenic
1080990800 11:37532110-37532132 AATTATGTGAAAGAATCAAAAGG - Intergenic
1080992265 11:37551535-37551557 TTTTCTATGAAATAATTAAAAGG + Intergenic
1081144352 11:39543426-39543448 CATTAATTGACAAAATTAAGAGG - Intergenic
1081273065 11:41111131-41111153 CTATAAATGAAGAAATTAAAGGG + Intronic
1081826631 11:46060042-46060064 ATTTATATTAAAAAATAAAATGG - Intronic
1082203324 11:49400679-49400701 GAATAAATGAGAAAATTAAAAGG - Intergenic
1082626261 11:55490398-55490420 CATTAGAGGAAAAAATAAACAGG - Intergenic
1082630833 11:55540040-55540062 AATTATATGAAATAATTACTAGG + Intergenic
1082872842 11:57959541-57959563 CATGATCTAAAAATATTAAATGG - Intergenic
1083698786 11:64460318-64460340 GAGTGTATAAAAAAATTAAAGGG - Intergenic
1083701380 11:64480595-64480617 CAAAAAATGAAAAAATTAATTGG - Intergenic
1084382257 11:68820369-68820391 CACCATCTGAAAATATTAAATGG + Intronic
1084984783 11:72859172-72859194 CATGATCTGAAAATATTAAGTGG + Intronic
1085063229 11:73468063-73468085 CATTTTTTAAAAAAATTAACAGG + Intronic
1085496145 11:76971620-76971642 CAAAATATGAAAAACTCAAACGG + Intronic
1085543468 11:77295298-77295320 CATTCTTTGTAAAAATTAAATGG + Intronic
1085576335 11:77607163-77607185 CAATATATGACAAAATTCAATGG - Intronic
1085612401 11:77963584-77963606 CTATATATTAAAAAAATAAATGG + Intronic
1085954636 11:81377035-81377057 CAGTACAGCAAAAAATTAAAAGG - Intergenic
1086204913 11:84246184-84246206 CATTGTCTGAAAATATTAAATGG + Intronic
1086495084 11:87395254-87395276 CATTACATCAAAAAAGTACATGG - Intergenic
1086641688 11:89166269-89166291 CATTATATGAACCTATAAAAAGG - Intergenic
1086800418 11:91167501-91167523 TATTAGATTAAAAAATAAAATGG + Intergenic
1087301876 11:96445363-96445385 TATTATTTTAAAAATTTAAATGG + Intronic
1087386659 11:97479424-97479446 GAATATTTGGAAAAATTAAAAGG + Intergenic
1087411399 11:97794220-97794242 CAGTATATAAGAATATTAAATGG + Intergenic
1087492013 11:98840066-98840088 CACAATTTAAAAAAATTAAAGGG - Intergenic
1087657323 11:100940203-100940225 TATTAAAGAAAAAAATTAAATGG + Intronic
1087769205 11:102189148-102189170 GTTTATATGAAATAATTTAATGG - Intronic
1087993492 11:104775109-104775131 CACTATAAGAAAAAGATAAAAGG + Intergenic
1088023573 11:105150589-105150611 TATTCTATAAAACAATTAAAGGG + Intergenic
1088547153 11:110970989-110971011 CATTATATTAACAAATAAATGGG + Intergenic
1088784683 11:113170521-113170543 CACTATTTGAAAAGATCAAAAGG + Intronic
1089044671 11:115490171-115490193 CAGTAAATGAAACAATTAAGGGG + Intronic
1089275009 11:117328737-117328759 TATTAGATGAATAAATTAAAGGG - Intronic
1089547120 11:119236929-119236951 CATGGTTTGAAAATATTAAATGG + Intronic
1089732583 11:120528409-120528431 CTTAATATAAAAAAATTATAGGG - Intronic
1089905831 11:122037533-122037555 CGTTAAATGAACAAATAAAAAGG - Intergenic
1089922571 11:122223692-122223714 CAGTGTCTTAAAAAATTAAATGG - Intergenic
1090597850 11:128338461-128338483 TTTTTTATGAACAAATTAAAGGG - Intergenic
1090622143 11:128569730-128569752 GAGTATGTGAAAAAATTAAAGGG + Intronic
1090979127 11:131701701-131701723 CATTAAATGAAGAAATAACAAGG - Intronic
1091599083 12:1907259-1907281 CATGATATGCACATATTAAAGGG - Intronic
1091827864 12:3527483-3527505 CATTGTCTGAAAATATTAAATGG - Intronic
1092883706 12:12907791-12907813 CTTTATATTAAAAAATTAGCTGG - Intronic
1093102407 12:15043395-15043417 CATTATATGAAGAAAAAATAAGG - Intergenic
1093320618 12:17708829-17708851 AATTATGGGAAAATATTAAAAGG + Intergenic
1093369320 12:18347996-18348018 AATTTTATGAAAAATTTTAAAGG + Intronic
1093586428 12:20842730-20842752 AAGTATAAGAAAACATTAAAAGG - Intronic
1093654024 12:21674718-21674740 TATTATAGGAAATAATTTAATGG + Intronic
1093778832 12:23110347-23110369 AAACATATGCAAAAATTAAATGG - Intergenic
1093818229 12:23577090-23577112 CATTTTATGAAATGGTTAAATGG + Intronic
1094022852 12:25932524-25932546 TATTACATTAAAAAATAAAAAGG + Intergenic
1094280986 12:28737871-28737893 TATTAAGTGAAAAAATTCAAGGG + Intergenic
1094312536 12:29100010-29100032 CATGGTCTGAAAATATTAAATGG + Intergenic
1094436955 12:30431247-30431269 TACTATATGAAAAGAGTAAAGGG - Intergenic
1094462067 12:30707001-30707023 AATTATATGGAATAATTATATGG + Intergenic
1094784599 12:33832139-33832161 GAATATATGAATAAATAAAAAGG + Intergenic
1095272080 12:40231189-40231211 AATTATAGGAAAAAATGAAGTGG - Intronic
1095315931 12:40761295-40761317 TATTTTATGAGAAAATTAAATGG - Intronic
1095329904 12:40947494-40947516 CATTAAATGAATAAATAAAATGG - Intronic
1095579875 12:43785310-43785332 CATGATAAAAAAAAATTAACAGG - Intronic
1095596941 12:43969972-43969994 CATGATCTGAGAATATTAAATGG + Intronic
1095879894 12:47122119-47122141 CATTAATTGAAATAATAAAATGG + Intronic
1095985755 12:47998511-47998533 CATTAGATCAAACAAGTAAAAGG + Intronic
1096046161 12:48564212-48564234 CAATAAATGAAAAAAATGAATGG + Intergenic
1096183018 12:49560961-49560983 CATTTTTTCAAAAAATGAAATGG + Intronic
1096339725 12:50787414-50787436 AACTATATGAAAAAGTCAAATGG + Intronic
1096475325 12:51906124-51906146 AATTAAATGAATAAATGAAAAGG - Intergenic
1096576847 12:52558129-52558151 CATTCAAGAAAAAAATTAAATGG + Intergenic
1097009770 12:55944459-55944481 CTTTAAATTAAAAAATAAAAAGG + Intronic
1097283394 12:57859841-57859863 CATCATATGAAAACAGAAAATGG - Intergenic
1097575457 12:61387927-61387949 CATTAAGAGAAAAAAATAAATGG + Intergenic
1097713148 12:62936531-62936553 CTATACATGAAAAAGTTAAAGGG - Intergenic
1097892962 12:64796543-64796565 CACCATATGAAAGAAATAAAGGG + Intronic
1097952199 12:65443943-65443965 CAATATATGACTGAATTAAAAGG - Intronic
1097965920 12:65581180-65581202 CATTATATGAAAAAGATACTTGG + Intergenic
1098118350 12:67205511-67205533 AATTATAGGCAAAAATTATATGG + Intergenic
1098182608 12:67863910-67863932 AAGTATAATAAAAAATTAAAAGG - Intergenic
1099027489 12:77483839-77483861 CATAAAATGACAGAATTAAAAGG - Intergenic
1099094903 12:78362643-78362665 TTTTATATTAAAAAATTAAGTGG + Intergenic
1099134109 12:78872831-78872853 AATTACATAAACAAATTAAAAGG - Intronic
1099135066 12:78887092-78887114 CATGGTCTGAAAATATTAAATGG + Intronic
1099351261 12:81571893-81571915 CAGTATATGAAAGAAGTAGATGG - Intronic
1099353636 12:81606287-81606309 CATTATACCAAAAAGTTACATGG - Intronic
1099458141 12:82889405-82889427 GCTTATTTGAAAAAACTAAAAGG - Intronic
1099586833 12:84528796-84528818 CTTAATATGAAAAAATTCAGGGG + Intergenic
1099634953 12:85201712-85201734 CATTTTATGAAAACATTAATAGG - Intronic
1099674444 12:85740695-85740717 CACTAAAATAAAAAATTAAATGG - Intergenic
1099696613 12:86030452-86030474 CATTAAATGAAAAAGTTCACTGG + Intronic
1099713108 12:86253825-86253847 CATTACATGAAACTAATAAAGGG + Intronic
1099736768 12:86577560-86577582 CATTATATCAACAGAATAAAGGG - Intronic
1099867041 12:88295943-88295965 CATTGTATGAACAAATGTAATGG + Intergenic
1099938656 12:89158874-89158896 CATTAGATCAAACAATTCAAAGG + Intergenic
1100079406 12:90829220-90829242 CATCATATGTGAAACTTAAATGG + Intergenic
1100113224 12:91271032-91271054 CATTAATTAAAAGAATTAAAAGG + Intergenic
1100522242 12:95386292-95386314 CTATACATGAAAAAATTAATAGG - Intergenic
1100677633 12:96885539-96885561 AATTCTATGAATAGATTAAATGG - Intergenic
1100696177 12:97096504-97096526 ACTTATATAGAAAAATTAAAAGG - Intergenic
1100946975 12:99796324-99796346 CATGGTCTGAAAACATTAAAAGG - Intronic
1101095818 12:101339494-101339516 CTTTATTTAATAAAATTAAAGGG + Intronic
1101141341 12:101798942-101798964 CATTACAAGAAAAAGTTGAATGG + Intronic
1101363134 12:104046760-104046782 CATTATAGCAAAAAGTTAAAAGG - Intronic
1101396311 12:104351520-104351542 CATAACAGGAAGAAATTAAAAGG - Intergenic
1101472890 12:105015506-105015528 CACAATATAAAAATATTAAATGG + Intronic
1101485394 12:105152862-105152884 CATTATATGCACAAGTAAAATGG - Intronic
1101684275 12:107001674-107001696 CTTTACATGGCAAAATTAAAAGG + Intronic
1102790716 12:115643115-115643137 CATGATATAAAAAAGATAAATGG - Intergenic
1102863375 12:116355415-116355437 GATTCTAAGAAAAAATTAGAAGG + Intergenic
1102972408 12:117179951-117179973 CATAATACTAAAAAATTAATTGG - Intronic
1103145126 12:118589035-118589057 CAATATATAAAAACATGAAATGG + Intergenic
1103493179 12:121339459-121339481 AATAAAATTAAAAAATTAAAAGG - Intronic
1103594160 12:122013520-122013542 CATTATTTTAAAAAATCAACCGG + Intergenic
1103887272 12:124212085-124212107 CATTATATGGAAATATGGAAAGG - Intronic
1104114427 12:125735678-125735700 CAGGATCTGAAAATATTAAATGG + Intergenic
1104244675 12:127026807-127026829 CATTTCAGGGAAAAATTAAAAGG + Intergenic
1104853275 12:131889099-131889121 CAAAATATGAAAAAATTAGCTGG + Intergenic
1104888620 12:132127376-132127398 AAATATATGTAAAAATTACAGGG - Intronic
1105331371 13:19419567-19419589 CATCATATACAAAAATTAACCGG + Intergenic
1105840324 13:24248465-24248487 AATTATCTGAAAAAATTAGAAGG + Intronic
1105880459 13:24601290-24601312 CATCATATATAAAAATTAACTGG - Intergenic
1106125007 13:26894042-26894064 AAATATAAGAAAAAATTACAAGG + Intergenic
1106610756 13:31277966-31277988 CATATTATGAAAAAAGTAAAAGG - Intronic
1106632203 13:31486597-31486619 CATTGTATTAAAAAAATCAAGGG + Intergenic
1106982092 13:35299247-35299269 GAATATATAAAAAAATTACAAGG - Intronic
1107181636 13:37467978-37468000 CCTTAAATGAAAAACTTAGAAGG + Intergenic
1107277687 13:38695310-38695332 AATTATATGAAAAATATAAAAGG + Intronic
1107485081 13:40818702-40818724 CATCATATACAAAAATTAACTGG + Intergenic
1107844120 13:44493434-44493456 CATTCTTTGAAAACATTGAAAGG + Intronic
1108016126 13:46078389-46078411 CATTTTATGGAAATGTTAAATGG + Intronic
1108287513 13:48923261-48923283 CATTAAATGAAAGAGTTTAATGG + Intergenic
1108793226 13:53997956-53997978 TAATATATGAAATATTTAAAAGG + Intergenic
1108948282 13:56051730-56051752 TATTTTAGGAAAAAATTATATGG - Intergenic
1108969390 13:56353646-56353668 CATTATATCATAATATCAAATGG + Intergenic
1109104084 13:58227144-58227166 ATTTATTTGAAAAAATAAAAAGG + Intergenic
1109311440 13:60698834-60698856 CTTTAAATGAAAATATTTAAAGG + Intergenic
1109410976 13:61969303-61969325 CATTAAATGTAAATATTATAGGG + Intergenic
1109464776 13:62716033-62716055 CAATATCAGAAAACATTAAATGG - Intergenic
1109490584 13:63093712-63093734 AATTAGTTAAAAAAATTAAAAGG + Intergenic
1109611449 13:64770537-64770559 CATGTTCTGAAAAAATAAAAGGG + Intergenic
1109694187 13:65931717-65931739 TCCTATTTGAAAAAATTAAATGG - Intergenic
1109731991 13:66424292-66424314 CATTATGTGAAGAAAGTCAATGG - Intronic
1109732491 13:66433313-66433335 AAGTATATGAAAAGATTAATTGG - Intronic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1109857993 13:68157807-68157829 AATTACATTATAAAATTAAAAGG + Intergenic
1109975045 13:69820494-69820516 CATTTTACAAAAAAATAAAAAGG + Intronic
1110029862 13:70596207-70596229 TTTTATATCAAAATATTAAAGGG + Intergenic
1110142590 13:72149134-72149156 CATTTTATAAATAAGTTAAATGG + Intergenic
1110197046 13:72801876-72801898 CATTGTAAGAAAAAGTTAATGGG + Intronic
1110468298 13:75828222-75828244 AATTAAATGAAACATTTAAAAGG - Intronic
1110819174 13:79894321-79894343 CATTATTTGAAATAATTGAGTGG - Intergenic
1110840087 13:80132029-80132051 AATTGTAATAAAAAATTAAAGGG - Intergenic
1111005657 13:82244606-82244628 TTTGAGATGAAAAAATTAAAGGG - Intergenic
1111100996 13:83586025-83586047 CATTATATTATAAATTTACAAGG - Intergenic
1111376834 13:87391184-87391206 AATTATACCAAAAAATTGAAGGG - Intergenic
1111549324 13:89785622-89785644 CACAATGGGAAAAAATTAAATGG + Intergenic
1111652453 13:91109058-91109080 TTTTAAAAGAAAAAATTAAATGG + Intergenic
1112027133 13:95421391-95421413 AATCATAGGAAAAAAATAAAAGG - Intergenic
1112047046 13:95608312-95608334 CAAAAAATGAAAAAATTAAAAGG + Intronic
1112456865 13:99570996-99571018 CATTAGGTCAAAAAATAAAAGGG - Intergenic
1112533625 13:100228431-100228453 CAATACATGAAAATATGAAAGGG - Intronic
1112866962 13:103915161-103915183 TATTAAATGAATAAATAAAATGG + Intergenic
1112957969 13:105084956-105084978 CATGGTCTGAAAATATTAAATGG + Intergenic
1113075142 13:106460789-106460811 CAATAAATGAATGAATTAAATGG - Intergenic
1113130350 13:107029841-107029863 TTTGAAATGAAAAAATTAAATGG + Intergenic
1113613592 13:111665331-111665353 CTTTAGAGGAAAAAATTAAAAGG + Intronic
1114151582 14:20046202-20046224 CTTGATAAGAAAAAATAAAAAGG - Intergenic
1114341273 14:21747309-21747331 CATTTTATGAAAAAATCATAGGG + Intergenic
1114785280 14:25590051-25590073 ATTTCTATAAAAAAATTAAAAGG - Intergenic
1115170998 14:30506816-30506838 AATTAAATTTAAAAATTAAATGG - Intergenic
1115272149 14:31564692-31564714 CATGATTTTAAAAAATTAAGTGG + Intronic
1115453163 14:33572291-33572313 CATTTTTTTAAAAATTTAAAAGG + Intronic
1115505401 14:34088783-34088805 CACCATATTAATAAATTAAAAGG + Intronic
1115925039 14:38423472-38423494 CATTGAATCAAGAAATTAAAGGG - Intergenic
1116377623 14:44223946-44223968 CATAAGATGTTAAAATTAAAGGG + Intergenic
1116554488 14:46286278-46286300 CATTATATTTAAAAATTTATTGG + Intergenic
1116562857 14:46403421-46403443 ATTTAAATGAAAACATTAAACGG - Intergenic
1116638424 14:47428963-47428985 TATTATATAAAAAAACTAAGGGG + Intronic
1116719115 14:48470201-48470223 CATTATAAGTAAAAACTAATGGG - Intergenic
1116829032 14:49699760-49699782 GATAATATCAAAAAAGTAAATGG + Intronic
1117010413 14:51464956-51464978 CAATCTATGAAATAATTCAAGGG + Intergenic
1117131233 14:52688914-52688936 CTTTGTGTGAAAAAATAAAATGG - Intronic
1117416245 14:55499300-55499322 CATAATATGATAAAAGTATATGG + Intergenic
1117453424 14:55874137-55874159 CATTTTAATTAAAAATTAAAAGG + Intergenic
1118260231 14:64239425-64239447 CATTAAATGAAAGAAATAGAGGG - Intronic
1118829189 14:69413402-69413424 CCTTACATGGCAAAATTAAAAGG - Intronic
1119066431 14:71532093-71532115 TATAATATGTATAAATTAAAGGG - Intronic
1120213527 14:81658073-81658095 AAATATGGGAAAAAATTAAAAGG - Intergenic
1120450504 14:84660677-84660699 CATTATATGAAAAAGATACTTGG - Intergenic
1120790383 14:88575389-88575411 TATTATTTAAAAAAACTAAAAGG + Intronic
1121961689 14:98266153-98266175 CATTTTATTCATAAATTAAAGGG + Intergenic
1122358628 14:101142454-101142476 AATAATATAATAAAATTAAAAGG - Intergenic
1122684776 14:103496711-103496733 CTTTTTATTAAAAAAATAAAAGG - Intronic
1123419958 15:20123537-20123559 AATTAAATGGAAAATTTAAATGG + Intergenic
1123445903 15:20329995-20330017 AATTAAATGGAAAATTTAAATGG - Intergenic
1123539352 15:21272566-21272588 TATTATTTGAAATAATAAAAAGG - Intergenic
1124358906 15:29019992-29020014 CAGGAAATGAAAAAATAAAATGG - Intronic
1124367878 15:29086814-29086836 AATTATAAAACAAAATTAAATGG - Intronic
1124367879 15:29086833-29086855 AATTATATAAAATAATTACATGG + Intronic
1124526186 15:30455483-30455505 CATTATATGGAAAATGTATAGGG + Intergenic
1125914905 15:43477397-43477419 AATTATGTCAAAATATTAAATGG + Intronic
1125997553 15:44178332-44178354 AATAAAATAAAAAAATTAAAAGG + Intronic
1126319928 15:47410937-47410959 TTTTCTTTGAAAAAATTAAATGG - Intronic
1126321313 15:47427153-47427175 CATAATATGAACAACTTTAATGG + Intronic
1126393615 15:48187244-48187266 CATTTTTTGAAAAAAAAAAAAGG + Intergenic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1126486776 15:49189866-49189888 CATGGTCTGAAAATATTAAATGG - Intronic
1126571801 15:50159716-50159738 CATCAACTGAAAAAATTATACGG + Intronic
1127020445 15:54740993-54741015 CATTCTAAGCAAAAATAAAAAGG + Intergenic
1127099388 15:55549649-55549671 CATTATCTTTAAGAATTAAAAGG - Intronic
1127304746 15:57694279-57694301 CATTAGATATAAAAATTAAATGG + Intronic
1127442566 15:59025093-59025115 CATTATTTGCAAAAACCAAAAGG - Intronic
1127491939 15:59473217-59473239 CATGATCTGGAAATATTAAATGG + Intronic
1127509309 15:59624421-59624443 CTTTGTAATAAAAAATTAAATGG - Intronic
1128034295 15:64509990-64510012 CAAGATGTGAAAATATTAAATGG + Intronic
1128040765 15:64571367-64571389 TATTATATGAATAGATTAAATGG + Intronic
1128181132 15:65605495-65605517 CTTTGAAGGAAAAAATTAAAAGG + Intronic
1128597799 15:68967522-68967544 CATTAAATAAAAAATTTTAAAGG - Intronic
1128622730 15:69164684-69164706 TATAATATGTAAAAATTACATGG - Intronic
1129010254 15:72409657-72409679 CATTATATGACTAAATTGACAGG + Intergenic
1129480292 15:75819342-75819364 CACTATATTAATAAAATAAAAGG - Intergenic
1129544846 15:76384890-76384912 GTTTATAAGAAAAAAGTAAAAGG + Intronic
1129632977 15:77281937-77281959 CTGTATTTGAAAGAATTAAATGG - Intronic
1130221830 15:82025940-82025962 CATAATAGGAAACAATTACAGGG - Intergenic
1130244307 15:82230088-82230110 CATGATATGACAAAAGCAAAAGG + Intronic
1130315007 15:82787717-82787739 CATTAAAAAAAAAACTTAAAAGG + Intronic
1130456145 15:84111038-84111060 CATGATATGACAAAAGCAAAAGG - Intergenic
1130500173 15:84491416-84491438 CATTATATTTAGAAATTAAATGG - Intergenic
1130658423 15:85810142-85810164 CAGTATCTGAAAATATTAAATGG + Intergenic
1130819171 15:87475440-87475462 CATCATAGGACCAAATTAAAAGG - Intergenic
1130846010 15:87746799-87746821 AATTAAATGAGAAAAATAAAAGG - Intergenic
1131115790 15:89794504-89794526 AAATAAATAAAAAAATTAAAGGG + Intronic
1131614085 15:93995441-93995463 CATTAAAAAAAAAAATAAAATGG - Intergenic
1131663320 15:94542215-94542237 AGTTATAGGAAAAATTTAAAAGG + Intergenic
1131794250 15:95998275-95998297 CATAATATGAAAGAGTTCAAAGG - Intergenic
1132100511 15:99019871-99019893 CATAGTCTGAAAATATTAAATGG - Intergenic
1132116497 15:99140071-99140093 CTTTATTTAAAAAAATAAAAGGG - Intronic
1132436694 15:101811476-101811498 CATTATAGATAAAATTTAAAAGG + Intronic
1133415369 16:5602680-5602702 CACTATAGAAAAAAAATAAAAGG - Intergenic
1133951309 16:10395925-10395947 TATTATTTGAAAAAAAAAAATGG - Intronic
1134614961 16:15643614-15643636 CTTTATTTTTAAAAATTAAATGG + Exonic
1134899530 16:17924790-17924812 AATTACATAAAAAAATAAAATGG - Intergenic
1136923322 16:34350027-34350049 CAAAAAATGAAAAAAATAAAAGG - Intergenic
1136981251 16:35061779-35061801 CAAAAAATGAAAAAAATAAAAGG + Intergenic
1138765899 16:59603036-59603058 CATTGTATGAATAAATTACAAGG - Intergenic
1138796349 16:59974284-59974306 CATGGTGTGAAAATATTAAATGG - Intergenic
1138840294 16:60494017-60494039 CATTGTAAAAAAACATTAAAAGG - Intergenic
1138890031 16:61130593-61130615 GATTTTAAGAAAAAATTACAAGG - Intergenic
1138949202 16:61890266-61890288 TATAACAGGAAAAAATTAAAAGG + Intronic
1139144899 16:64311544-64311566 CATACTATGAAAAACATAAAGGG + Intergenic
1139197539 16:64938218-64938240 CATAATAGCAAACAATTAAAAGG + Intergenic
1139402191 16:66691737-66691759 AACATTATGAAAAAATTAAACGG - Intronic
1139488931 16:67276194-67276216 GATTAAATGACAAAATTTAATGG + Intergenic
1140008724 16:71108502-71108524 CATTATAACAAATAATTATAAGG - Intronic
1140055846 16:71524971-71524993 CACGATTTGAAAATATTAAATGG + Intronic
1140201472 16:72898258-72898280 ATTTATAAGAAAAAAGTAAAAGG + Intronic
1140940540 16:79717917-79717939 CACTTTATGGAAAAATTAAGGGG - Intergenic
1140983084 16:80129331-80129353 CATAATATGCAAAAATAAAGAGG + Intergenic
1141225014 16:82106661-82106683 CATGGTCTGAAAATATTAAATGG - Intergenic
1141266818 16:82505450-82505472 CATTATATTAACAATTCAAAGGG - Intergenic
1142449209 16:90164780-90164802 CATTATTTTAAAAAATTGACAGG + Intergenic
1142457886 17:67101-67123 CATTATTTTAAAAAATTGACAGG - Intergenic
1142458279 17:70521-70543 CATTATTTTAAAAAATTGACAGG - Intergenic
1143674842 17:8424804-8424826 CTTTATATTAAAAAAACAAAGGG - Intronic
1144069564 17:11656031-11656053 CATTATATGAAAAAGATACTGGG - Intronic
1144181997 17:12761189-12761211 AAATAAATGAACAAATTAAAAGG - Intronic
1144194926 17:12882704-12882726 CATCACATGCACAAATTAAAGGG - Intronic
1144767757 17:17742000-17742022 CTTTTTATTAGAAAATTAAAGGG - Intronic
1145119018 17:20239438-20239460 TATGATATGATAAAATAAAAAGG - Intronic
1146136043 17:30321988-30322010 CATCAAATCAAAAAATTAACTGG - Intronic
1146239458 17:31204368-31204390 CATAATATGAACAAATTATGTGG - Intronic
1146437861 17:32867857-32867879 GATTATATGAAAAACATATAGGG + Intronic
1146768215 17:35543310-35543332 AAATACATTAAAAAATTAAAAGG + Intergenic
1147003452 17:37382337-37382359 AACTATATGAAAAAAAGAAAGGG - Intronic
1147928775 17:43963062-43963084 CATTACGTGAAAACAATAAAAGG + Intronic
1148710114 17:49673658-49673680 CATTATACGAAAAAAGAAAAAGG + Intronic
1148936515 17:51167497-51167519 TATTATCTGAAATATTTAAAAGG + Intronic
1149196279 17:54125773-54125795 AATTAAAAAAAAAAATTAAATGG - Intergenic
1149202094 17:54198390-54198412 CCTGATTTGAAAAAATTCAATGG - Intergenic
1149957686 17:61071014-61071036 CAGTATATGCATAAGTTAAAGGG - Intronic
1150179243 17:63097804-63097826 CATTAAAGGAAAAAATCAATTGG - Intronic
1150876133 17:68972494-68972516 CAATAAATGAAAATATTACAAGG - Intergenic
1150994639 17:70303245-70303267 GTGTATCTGAAAAAATTAAAAGG + Intergenic
1151038847 17:70834208-70834230 CCTTATATAAAAAATGTAAATGG - Intergenic
1151104768 17:71599804-71599826 AATTAAAATAAAAAATTAAATGG + Intergenic
1151446182 17:74165808-74165830 CATTATTTAAAAAAAAAAAAAGG + Intergenic
1152309644 17:79542038-79542060 CAATACATGAAAAAAAAAAAAGG - Intergenic
1153110629 18:1582094-1582116 CATTATATGGCAAAAGTGAAAGG - Intergenic
1153123098 18:1755375-1755397 CATTACATCAAAAAATTGTACGG - Intergenic
1153379561 18:4422263-4422285 CATTATATTACCAAATTTAATGG - Intronic
1154393940 18:13970072-13970094 CATTGTATTAAAAAATAAAAAGG + Intergenic
1154507350 18:15055227-15055249 GATTATATGACTAAAGTAAAAGG + Intergenic
1154952469 18:21223665-21223687 CATGATCTGAAAATATTAAATGG + Intergenic
1155368150 18:25069931-25069953 TACCATATGAAAAAATAAAAAGG - Intronic
1155554754 18:27006457-27006479 CATTATAATAAAAATTTATATGG - Intronic
1155651210 18:28144402-28144424 CAATATATTATGAAATTAAATGG + Intronic
1155742425 18:29305522-29305544 CATTATATTAATACATGAAATGG - Intergenic
1155812023 18:30248951-30248973 CATGCTCTGAAAATATTAAATGG + Intergenic
1156170907 18:34484260-34484282 CATCATAAGAAACAAGTAAAAGG + Intergenic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1156252410 18:35363683-35363705 CATTATTTGAAATAACCAAAAGG - Intergenic
1156512386 18:37649679-37649701 AATGATATCAAAAAGTTAAAAGG + Intergenic
1157000973 18:43524461-43524483 CATGGTCTGAAAATATTAAATGG - Intergenic
1157004529 18:43566207-43566229 CATGGTTTGAAAATATTAAATGG + Intergenic
1157019370 18:43760852-43760874 CTTTAGATTAAAAAATAAAAAGG - Intergenic
1157026139 18:43846265-43846287 CATTAAATTAATAAATAAAAGGG - Intergenic
1157227176 18:45877094-45877116 CTTTATATGAAAAATTTAATTGG + Intronic
1157375743 18:47162783-47162805 CAATGAATGAGAAAATTAAAAGG + Intronic
1157819534 18:50755467-50755489 CATGGTCTGAAAACATTAAATGG + Intergenic
1157859591 18:51128970-51128992 CTTGAAATGAGAAAATTAAAGGG + Intergenic
1157894576 18:51453035-51453057 CATTATTTTAAAAATCTAAATGG + Intergenic
1157996110 18:52558167-52558189 CATTATTGGAAAAAATTATTGGG + Intronic
1158502555 18:58016493-58016515 CATGAGATGAAAAATATAAAAGG - Intergenic
1158776628 18:60589805-60589827 AAATATATGACAAAATTATATGG + Intergenic
1159206736 18:65263531-65263553 GCTTATATGAAAGATTTAAAGGG - Intergenic
1159236133 18:65675215-65675237 CATTACATTAAAAAACAAAATGG + Intergenic
1159292677 18:66442094-66442116 CTTGATCTGAAAATATTAAATGG + Intergenic
1159464373 18:68762116-68762138 CATGGTTTGAAAATATTAAATGG + Intronic
1159498477 18:69237369-69237391 TAAAATATCAAAAAATTAAAGGG - Intergenic
1159650604 18:70973199-70973221 AATTCTATGAAAATATTCAAAGG - Intergenic
1159704616 18:71672084-71672106 AATTATATGATAAAAATTAAAGG - Intergenic
1159816572 18:73081224-73081246 CATCTTATGAAAAAATAAAATGG + Intergenic
1159982368 18:74799565-74799587 CATAACCTGAAAACATTAAAAGG + Intronic
1160213136 18:76901125-76901147 CATTATATGTATTAATTAAGGGG - Intronic
1160647997 19:203027-203049 CATTATTTTAAAAAATTGACAGG - Intergenic
1161552166 19:4919601-4919623 CATTATCAGAAAAGATAAAATGG - Intronic
1165284387 19:34828632-34828654 CAATATATTAAAAAATAACAAGG + Intergenic
1165550271 19:36577967-36577989 CATTTTATAAAAAAAATATAAGG - Intronic
1165919397 19:39284876-39284898 CATTATTTGCAATAACTAAAAGG + Intergenic
1166580256 19:43891775-43891797 TATTATAAGGAAAAAATAAAAGG + Intronic
1167405767 19:49307392-49307414 CAATATATGATAAAATTGAAGGG + Intronic
925376740 2:3391452-3391474 AGTTATCTGAAAAAATTAATTGG - Intronic
925477417 2:4233052-4233074 CATTTTTTAAAAAACTTAAAAGG - Intergenic
925727796 2:6890786-6890808 CATTACATTAGAAAACTAAATGG - Intronic
926233995 2:11025769-11025791 CATTAAAAGAGAAAATAAAAGGG - Intergenic
926256846 2:11210908-11210930 AATTACATGCAATAATTAAAAGG + Intronic
926498439 2:13620758-13620780 CATTATTTAGAAAAATCAAAAGG - Intergenic
926582463 2:14646112-14646134 CATTCACTGAAAACATTAAATGG - Intronic
926820366 2:16845209-16845231 GATTCTTTGTAAAAATTAAAGGG - Intergenic
926831711 2:16970281-16970303 CATTTTATTAAAGAATTAATTGG - Intergenic
926833570 2:16991894-16991916 CACTATATACAAAAATAAAATGG - Intergenic
927129975 2:20050999-20051021 CATTAGAGGAAAAAATTCCAGGG + Intronic
927244655 2:20947685-20947707 CATTATCAGAAATAAGTAAATGG - Intergenic
927400053 2:22700621-22700643 CATTATGTCAATAAATTAATTGG + Intergenic
927531083 2:23802206-23802228 CAATATTTATAAAAATTAAAAGG + Intronic
928357325 2:30630635-30630657 GATTATTTGAAAAAAGTAGAAGG - Intronic
928704776 2:33936742-33936764 AATTATAGGAAAGAAGTAAATGG - Intergenic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
928834334 2:35524669-35524691 CATACTATGAAAAAAAAAAATGG - Intergenic
928993765 2:37264221-37264243 CATTACTTTAAAAAGTTAAAGGG + Intronic
929001607 2:37352491-37352513 CAAAAAATGAAAAAATTAGATGG - Intronic
929305819 2:40360323-40360345 CAATATATTAAAAAAACAAATGG - Intronic
929358303 2:41052396-41052418 TATTATAAGAGAAAATAAAAAGG - Intergenic
929378213 2:41316608-41316630 CAGTAGATGAAAAAACAAAAAGG - Intergenic
929997803 2:46839949-46839971 CTTAAAAAGAAAAAATTAAATGG + Intronic
930152244 2:48070516-48070538 CATTCCATGAGAAAAGTAAAGGG + Intergenic
930206321 2:48589712-48589734 CTTTATAAGAAAAAATTATTTGG - Intronic
930321959 2:49866147-49866169 CATTATATGTATAATTCAAAAGG + Intergenic
930470332 2:51804621-51804643 CATTATTTTAAACAAATAAATGG - Intergenic
931116091 2:59168421-59168443 TATTATTTGAAAAAATTTGATGG + Intergenic
931476072 2:62588900-62588922 CATTATAGAAAAAAATTAAGAGG - Intergenic
931622677 2:64227000-64227022 CATTATAGAAAAAAAAGAAAAGG + Intergenic
931796495 2:65715157-65715179 CATTATTTCAGAAAATCAAATGG - Intergenic
931798619 2:65736528-65736550 CAGTTTATGAAAAAAACAAATGG - Intergenic
932011314 2:67980318-67980340 CAATATATGACATAATTAATTGG - Intergenic
932267459 2:70380583-70380605 CACCATATGCAAAAATTAATTGG - Intergenic
932365314 2:71148454-71148476 CATTACATGAATAAAATAAGGGG - Intronic
933060418 2:77729819-77729841 CATTATGTTAAACCATTAAAGGG + Intergenic
933176734 2:79182568-79182590 TATTATAAGTGAAAATTAAATGG - Intergenic
933284477 2:80370381-80370403 ATTTATATGAATAAAGTAAAAGG - Intronic
933288878 2:80414357-80414379 ATTTATAAGAAATAATTAAAAGG - Intronic
933396252 2:81735132-81735154 CATTTTATGAAAAAAGTTCAGGG + Intergenic
933405980 2:81860100-81860122 ACCTATATAAAAAAATTAAAAGG - Intergenic
933665929 2:84964867-84964889 CATTAAAAGAAAAAAAAAAAAGG + Intergenic
933866147 2:86519701-86519723 CATTAAATGAAATTTTTAAAGGG - Intronic
934064551 2:88328876-88328898 TATGATCTGAAAATATTAAATGG - Intergenic
934153672 2:89174275-89174297 CATGATATGATCAAAGTAAAGGG - Intergenic
934213562 2:90007657-90007679 CATGATATGATCAAAGTAAAGGG + Intergenic
934316774 2:91928610-91928632 CTTTATATGAAAAAAATACTTGG + Intergenic
934673519 2:96232497-96232519 CATTTTCTGAATAACTTAAAAGG - Intergenic
934723536 2:96599547-96599569 TACTATATGAAACATTTAAATGG + Intronic
934946310 2:98544708-98544730 CATTATGTAAAAGAATCAAAGGG - Intronic
934997257 2:98975853-98975875 CACGATCTGAAAATATTAAATGG - Intergenic
935100381 2:99988987-99989009 CTTTCTAGGATAAAATTAAAAGG + Intronic
935194579 2:100804887-100804909 CATTTTATGAAAAAAATAAAAGG + Intergenic
935474807 2:103505804-103505826 CATTATATGAGTAAAGTAAGAGG - Intergenic
935477587 2:103542574-103542596 CATGATATGAATGTATTAAATGG + Intergenic
935494951 2:103769627-103769649 CATTATATATTTAAATTAAACGG - Intergenic
935619261 2:105114318-105114340 CAGTATTTGATAAAATTAACAGG - Intergenic
936273014 2:111066316-111066338 CTTGATATGACAAAATTATATGG + Intronic
936517474 2:113191570-113191592 CATAATATGAAAACATTCCAGGG - Intronic
936661884 2:114551965-114551987 CACTCTATGAAAAAGTAAAATGG + Intronic
936761035 2:115783509-115783531 CATTATTTGAACAATATAAATGG - Intronic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
936882357 2:117269352-117269374 TATTACATGAATACATTAAAAGG - Intergenic
937162120 2:119774261-119774283 CATTACAAGAAAAAGTTGAATGG + Intronic
937558293 2:123187707-123187729 CATTATATGCAAAAAGGAACAGG - Intergenic
937607316 2:123816846-123816868 TATAATATGAAAAAGTAAAAAGG + Intergenic
937971417 2:127552162-127552184 AATTAAAAGTAAAAATTAAAAGG - Intronic
938173899 2:129106687-129106709 CATGATCTGAAAATATTCAATGG + Intergenic
938205477 2:129417482-129417504 AATTATATGGAAAAATAAATAGG - Intergenic
938664339 2:133518986-133519008 AATTATATTAAAAAGTTAATTGG - Intronic
939577879 2:143917841-143917863 CAGGAGATGAAAATATTAAATGG - Intergenic
939588242 2:144031608-144031630 AATTTTAGGAAAAAATTAAAGGG + Intronic
939639279 2:144619464-144619486 CATTCTGTCAAATAATTAAAAGG + Intergenic
939673054 2:145037540-145037562 CAGTATATGAATGAATTATAAGG - Intergenic
939773222 2:146350955-146350977 ATTTATATGAACAAATAAAATGG + Intergenic
939786247 2:146516828-146516850 AATTATATAAAAATATTAGAGGG + Intergenic
939912967 2:148005812-148005834 CAAAATATGAAAAAATTAGCTGG + Intronic
940061124 2:149569981-149570003 CATATTATGAAGAAATTAAGTGG - Exonic
940127012 2:150337803-150337825 CATTATTTGCAAAAATAACAAGG - Intergenic
940202634 2:151168075-151168097 CATTTTAGGAAAAAAATAATGGG + Intergenic
940234838 2:151499256-151499278 CATTTTTTTAAATAATTAAAGGG + Intronic
940477628 2:154184786-154184808 TATTATATGAAAAAATGTAAAGG - Intronic
940555992 2:155229334-155229356 CATTATATGAAAACTAGAAAAGG - Intergenic
940574841 2:155489642-155489664 CATTCTTAAAAAAAATTAAAGGG + Intergenic
940666042 2:156611016-156611038 CATTATCAGAAAAAATAAAATGG + Intronic
940678716 2:156756683-156756705 CAACATATGATAAAATGAAAAGG - Intergenic
940737400 2:157468895-157468917 CCTTATATCAAAGAATAAAAAGG + Intronic
940774012 2:157867920-157867942 CATTAAATGAGATAATGAAAGGG + Intronic
940799774 2:158120711-158120733 AAACAAATGAAAAAATTAAAAGG - Intronic
940997793 2:160168877-160168899 CATTAGATGAAATAATTCAAGGG + Intronic
941014624 2:160341156-160341178 CATTATATGATTAAGTAAAAAGG - Intronic
941325318 2:164107049-164107071 CATTCTATTAAAAAAATACAAGG + Intergenic
941339465 2:164288659-164288681 TATTAGATGAAAAAAATACAAGG + Intergenic
941359646 2:164536142-164536164 ATTTATATCAAAAAATTAAAAGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941409656 2:165138262-165138284 CATTTTCTGAAAATATTTAATGG - Intronic
941414515 2:165203150-165203172 CTTTAAATCAATAAATTAAAAGG + Intronic
941589500 2:167401937-167401959 CATTAAAACAAGAAATTAAATGG + Intergenic
941692252 2:168513220-168513242 CAATATAGGAAATAATTAGAAGG - Intronic
941786176 2:169500990-169501012 AACTATATGAAAATATTCAAGGG - Intronic
941963720 2:171279727-171279749 CATTAAAAGAAAAAGTTGAATGG + Intergenic
941984829 2:171500033-171500055 AATAAAATAAAAAAATTAAAAGG - Intergenic
942155807 2:173125962-173125984 CATACAATTAAAAAATTAAAAGG - Intronic
942184370 2:173410601-173410623 TATTAAATGAAAAAAATATATGG - Intergenic
942520126 2:176795057-176795079 TAAAATATGAAAAAATTAGATGG + Intergenic
942548127 2:177085974-177085996 CATCATATGACATAATAAAATGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943028820 2:182661999-182662021 ATTTATATGAAAAAAATCAAAGG + Intergenic
943060085 2:183033597-183033619 GAGTAAATGAATAAATTAAAAGG + Intronic
943165566 2:184320298-184320320 CGTTACATGAAAAGAATAAAAGG + Intergenic
943207859 2:184923792-184923814 CATCATTTGAAACAATTATATGG + Intronic
943236875 2:185333501-185333523 GATTTTATTAAAATATTAAAGGG + Intergenic
943260879 2:185661977-185661999 CATTAGATTAAATAAATAAATGG - Intergenic
943382237 2:187165421-187165443 AACTATATGAAAGAATCAAATGG - Intergenic
943737367 2:191371610-191371632 CAATAAATGAAAATATTAAAAGG - Intronic
943955789 2:194187756-194187778 AACTGTATGGAAAAATTAAAGGG + Intergenic
944507045 2:200423544-200423566 CATTACCTGATAAAATTACATGG - Intronic
944777575 2:202982736-202982758 GAGTACATGAAAAAATTAATAGG + Intronic
945010309 2:205454275-205454297 CATTAAATACAAAAATTATAAGG - Intronic
945427616 2:209725996-209726018 CATTTTAATTAAAAATTAAAAGG + Intronic
945603637 2:211898699-211898721 CATTAAATTAAAAAATGATAAGG + Intronic
945637119 2:212369147-212369169 AATTATTTGCCAAAATTAAAAGG + Intronic
945757247 2:213862410-213862432 CAGAATATGAATAAATGAAATGG - Intronic
945761990 2:213924964-213924986 CAGTATAAGAAAAAAAGAAATGG - Intronic
945782851 2:214198567-214198589 CATTATATGAAAAAGATACGTGG - Intronic
946220649 2:218223148-218223170 CATGGTCTGAAAATATTAAATGG + Intronic
946552698 2:220820876-220820898 GTTTATTTTAAAAAATTAAAAGG - Intergenic
946711733 2:222513662-222513684 CATTATAAGAAAAAAGCAGAGGG + Intronic
946822061 2:223640606-223640628 CATAATTTTAAAAAATTATATGG + Intergenic
946992525 2:225351367-225351389 AATTATATGCAACAATTTAAAGG + Intergenic
947023173 2:225706339-225706361 CATTATATGAAACAAATATTGGG + Intergenic
947086441 2:226458325-226458347 AATTATGTGAAGAAAGTAAATGG - Intergenic
947091319 2:226514347-226514369 CAGTAAATGAAAAAAAGAAATGG + Intergenic
947504612 2:230698098-230698120 CAGTAGATGACAAAATAAAATGG + Intergenic
948445150 2:238026774-238026796 CAGTATATACAAAAATGAAATGG - Intronic
1169289507 20:4336769-4336791 CATTTTATTAATTAATTAAAAGG - Intergenic
1169358835 20:4930396-4930418 CATTATAGGAAAAAAGAAAATGG + Intronic
1169752207 20:9006004-9006026 CATTACAATAAAAAATTAAAAGG - Intergenic
1170368298 20:15620395-15620417 CATTGGAGGAAAAAAATAAAAGG + Intronic
1170653516 20:18264813-18264835 CCATATTTTAAAAAATTAAAAGG - Intergenic
1170659871 20:18327131-18327153 CCTAATATCAAAAAATTAAAAGG - Intergenic
1172289076 20:33762359-33762381 CATGGTCTGAAAATATTAAATGG - Intronic
1172467806 20:35169486-35169508 CATTAAGTGAAAAAAGCAAAAGG + Intergenic
1172723821 20:37020404-37020426 CATTAAATGAACAAATGGAATGG + Intronic
1172729775 20:37076623-37076645 CATGGTTTGAAAATATTAAATGG - Intronic
1173265077 20:41471931-41471953 CATTAAATGAAAAAGACAAAGGG + Intronic
1173373879 20:42465091-42465113 CATTATATGTAATTATTATATGG + Intronic
1173434126 20:43017222-43017244 CAATATTTAAAAAAATTAAATGG - Intronic
1173967664 20:47125582-47125604 CATTAAAAGAAAGAATTTAATGG - Intronic
1174971588 20:55281718-55281740 AATTATATTAAAAAGCTAAAAGG + Intergenic
1175365840 20:58455597-58455619 AATTATGGGAAAGAATTAAAGGG - Intergenic
1175370700 20:58488074-58488096 CATGATCTGGAAATATTAAATGG + Intronic
1176741622 21:10609025-10609047 CATCATATACAAAAATTAACTGG - Intergenic
1176864906 21:14042528-14042550 CATTTAATTAAAAAATTAACAGG + Intergenic
1176931220 21:14812620-14812642 CATGATCTGGAAATATTAAATGG - Intergenic
1177168526 21:17629665-17629687 AATTCTATGAAAACATCAAATGG + Intergenic
1177199215 21:17934637-17934659 CGTTATAATAAAAACTTAAAGGG - Intronic
1177246842 21:18537005-18537027 TATTATATTAAAAAATTCAAAGG + Intergenic
1177401913 21:20615424-20615446 CATTATCTCATAAAATTAAATGG + Intergenic
1177549331 21:22599637-22599659 CATTTTAGGAAAAAATAAATAGG + Intergenic
1177550401 21:22613605-22613627 AATTATAGGAAAAGACTAAATGG - Intergenic
1177575665 21:22951768-22951790 GATTATATAGAACAATTAAATGG - Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177606711 21:23388526-23388548 CATTATATCAAGAAAATATAAGG + Intergenic
1177738887 21:25128849-25128871 CATTATCTGATAAGATAAAAAGG - Intergenic
1177854027 21:26382009-26382031 AATTGTAAGAAAAAATAAAAGGG + Intergenic
1177995776 21:28095895-28095917 GATTAGACGAAAAAGTTAAAAGG + Intergenic
1178060583 21:28849661-28849683 CATTTTAAGAAAAAAAGAAACGG + Intergenic
1178494806 21:33077684-33077706 CAGTGTAGGAAAAAATAAAATGG + Intergenic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1178732675 21:35119026-35119048 CAGCATATGAATAAAATAAAGGG + Intronic
1179105992 21:38400950-38400972 CGTTTTATTAAAAAATTATATGG + Intronic
1179813718 21:43889424-43889446 CATGATATTAACAAATCAAAAGG - Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180563499 22:16642296-16642318 CATCATATACAAAAATTAACTGG - Intergenic
1181844569 22:25696582-25696604 GTTCATATGAAAATATTAAAAGG - Intronic
1182140114 22:27947455-27947477 CACTATATAAAAAGACTAAATGG - Intergenic
1182595113 22:31413393-31413415 GATAATTTTAAAAAATTAAAAGG - Intronic
1182838569 22:33364526-33364548 CACTGTCTGAAAATATTAAATGG + Intronic
1182946465 22:34327465-34327487 CATGGTCTGAAAATATTAAATGG + Intergenic
1183123036 22:35746036-35746058 TATGATCTAAAAAAATTAAAGGG + Intronic
1183228121 22:36563949-36563971 ATTTAAATGAAAAAATAAAAGGG - Exonic
1184179679 22:42812076-42812098 GATTAAAAGAAAAAATTAATGGG + Intronic
1184368347 22:44067141-44067163 CATTTTCAGAATAAATTAAAGGG - Intronic
1184845083 22:47077864-47077886 CATGATTTGAAAAGGTTAAAAGG + Intronic
1184903286 22:47461314-47461336 CACTCCATGAAAAAATAAAACGG - Exonic
1184934410 22:47710132-47710154 TAATACATGAAATAATTAAAAGG - Intergenic
1184991401 22:48172598-48172620 CATTAAATGAAAAGAATAACAGG + Intergenic
949109511 3:242109-242131 TATCATAAGAAAAGATTAAAAGG + Intronic
949385367 3:3496211-3496233 AATTCTTTTAAAAAATTAAATGG + Intergenic
949489070 3:4570207-4570229 CATGATATTATCAAATTAAAAGG + Intronic
949498143 3:4653056-4653078 CATTTGATACAAAAATTAAAAGG - Intronic
949726893 3:7059437-7059459 CATTATATGTAAAAACAAAAGGG + Intronic
950012891 3:9735696-9735718 AATTAAATGACAAAAATAAAAGG - Intronic
950228809 3:11258287-11258309 TATTATGGGAAATAATTAAATGG - Intronic
950242525 3:11384604-11384626 TATAATATCAAAAAAATAAATGG - Intronic
950820588 3:15754142-15754164 CATGGTCTGAAAATATTAAAGGG + Intronic
950983703 3:17337041-17337063 CATTATTCGAAAAAAGTCAATGG + Intronic
951349197 3:21584672-21584694 CATTATTTGTAGAAAATAAAGGG - Intronic
951465429 3:22996202-22996224 CATTATATGAAAAACATACATGG + Intergenic
951751902 3:26045206-26045228 CATTATATGAAAAAGACACATGG - Intergenic
951798088 3:26564338-26564360 TATTATATAAAATATTTAAATGG + Intergenic
951962499 3:28344395-28344417 CATTATATTAATAAATATAATGG - Intronic
952042230 3:29274773-29274795 TATTTTGTGAAAAAATAAAAGGG - Intergenic
952087417 3:29842448-29842470 CCTTATATGAAACGATTTAATGG + Intronic
952092172 3:29900961-29900983 CCTTATTTAAAAAAATAAAATGG - Intronic
952209460 3:31214850-31214872 CACTTTATGAAAAAATAAAAAGG + Intergenic
952462104 3:33538434-33538456 CTCTATATGAAAAATCTAAAAGG + Intronic
952624611 3:35389740-35389762 CATTGTCTGAAAAATTTTAAAGG - Intergenic
952756907 3:36877358-36877380 AAATATATTAAAAAATCAAAAGG - Intronic
953298548 3:41748572-41748594 CATTATATAAAACATTTACATGG + Intronic
953728456 3:45422843-45422865 AATTAATTGAAAAAATTAAAAGG + Intronic
954592477 3:51794687-51794709 CTTTACATGAACAATTTAAAGGG - Intergenic
954827617 3:53388484-53388506 ATTTTTATGCAAAAATTAAAGGG + Intergenic
954892242 3:53941481-53941503 CATGGTCTGAAAATATTAAATGG - Intergenic
954924830 3:54224270-54224292 CATTAAAAAAAAAAGTTAAATGG - Intronic
955184002 3:56697691-56697713 CATTAAATGAAAAAATAATTGGG - Intergenic
955247444 3:57239586-57239608 CATTATTTGAACTAGTTAAAAGG - Intronic
955992727 3:64645139-64645161 CATTATAACAAAACATTAAGTGG + Intronic
956348206 3:68304205-68304227 CTTGATATGAAAAAATGTAAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956561528 3:70581868-70581890 CATTATTTGAAAATATTACTAGG - Intergenic
956860399 3:73317674-73317696 CACTGTATGTAAAAATGAAATGG + Intergenic
957135602 3:76284501-76284523 CATTTTATGAAGTAATGAAAAGG + Intronic
957180087 3:76866093-76866115 CTTTCTTTGATAAAATTAAATGG - Intronic
957234570 3:77569201-77569223 CAGTTTATCAAAATATTAAATGG - Intronic
957238885 3:77631365-77631387 TATTACAGAAAAAAATTAAATGG + Intronic
957638827 3:82822315-82822337 AACAATATAAAAAAATTAAATGG - Intergenic
957640601 3:82848873-82848895 GAACATATGAAAACATTAAAAGG - Intergenic
957747222 3:84361455-84361477 AATTATGTGAAGAAAGTAAATGG + Intergenic
957774395 3:84737185-84737207 CGTTGTAAGAAAAAATCAAATGG + Intergenic
957941518 3:87011333-87011355 AATTATTCCAAAAAATTAAAGGG - Intergenic
957964239 3:87302083-87302105 CATTAAATGAATAAACTAATGGG + Intergenic
958048437 3:88315673-88315695 CATTATTTCAAAAAATTAAGGGG + Intergenic
958132365 3:89444601-89444623 CAGTAAATGTAACAATTAAAGGG + Intronic
958136754 3:89503894-89503916 CATTATATAAGAAACATAAAAGG - Intergenic
958493872 3:94816937-94816959 CATGATATTAATAAAATAAAGGG + Intergenic
958611671 3:96434587-96434609 AATTATATGAAAAAAAAAAACGG + Intergenic
958645414 3:96865518-96865540 CAATAAATGAAAAAATTAGCTGG + Intronic
958648580 3:96905345-96905367 AATTATAAGAAAAAAGAAAAAGG - Intronic
958919021 3:100082335-100082357 CAGTATAGCAAAAACTTAAAAGG + Intronic
959316827 3:104820187-104820209 CATTATATGAGAGAAATAAAAGG + Intergenic
959358576 3:105363167-105363189 CATGATATGAGAAGATGAAAGGG - Intergenic
959760825 3:109962538-109962560 CATTCTATGAAAAATTTTGAAGG - Intergenic
959776456 3:110170127-110170149 AATGAGAGGAAAAAATTAAAAGG + Intergenic
960082181 3:113553340-113553362 AATTATATCACAAAAATAAAAGG + Intronic
960186294 3:114644247-114644269 TATTATTGTAAAAAATTAAATGG + Intronic
960394627 3:117121096-117121118 CATTAAAAAAAAAAGTTAAAGGG + Intronic
960593544 3:119388197-119388219 CAGTATAAGACAAAAATAAATGG - Intronic
960728723 3:120700103-120700125 GATTTTATGAAAAAGTTAAAAGG - Intronic
960980781 3:123223408-123223430 TATTCTAGGAAAAAATTTAAAGG - Intronic
961587142 3:127940879-127940901 CAGTCTCTGAAAATATTAAAAGG + Intronic
962065056 3:131970937-131970959 AATTATGAGATAAAATTAAATGG - Intronic
963237464 3:142969874-142969896 CATTATATTAAAAAACTTAAGGG - Intronic
963622238 3:147624931-147624953 CATTGTTTTAAAATATTAAAAGG + Intergenic
963798116 3:149651607-149651629 CCAAATATGAAAAAACTAAAAGG + Intronic
963837428 3:150071188-150071210 AATTAGATGAAACAATCAAAGGG + Intergenic
964660040 3:159110449-159110471 CATTATTTAAATAAATGAAAAGG - Intronic
964780445 3:160331401-160331423 CATGATCTGAAAATATTAAAGGG - Intronic
964824710 3:160812370-160812392 CATTTTATGAAGAAAGAAAAAGG - Intronic
964843509 3:161020876-161020898 CTTTATATCAATAAAATAAAAGG - Intronic
965095094 3:164216034-164216056 CGTTATAAGAAAAAGTTATAGGG - Intergenic
965155168 3:165042269-165042291 CATGATGGAAAAAAATTAAAAGG - Intronic
965156189 3:165059784-165059806 CATTATATCATATAATTAAGAGG - Intronic
965334106 3:167414596-167414618 AACTATATTAAAAAATTTAAAGG + Intergenic
965489910 3:169323059-169323081 CATTTTAGGAAAAAAAGAAATGG + Intronic
965697134 3:171420979-171421001 CACGATCTGAAAATATTAAATGG - Intronic
965833318 3:172823067-172823089 CAGTATAGGAGAAAAATAAATGG + Intergenic
965852353 3:173043622-173043644 TATTATATGAAAATGATAAATGG - Intronic
965867827 3:173226962-173226984 CATTATATGAAAACAGTGCATGG - Intergenic
965967667 3:174514213-174514235 CATTAAAATATAAAATTAAAGGG - Intronic
966096377 3:176208732-176208754 AATTATATTACAAAAATAAATGG + Intergenic
966513467 3:180790676-180790698 CAAAATATGAAGAAATTACATGG - Intronic
966705852 3:182912446-182912468 CATTTCATGAAAAAAAAAAAGGG - Intronic
966745564 3:183272929-183272951 TATTCTAAGCAAAAATTAAAAGG - Exonic
968324748 3:197803953-197803975 CAGTCTATTAAAAAATGAAAAGG + Intronic
968369850 3:198217088-198217110 CATTATTTTAAAAAATTGACAGG + Intergenic
968980269 4:3844359-3844381 CAATATAAAAAAAAATTAAAGGG - Intergenic
969404974 4:6985347-6985369 TTTTATATGAAAAGAATAAAGGG - Intronic
970181211 4:13397239-13397261 ATTTATATAAAAATATTAAATGG + Intronic
970666706 4:18344765-18344787 CATCATATTAACAGATTAAAAGG + Intergenic
970749967 4:19347144-19347166 CATTACTTTAAAAAATTTAATGG - Intergenic
970790249 4:19849835-19849857 AATAAAATAAAAAAATTAAAAGG - Intergenic
971168239 4:24206143-24206165 CATTTTAATAAAAAAATAAAGGG + Intergenic
971736574 4:30461142-30461164 AATTAAATGAAAAAAAAAAATGG + Intergenic
971902632 4:32681869-32681891 CATTATCTAAATAAATTATAGGG - Intergenic
972166218 4:36287453-36287475 CATTATGTGAAAAAGATACATGG - Intronic
972258456 4:37383944-37383966 AATTAAATAAAAAAATAAAAAGG - Intronic
972463623 4:39330257-39330279 AATGATATGTAAAAATCAAAAGG + Intronic
972857640 4:43126306-43126328 CTTTGTATAAAAAAATTTAAAGG - Intergenic
972867469 4:43251531-43251553 TACTAGATTAAAAAATTAAATGG + Intergenic
973149267 4:46866888-46866910 AATTATATGAACAAGTTACATGG + Intronic
973894708 4:55399903-55399925 GAATATATGAAAATATTAAACGG - Intronic
973903181 4:55499029-55499051 AACTATATGAAATAATCAAATGG - Intronic
974075205 4:57162461-57162483 CTTTAAATGAAAAAATTACATGG - Intergenic
974125945 4:57695572-57695594 CTAAATATGAAAAAATTATATGG + Intergenic
974574949 4:63706655-63706677 CAATAGATTTAAAAATTAAATGG - Intergenic
974646435 4:64699347-64699369 CTTTATATTAGAAAATAAAAAGG + Intergenic
975056614 4:69940664-69940686 AATTATATTAGAATATTAAATGG - Intronic
975083869 4:70313124-70313146 CATTATGTGAAAGAAGTATATGG + Intergenic
975115981 4:70681350-70681372 CATGAAAAGAAAAAACTAAAAGG + Intronic
975759264 4:77602656-77602678 CATAAAATGAGAAAATTATAGGG - Intronic
975876223 4:78840041-78840063 CATATTATCAAAAATTTAAATGG + Intronic
975930545 4:79517172-79517194 CATTTTAAGAGAAAATTACATGG + Intergenic
976035066 4:80808624-80808646 TATTTTATGAAAAGATAAAAAGG - Intronic
976145409 4:82038180-82038202 CATTCTATTAAAAAATAAACTGG - Intronic
976348337 4:84030870-84030892 CATTCTCTCAAAAAATAAAAAGG - Intergenic
976425574 4:84899271-84899293 AAGAATATGAAAAAAGTAAAAGG + Intronic
977526167 4:98148010-98148032 TATTATATCAAAAAATCAGAGGG - Intergenic
977538417 4:98284193-98284215 CATTATTTTTAAAAATTATATGG - Intronic
977786499 4:101041359-101041381 AATTAAAAGAAAAAATAAAATGG - Intronic
977849534 4:101809021-101809043 CATTATATGAAAAAGACACATGG + Intronic
977998930 4:103531882-103531904 CATGATATGAATAATTTAATAGG - Intergenic
978565000 4:110072155-110072177 CTTTAAATAAAAAAATTAAGTGG + Intronic
978591859 4:110332304-110332326 CATGATGAGAAAAAAATAAATGG - Intergenic
978989310 4:115058901-115058923 TTTTATTTAAAAAAATTAAATGG + Intronic
979064334 4:116109096-116109118 AGTTATATGAAAAAGTTATAGGG - Intergenic
979087920 4:116438060-116438082 AATTATATAAACAAAATAAATGG + Intergenic
979149374 4:117290087-117290109 AATTACCTGCAAAAATTAAATGG + Intergenic
979176737 4:117674419-117674441 CATTACATGAAAACAATAAAAGG + Intergenic
979284537 4:118907148-118907170 CATTATTTTAAAAAGTTATAAGG - Intronic
979357410 4:119721287-119721309 CATTATATGAAAAAGATACTTGG + Intergenic
979644931 4:123057444-123057466 AATTACATGAAATAATTTAATGG - Intronic
979759862 4:124388956-124388978 CAGTTTAAGAATAAATTAAATGG + Intergenic
979808754 4:125009225-125009247 CAATATTTGAAAAATTAAAATGG - Intergenic
979849523 4:125559148-125559170 CAAAATTTGAGAAAATTAAATGG - Intergenic
980026999 4:127779788-127779810 CATTGTATTAACAAATTAAAGGG + Intergenic
980053096 4:128057495-128057517 AATTAAATTAAAAAGTTAAATGG + Intergenic
980138813 4:128890855-128890877 CATCATATGTAAATAATAAAAGG - Intronic
980317222 4:131217958-131217980 AATTCTATGAAGAAAGTAAATGG + Intergenic
980537564 4:134148626-134148648 CATTAAATCAAAATCTTAAATGG - Intergenic
980656966 4:135801277-135801299 TTTTATATGTAAAAATTAAATGG + Intergenic
980986368 4:139698927-139698949 TATTACAAGAAAAAATTGAATGG - Intronic
981414387 4:144473447-144473469 CATATCATGAAAAAATAAAACGG + Intergenic
981666843 4:147237926-147237948 CATGATATGAAACAACGAAATGG + Intergenic
981743004 4:148022745-148022767 CATTTTATGAAAAATGTAAATGG + Intronic
981959238 4:150515279-150515301 CCTTATATCAACAAATTAAAAGG + Intronic
981992259 4:150935636-150935658 AAATATATGAAAAAAGTGAAGGG + Intronic
982340920 4:154297820-154297842 CAATATATGAAAAACTTGAAGGG + Intronic
982344336 4:154340251-154340273 CATTAAATGAAGATATTAAAGGG + Intronic
982572057 4:157062837-157062859 CAGGATATGAAAAGATAAAAGGG + Intergenic
982840320 4:160175717-160175739 CATTTTAAGAAAAAAGCAAACGG + Intergenic
983153993 4:164321566-164321588 CATCAGATGAAAGAATTTAATGG + Intronic
983484326 4:168316518-168316540 CAATATATGAAAAAAAATAATGG + Intronic
983691817 4:170480161-170480183 CATCATATTAACAAACTAAAAGG - Intergenic
983700163 4:170582021-170582043 CATAGTCTGAAAATATTAAATGG + Intergenic
984064515 4:175031756-175031778 CTTTATATGCAAAAACTATAAGG - Intergenic
984076848 4:175193640-175193662 CTTTATGTATAAAAATTAAAAGG - Intergenic
984176279 4:176421943-176421965 CATAAGATGAAAAAATTAGAGGG + Intergenic
984255501 4:177385389-177385411 CATTATATTAAAAATTAAAATGG + Intergenic
984550366 4:181152255-181152277 CAGTATATGCAAATATTCAAAGG - Intergenic
984789570 4:183603040-183603062 CTTTATATGAAAAACTAAAGAGG + Intergenic
984816638 4:183843661-183843683 CATCATATGTGAAAATTATATGG - Intergenic
984884334 4:184436879-184436901 AATAAAATGAAAAAATAAAATGG - Intronic
985240257 4:187923601-187923623 CATTATATGAAAAAGATACTTGG - Intergenic
985504089 5:268714-268736 GATTATATTTAAATATTAAAAGG + Intergenic
986078084 5:4358517-4358539 CAATATGTTAAAAAATAAAATGG + Intergenic
986227560 5:5829667-5829689 CAGTATATCTAAAAATAAAATGG - Intergenic
986277295 5:6287801-6287823 AATTCTAAGAAAGAATTAAAAGG + Intergenic
986362595 5:6994889-6994911 TATAATATGAAGAAATAAAATGG - Intergenic
986426988 5:7642683-7642705 CATTAAATAAAAAATTTTAATGG + Intronic
986474782 5:8116869-8116891 CACTACATGCAAAAAGTAAATGG - Intergenic
986664569 5:10089234-10089256 CATTATATAGAAAAGGTAAAGGG - Intergenic
986897402 5:12386694-12386716 AATTATATGAAAGAATCCAATGG - Intergenic
986941248 5:12952479-12952501 AAGTATAAGAAACAATTAAATGG + Intergenic
987080904 5:14424472-14424494 CAGTGAATGAGAAAATTAAAGGG + Intronic
987223951 5:15820430-15820452 GATTATATAAGAAAAGTAAAAGG - Intronic
987625759 5:20398282-20398304 CATTTTAAGAAAAAAATGAAAGG - Intronic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
987651351 5:20744262-20744284 CTTAATATGAAACAGTTAAAAGG + Intergenic
987756855 5:22107677-22107699 CATAATAAGAAGAAATAAAAAGG + Intronic
987847726 5:23307932-23307954 AATTATAAGAAAAAATCAAAAGG + Intergenic
987871380 5:23622954-23622976 CATCATATTAAAATATGAAATGG + Intergenic
987979698 5:25066889-25066911 CAAAATTTGAATAAATTAAATGG + Intergenic
988005539 5:25405773-25405795 CTATATATGAAAAAATTTAATGG - Intergenic
988052755 5:26052013-26052035 GATTAAATGAAAAAAAAAAAAGG + Intergenic
988243442 5:28644540-28644562 CATATTAAGAAAAAATTACAAGG + Intergenic
988317683 5:29651647-29651669 CATTATATTAAAAAATGCACTGG + Intergenic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
988726795 5:33934446-33934468 TACTTTATGAAAAAATTATAGGG - Intergenic
988744208 5:34117191-34117213 CTTAATATGAAATAGTTAAAAGG - Intronic
988868504 5:35361722-35361744 TATTATCAGGAAAAATTAAAGGG + Intergenic
989194630 5:38704545-38704567 AATTATGTGAAAAAAGTCAATGG - Intergenic
989264772 5:39460353-39460375 TCGTATATGAAAAAACTAAAGGG - Intronic
989271391 5:39537636-39537658 AATTATTTGAAAAAATTAAATGG - Intergenic
989681811 5:44038579-44038601 AATTATGTGAAAAAGTTCAATGG + Intergenic
989985891 5:50697438-50697460 CAGTATGTTAATAAATTAAAAGG + Intronic
990040220 5:51370466-51370488 CATTATATGGCAAAAGTGAAAGG + Intergenic
990063692 5:51684785-51684807 CTTTATATCAATAAATTAAAAGG + Intergenic
990105662 5:52256436-52256458 CATAAGTTGAAAAACTTAAATGG - Intergenic
990128984 5:52556277-52556299 CATAATATTTAAAAATTGAAAGG + Intergenic
990247403 5:53876464-53876486 AAGTATATAAAAAAATTAAAAGG + Intergenic
990642509 5:57803569-57803591 CATAAAATTAAAAAATTACATGG - Intergenic
990682224 5:58257911-58257933 TCTTATTTAAAAAAATTAAAAGG + Intergenic
990765043 5:59173128-59173150 CTTTAATTGAAATAATTAAATGG - Intronic
990839319 5:60058764-60058786 CATTTTGAGAAAAAATTAAAAGG + Intronic
991167450 5:63580795-63580817 AATAATATAACAAAATTAAAGGG + Intergenic
991176507 5:63694208-63694230 CATAATATCAAAAACTAAAAAGG + Intergenic
991261470 5:64673088-64673110 CAACATATGCAAAAATAAAAAGG - Intergenic
991482234 5:67093219-67093241 CATTAAATGAAAAAGTAAGAAGG - Intronic
991606199 5:68403644-68403666 CATTATCAGAAATAACTAAAAGG - Intergenic
991620233 5:68537722-68537744 AATTATAAAACAAAATTAAAAGG + Intergenic
991709575 5:69395196-69395218 CATCCTATAAATAAATTAAAAGG + Intronic
991898377 5:71429916-71429938 TATCACATGAAATAATTAAAGGG - Intergenic
992056471 5:72996262-72996284 CATTATATGAAATACATAACAGG - Intronic
992118235 5:73563729-73563751 CCTAACATGAAAAAATTAACTGG - Intronic
992343789 5:75854869-75854891 CATCATAATAAAAAATTAATTGG - Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992500430 5:77337483-77337505 CATTATATAAAGAAATAAATTGG + Intronic
992595366 5:78341388-78341410 CATTATAGGAAAAAGTCATATGG - Intergenic
992664949 5:78998958-78998980 CATTACATCAAAACATTACATGG + Intronic
992938201 5:81733961-81733983 AATTATATGAAAAAAATCAAAGG + Intronic
992973622 5:82088625-82088647 CATTTAAAGAAAAAATTGAAAGG + Intronic
993196624 5:84756964-84756986 CTTTATTTAAACAAATTAAATGG + Intergenic
993301183 5:86212698-86212720 CAATATATGAAAAACTTCAAAGG + Intergenic
993373703 5:87123056-87123078 CAATATATGTAAAAATGAAAAGG - Intergenic
993558240 5:89368381-89368403 CTTTATATGAAAATAAAAAAAGG - Intergenic
993869652 5:93237375-93237397 CATGGTCTGAAAATATTAAATGG - Intergenic
993942283 5:94073966-94073988 TACCAAATGAAAAAATTAAATGG - Intronic
994257981 5:97623185-97623207 CATTTTAAGAAAGAACTAAAAGG - Intergenic
994279094 5:97878467-97878489 CTTTATTTAAAAAAATAAAAAGG - Intergenic
994403363 5:99311706-99311728 AAATAGATGAAAAAATTGAAGGG - Intergenic
994470422 5:100197832-100197854 AATTATAGGAAAGTATTAAAGGG + Intergenic
994563532 5:101409808-101409830 CATTATATGAAAAAGACACATGG + Intergenic
994621575 5:102169880-102169902 ACTTATATGCAAAAAATAAAAGG + Intergenic
994629820 5:102271108-102271130 AATTGTGTAAAAAAATTAAATGG - Intronic
994639123 5:102384484-102384506 CAAAATATAAAAAAGTTAAAAGG - Intronic
995263125 5:110128835-110128857 AATTCTATGAAGAAAGTAAATGG + Intergenic
995279960 5:110323101-110323123 CATTGTTTGAAAAACTGAAATGG - Intronic
995525597 5:113048267-113048289 CATGGTCTGAAAATATTAAATGG + Intronic
995542704 5:113200202-113200224 CCTAATAGGAAAAAATAAAAGGG + Intronic
995638701 5:114226973-114226995 CACTACATGAAAAAAATCAAAGG - Intergenic
995874834 5:116779585-116779607 CATTATATGACACATTTCAAAGG - Intergenic
995896534 5:117018836-117018858 TATTATATTAAAAAGTTATATGG - Intergenic
996023345 5:118615918-118615940 AATTAAATGATAAAATCAAATGG + Intergenic
996042017 5:118825110-118825132 CATAATATGGAAAATTAAAATGG - Intergenic
996169826 5:120275689-120275711 AATTCTGTGAAGAAATTAAATGG - Intergenic
996175465 5:120350679-120350701 AAATATATGAAAAGAGTAAAGGG + Intergenic
996331488 5:122334460-122334482 CATTATATGAAAAAATAAGCTGG + Intronic
996495978 5:124157144-124157166 AAGTATCTGAAAAACTTAAAAGG + Intergenic
996569382 5:124915787-124915809 AATTCTATGAAAAAAGTCAATGG - Intergenic
996895711 5:128479763-128479785 CAAAATATTAAAAAATTAACTGG + Intronic
996970454 5:129360747-129360769 AATTCCAAGAAAAAATTAAAGGG - Intergenic
997048251 5:130346342-130346364 CATTATATGAATGAATAAAAAGG - Intergenic
997780801 5:136656178-136656200 CATTATAGGCAAAAATAATAGGG - Intergenic
997915927 5:137925152-137925174 CATTATATGAGAACCTTATAAGG + Intronic
998665601 5:144293778-144293800 CATTATATGCAAAATGTAACTGG - Intronic
998747693 5:145279752-145279774 CATTAAACCAAAAAATTAGAAGG + Intergenic
998990760 5:147813310-147813332 CATTATAAGAAACAAATAAATGG + Intergenic
999681590 5:154065295-154065317 CATTCTAAGAACAAATTAAATGG + Intronic
999860371 5:155639215-155639237 CTTTACATGTAAAAATTACAGGG + Intergenic
1000304795 5:159985272-159985294 CATTACATGTGATAATTAAAAGG - Intergenic
1000479504 5:161754270-161754292 CTTGATTTGAAAACATTAAATGG + Intergenic
1000565261 5:162839150-162839172 CATTATTTGAAAAATTAAATTGG + Intergenic
1000744961 5:165021110-165021132 CATTATATGAAAAAGATATGTGG - Intergenic
1000820412 5:165975864-165975886 CATAAGATCAACAAATTAAAAGG + Intergenic
1001624936 5:173124097-173124119 GTTTATATTAAAAAATAAAAAGG - Intronic
1001910276 5:175511368-175511390 CATTATTTGAAGAAATAAAAGGG - Intronic
1002333133 5:178459017-178459039 AATTGTAAGAAAAAATTAAAGGG + Intronic
1002729129 5:181322666-181322688 CATTATTTTAAAAAATTGACAGG + Intergenic
1002877647 6:1225888-1225910 AATAATAATAAAAAATTAAACGG - Intergenic
1002960326 6:1908283-1908305 CGTGATCTGAAAATATTAAATGG - Intronic
1003365281 6:5468452-5468474 CACTTGATGAAAATATTAAAGGG - Intronic
1003507992 6:6755645-6755667 CATTAAAAAAAAAAAGTAAAAGG - Intergenic
1003737349 6:8891514-8891536 CATTGCGTGAAATAATTAAAAGG - Intergenic
1004136948 6:12976590-12976612 CATGATCTGAAAATATTAAATGG + Intronic
1004219919 6:13737837-13737859 CATTATATGGAAAAAGAAATTGG - Intergenic
1004461993 6:15845986-15846008 CATTAGATTATAAAAGTAAAAGG - Intergenic
1004718461 6:18242446-18242468 CATAGTCTGAAAATATTAAATGG + Intronic
1004739391 6:18443204-18443226 CATTTTATGAAAAACGTAACAGG + Intronic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1005243985 6:23861086-23861108 CACTATATTAACAAAATAAAGGG + Intergenic
1005283487 6:24300016-24300038 TATTATAGGAAAAAATCAAGGGG + Intronic
1005784105 6:29224849-29224871 AATTATCTGAAAAGAATAAAAGG + Intergenic
1006529295 6:34637022-34637044 TATTAAATGAAAACATTAGATGG - Intronic
1006999217 6:38293284-38293306 AATTCTATGAAGAAATTCAATGG - Intronic
1007185630 6:39969573-39969595 GATTTTATAAAAAAATGAAATGG + Intergenic
1007568178 6:42869553-42869575 CATTTTCTAAAAAGATTAAAAGG + Intergenic
1008168868 6:48177170-48177192 CATTATTTTAAAAAAATAAAAGG - Intergenic
1008413132 6:51206716-51206738 CATTATATAAAAAAAAAAACAGG - Intergenic
1008770743 6:54976318-54976340 CAATAGATAAAAAAATTAACTGG - Intergenic
1008807408 6:55448371-55448393 CATAATATGAAAAAATGAATAGG + Intronic
1008811227 6:55502005-55502027 AATAAGATGAAAAAAATAAATGG - Intronic
1008845255 6:55955585-55955607 AATTATATAAAATAATTAAAAGG + Intergenic
1009372937 6:62930520-62930542 CATGATATGAAAAGCTTTAAAGG + Intergenic
1009437901 6:63638458-63638480 GATTTTATGAGAAATTTAAATGG - Intronic
1009452119 6:63813357-63813379 CATTATTTTCAAATATTAAATGG - Intronic
1009604913 6:65855170-65855192 CAAGAAATGAACAAATTAAAAGG - Intergenic
1009738751 6:67715614-67715636 TACTATGTTAAAAAATTAAATGG + Intergenic
1009859983 6:69316026-69316048 GATTATATAAAAAAATTAATGGG - Intronic
1010148311 6:72698552-72698574 CATTATATGAACATGTTGAAAGG + Intronic
1010184587 6:73128344-73128366 CATTCTATTAAAAAATTAGTTGG + Intronic
1010285411 6:74071942-74071964 CACAATCTGAAAATATTAAATGG + Intergenic
1010345646 6:74807213-74807235 CATACTCTGAAAATATTAAATGG + Intergenic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1010551825 6:77232730-77232752 CCTTATTAGAAAAAATAAAAGGG - Intergenic
1010633126 6:78223714-78223736 CATTCAATTAAAAAATTAACAGG + Intergenic
1010684620 6:78838674-78838696 CATTATGAACAAAAATTAAATGG + Intergenic
1010729114 6:79369017-79369039 CATTATCAGAAAAAGTTAAGGGG - Intergenic
1010847387 6:80726091-80726113 CATTACATGAACAACTGAAATGG - Intergenic
1011283781 6:85703334-85703356 CATTAGATAAAAGAATTTAAAGG - Intergenic
1011458767 6:87581046-87581068 CATTGTATCAGAAAAATAAATGG - Intronic
1011541830 6:88438945-88438967 CATGGTCTGAAAATATTAAATGG + Intergenic
1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG + Intergenic
1011840718 6:91495066-91495088 CAGTATTTGAAGAAATAAAAGGG - Intergenic
1011866258 6:91832257-91832279 TATTAAATGAAAAACTGAAAAGG - Intergenic
1011991064 6:93518421-93518443 CATTATAATATAAAATTAAAAGG - Intergenic
1012025546 6:93985812-93985834 CATTGCAAGAAAAAAGTAAATGG + Intergenic
1012047618 6:94298522-94298544 CATTAGAGGAAAAAATGAAAAGG + Intergenic
1012117179 6:95316475-95316497 GATAATAAGAAAAAATTCAAGGG + Intergenic
1012287313 6:97407400-97407422 CATTTTCTGAAAACATTAAAAGG - Intergenic
1012456479 6:99412084-99412106 CACTATCTGAAAAAAAAAAAGGG + Intronic
1012753122 6:103188132-103188154 AATTATTTGAAAAATTTAATAGG - Intergenic
1012886485 6:104851785-104851807 TCTTATATCAAAAAATTCAATGG + Intronic
1013169581 6:107624457-107624479 CAGTCTTTGAAAAAATTAAAAGG - Intronic
1013427777 6:110029975-110029997 AATTATTTTAAAAAATGAAAAGG - Intergenic
1013569353 6:111405877-111405899 AACTATATTTAAAAATTAAAAGG + Intronic
1013622392 6:111902609-111902631 CAATAAATGAATAAATTAACAGG + Intergenic
1013710275 6:112888861-112888883 CATTATATGAATGAATTCAGTGG - Intergenic
1013801129 6:113945041-113945063 CATTAACTGAAGAAATTAAATGG + Intronic
1013857172 6:114587438-114587460 CATCATATCAAAAATTTATATGG + Intergenic
1013963138 6:115925778-115925800 AATTATAAGAAAAAATAAAAGGG - Intergenic
1014224430 6:118831617-118831639 CATTTTTTAAAAAAACTAAATGG + Intronic
1014858817 6:126437701-126437723 GATAATTTGAAAAAAATAAAAGG - Intergenic
1014985769 6:128006322-128006344 CAAAATATTGAAAAATTAAATGG + Intronic
1015067040 6:129042411-129042433 CAGTATATTAAAAGATAAAATGG - Intronic
1015078689 6:129196142-129196164 AACTATATGAACAAATTTAAAGG - Intronic
1015619135 6:135111797-135111819 TATTATAGAAAAAAATTAAATGG + Intergenic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1016065295 6:139676247-139676269 AATTATAAGAAAGAATCAAAGGG + Intergenic
1016187374 6:141213192-141213214 CATAATATTAAATTATTAAATGG - Intergenic
1016197334 6:141360905-141360927 GAGAATATGAACAAATTAAAAGG + Intergenic
1016358497 6:143243470-143243492 TATTCAATGAAAAAAATAAAAGG - Intronic
1016505768 6:144777336-144777358 AATTAAATGAAAAAATTAAATGG + Intronic
1016813678 6:148284136-148284158 TATTATATGAAAATAATACATGG + Intronic
1016855066 6:148659838-148659860 CATTATTTAAAAAAAAAAAAAGG + Intergenic
1016886779 6:148966615-148966637 CATTATATGAAATGATTTACAGG - Intronic
1017107530 6:150901784-150901806 CATTACTTTAAAAAATTAACAGG - Intronic
1017206557 6:151808812-151808834 CATTAAACAAAAACATTAAAAGG - Intronic
1017362375 6:153589847-153589869 CATTACATCATAAAATTAAAGGG + Intergenic
1017425992 6:154322064-154322086 CATCATATTAAAATAATAAAGGG + Intronic
1017544826 6:155439215-155439237 CAGTTTTTGAAATAATTAAAGGG + Intronic
1018307191 6:162470221-162470243 CATTTTATGATATAATGAAAAGG + Intronic
1018421723 6:163646017-163646039 CATTATAGGTATAAATCAAAAGG + Intergenic
1018874576 6:167809362-167809384 CATTATAAGAAAAAAATAATAGG + Intergenic
1019889366 7:3933811-3933833 TAAGATATGAAAAAATAAAAAGG + Intronic
1020437626 7:8182634-8182656 CATAAAATAAAAAAATTAAAGGG + Intronic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1020588818 7:10107846-10107868 CAGCATTTTAAAAAATTAAATGG - Intergenic
1020603768 7:10309052-10309074 TATTATGTGACAAAGTTAAAAGG + Intergenic
1020605410 7:10331160-10331182 CATTTTATCAGAAAACTAAAGGG - Intergenic
1020610168 7:10386182-10386204 AAGTAGAAGAAAAAATTAAAAGG + Intergenic
1020874388 7:13674650-13674672 TATTATATGAAAAAGATACATGG - Intergenic
1020901124 7:14004855-14004877 CATTTTAACAAAAAATAAAATGG + Intergenic
1020906878 7:14074341-14074363 CATTATAGGAGAGAATTCAAGGG - Intergenic
1020951268 7:14681035-14681057 CACTATATGAAAAAAATAAGAGG + Intronic
1021007035 7:15410197-15410219 CATAATAAAAAAAAGTTAAATGG - Intronic
1021010454 7:15457933-15457955 AATTATATGATGAAATAAAATGG + Intronic
1021026845 7:15678528-15678550 TATTAGTTGAAAAGATTAAATGG - Intronic
1021060205 7:16101922-16101944 AATTCTGTGAAAAAATTCAATGG - Intronic
1021141760 7:17034163-17034185 CATTATGTGTTAAAATTGAAAGG - Intergenic
1021352159 7:19607907-19607929 CAACATATACAAAAATTAAATGG + Intergenic
1021379248 7:19947504-19947526 CAATGAATGAACAAATTAAATGG - Intergenic
1021407234 7:20285816-20285838 TACTTTCTGAAAAAATTAAATGG - Intergenic
1021623561 7:22571401-22571423 GACTATATGAATAAATGAAATGG + Intronic
1021677298 7:23094180-23094202 CATCATATACAAAAATTAAATGG - Intergenic
1021732571 7:23610110-23610132 TAATTTAAGAAAAAATTAAAAGG - Intronic
1021929910 7:25569847-25569869 CATGGTCTGAAAATATTAAACGG - Intergenic
1021974011 7:25994094-25994116 CACTGTATTAAAAAATTAACTGG + Intergenic
1022076954 7:26981267-26981289 TATTACATTAAAAAATTAAAAGG - Intronic
1022256941 7:28667936-28667958 CATTATGTGAGACAATTTAAAGG + Intronic
1022397494 7:30002787-30002809 AATTATATGGATAATTTAAAGGG + Intergenic
1022765952 7:33411976-33411998 AAATATCTGAAAAAATAAAATGG + Intronic
1022769994 7:33459499-33459521 CTCTATAGGAAGAAATTAAAAGG + Intronic
1023280685 7:38565983-38566005 CTTCATATGAAAATATTAACAGG + Intronic
1023383355 7:39630430-39630452 CAACATATGTCAAAATTAAACGG - Intronic
1023471575 7:40527736-40527758 CATCTAATGAAAAAATTACAGGG - Intronic
1023516204 7:41004311-41004333 CAATTTATGAATAAATGAAATGG - Intergenic
1024152530 7:46587387-46587409 CATAATAGGTAGAAATTAAATGG + Intergenic
1024503523 7:50140567-50140589 CATTAAATGTAGAAATTAAGAGG - Intronic
1024515880 7:50255162-50255184 CATTATAAAAATAAATTGAAAGG + Intergenic
1024541028 7:50475328-50475350 GATTATATGAAAGTTTTAAATGG + Intronic
1025482307 7:60996280-60996302 CATGAAATGAAAAGATCAAATGG + Intergenic
1025921000 7:65913299-65913321 CGTTACATGAAAAAAACAAAGGG - Intronic
1026269735 7:68825693-68825715 AATTATTTGTATAAATTAAAGGG + Intergenic
1026357557 7:69572330-69572352 CTTTATATGAAGAAATTATTTGG + Intergenic
1027539209 7:79446575-79446597 CAATATTTGAAATAATTAGATGG - Intronic
1027664737 7:81031475-81031497 CAATATAGGAAAAAAAAAAAAGG + Intergenic
1027776935 7:82477221-82477243 CATAAAAGGAAAAAATGAAATGG - Intergenic
1027800950 7:82748206-82748228 AATTATATGAACAAATTATGAGG + Intergenic
1027973014 7:85111028-85111050 TGTTAAATGAAAAAAGTAAAAGG - Intronic
1028138961 7:87251191-87251213 CATTATATTACTAAATTAACTGG - Intergenic
1028434409 7:90785470-90785492 CATTAAATGAACAAATGAATGGG + Intronic
1028545150 7:91990840-91990862 CATTATCTGAAAATATTAAATGG + Intronic
1028749483 7:94366808-94366830 TACTATATGAAAAGATTCAAAGG + Intergenic
1028788409 7:94824007-94824029 CATGGTCTGAAAATATTAAATGG + Intergenic
1028865076 7:95699808-95699830 CAGTAAAGGAAAAAATAAAATGG - Intergenic
1029016974 7:97325423-97325445 AATTATAAGAAAAAGTTAAATGG + Intergenic
1029024252 7:97398701-97398723 CAAAATTTGACAAAATTAAAAGG - Intergenic
1029042194 7:97588148-97588170 TATTATAATAAGAAATTAAATGG + Intergenic
1030012553 7:105184966-105184988 CATTCTATGAGATCATTAAAAGG + Intronic
1030120363 7:106104386-106104408 AATAAAATAAAAAAATTAAATGG + Intronic
1030181908 7:106718693-106718715 CATTATTTAAAAATATTTAATGG + Intergenic
1030225944 7:107151135-107151157 TTTTATTTGAAAAGATTAAATGG + Intronic
1030395329 7:108979274-108979296 AATTATGTGAAGAAATTCAATGG + Intergenic
1030546706 7:110905392-110905414 CATTAAAGAAAAAAATAAAAAGG + Intronic
1030764895 7:113396579-113396601 CATTGAATGATAAAATTCAATGG + Intergenic
1030796861 7:113799410-113799432 CATTACATGACAAGATTAAAGGG + Intergenic
1030832710 7:114245533-114245555 CATTATGTGAAAGAAATAGAGGG + Intronic
1030845561 7:114404855-114404877 CATTAGAGAAAAAAAATAAAAGG - Intronic
1030894926 7:115047380-115047402 CATCAAAAGAAAGAATTAAAGGG + Intergenic
1030999372 7:116396974-116396996 GATTAAATGAAAAAACTAAAAGG - Intronic
1031326046 7:120399381-120399403 CATTAGAGGAAAAAAACAAAGGG + Intronic
1031367616 7:120922311-120922333 CTTTCTATCAAACAATTAAAAGG - Intergenic
1031433801 7:121708086-121708108 CATTATAAAAAAAACTTAAATGG - Intergenic
1031475546 7:122216776-122216798 CCTTCTATGAAAACATGAAAAGG + Intergenic
1031581532 7:123480960-123480982 TAGTATATGTAAAAATTAAATGG - Intronic
1031673276 7:124578400-124578422 CATTATATGACAAAAGTAAAGGG + Intergenic
1031712202 7:125063041-125063063 GATTTTTTTAAAAAATTAAATGG + Intergenic
1031737012 7:125377859-125377881 CATTATTTAAAAAAATTTCATGG - Intergenic
1031868883 7:127070688-127070710 CATTATATGTATAAATAAATTGG + Intronic
1031940942 7:127788452-127788474 TATTAAATGAGTAAATTAAAAGG - Intronic
1032050860 7:128649803-128649825 CATTATTTTAAAAAATTGACAGG + Intergenic
1032450048 7:132022792-132022814 CATTATTTAAAAAAAAAAAAAGG + Intergenic
1032637606 7:133727035-133727057 CAATATTTGAATAAATTTAATGG - Intronic
1032901006 7:136308118-136308140 AATTAAAATAAAAAATTAAAGGG - Intergenic
1033296162 7:140138144-140138166 CAAAATATCAAAAAATTAACTGG + Intronic
1033373802 7:140737290-140737312 CATTCTATGTAAAATTTTAAAGG - Intronic
1033784445 7:144713980-144714002 CAATATATAAAAAAATTACTTGG + Intronic
1033850276 7:145486633-145486655 AACTATGTTAAAAAATTAAATGG + Intergenic
1033871918 7:145763830-145763852 AATTATCTGACATAATTAAATGG - Intergenic
1034014072 7:147563296-147563318 TATTGGATGAAAAAATTTAAAGG + Intronic
1034863496 7:154620588-154620610 CATTACATGAATAATTTCAAGGG + Intronic
1035826698 8:2652807-2652829 CATAAAATGAAACAATTAATAGG - Intergenic
1035838323 8:2782466-2782488 CGTTATAAGAAAATTTTAAAAGG + Intergenic
1036027101 8:4921603-4921625 CATTATCTGAGTAAAATAAAAGG - Intronic
1036170742 8:6481890-6481912 CATGGTCTGAAAATATTAAATGG + Intronic
1036194434 8:6701558-6701580 CAAAATATGAAAAACTCAAATGG - Intergenic
1036341625 8:7920135-7920157 TATTATAAGAATAAAATAAAAGG + Intergenic
1037012766 8:13864925-13864947 CACTATATTAAAATAATAAAGGG - Intergenic
1037212403 8:16406974-16406996 AATTATATGAAAACCTTGAAAGG + Intronic
1037286217 8:17303481-17303503 TATAATATGAAAAAACTCAAAGG - Intronic
1037438619 8:18891099-18891121 GATTAAATGAAACAATTAATTGG - Intronic
1037644473 8:20779784-20779806 CATTATACAAAAAAATTAACTGG + Intergenic
1037650510 8:20834003-20834025 AAAAATATGAAAAAATTAACTGG - Intergenic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1038319892 8:26516146-26516168 CCTTATATGAATAAATTAGAGGG - Intronic
1038507824 8:28101028-28101050 CATTGTATGTAAAAATTTTAGGG - Intronic
1038579622 8:28736530-28736552 CATTAAATGGAAGAAATAAATGG - Intronic
1038728942 8:30109452-30109474 CATTTGATGAAAGTATTAAATGG + Intronic
1038986303 8:32814959-32814981 CATTAAATGAAGAAAAAAAATGG + Intergenic
1039252211 8:35679238-35679260 CATTGTGTCAAAAAATAAAAAGG + Intronic
1039362390 8:36892300-36892322 GATTATAAGAAAAAAACAAATGG - Intronic
1039661625 8:39474045-39474067 ACTTATATTAAAATATTAAATGG + Intergenic
1039727495 8:40234726-40234748 AAATATAAGAAAAAATCAAAGGG - Intergenic
1040042515 8:42930962-42930984 CATTATTTTTAAAAATTTAAAGG + Intronic
1040431885 8:47350863-47350885 CATAATCTGAAAGTATTAAATGG + Intronic
1040484375 8:47856073-47856095 AATAAAATGAAAAAATTAAGAGG - Intronic
1040665401 8:49625586-49625608 TATTAGATGAGAAAAATAAAAGG - Intergenic
1041567311 8:59293529-59293551 CATTAAATGAAAAAGTAAACTGG - Intergenic
1041892598 8:62887724-62887746 AATTCTAAGAAAAAAGTAAAAGG - Intronic
1042013641 8:64281902-64281924 CATTTTAGGACAAAATTAAATGG - Intergenic
1042034880 8:64521869-64521891 CATTTTATTAAAAAAATAAAAGG - Intergenic
1042409950 8:68453434-68453456 CATTGTTTAACAAAATTAAAGGG - Intronic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1042913345 8:73848792-73848814 CCATACATGAAAAAATAAAATGG - Intronic
1042995305 8:74691636-74691658 CCTTCAATGCAAAAATTAAAAGG - Intronic
1043088228 8:75864815-75864837 CATAATATTAAAACATTTAACGG - Intergenic
1043217469 8:77610826-77610848 CACTATATAAAAATTTTAAAAGG - Intergenic
1043342549 8:79257621-79257643 CATTATCAGAAAAAATAAAGTGG - Intergenic
1043576449 8:81664155-81664177 TAATAAATGAAGAAATTAAAAGG - Intronic
1043618946 8:82163933-82163955 CATTTTTTGAAAAAATTAATTGG + Intergenic
1043664803 8:82795588-82795610 GATTTTATGAACAAAGTAAAAGG - Intergenic
1044034439 8:87282786-87282808 GATAAATTGAAAAAATTAAATGG + Intronic
1044039338 8:87346939-87346961 AATTAAATGAAAAAACAAAAAGG - Intronic
1044039592 8:87350328-87350350 ATTTATAATAAAAAATTAAAAGG - Intronic
1044158612 8:88883501-88883523 AATTACATGAAATAATAAAATGG - Intergenic
1044263233 8:90152763-90152785 TTTTATTTAAAAAAATTAAAAGG - Intergenic
1044400271 8:91762410-91762432 TATTATTTGAAAAAGTTATATGG - Intergenic
1044441364 8:92228139-92228161 CATCAAATGAAAAAAAAAAAAGG - Intergenic
1044520758 8:93196666-93196688 AAGTATATGAGAAAAATAAAGGG + Intergenic
1044648761 8:94473033-94473055 CTTTGTATCAACAAATTAAATGG - Intronic
1044653981 8:94528624-94528646 CATTATTTTTAAAAATTCAAGGG - Intronic
1044790466 8:95841644-95841666 CATTGGTTGAAAAAATAAAATGG + Intergenic
1045216479 8:100154109-100154131 CATTATATGAAAATACAGAAAGG - Intergenic
1045496782 8:102715981-102716003 CAGAATACAAAAAAATTAAATGG + Intergenic
1045498020 8:102724755-102724777 CAAAAAATGAAAAAATTAACTGG - Intergenic
1045594202 8:103633944-103633966 GATTTTTTGAAAAAATTAATAGG - Intronic
1045637667 8:104211275-104211297 CACCACATGAAAAAATAAAATGG + Intronic
1045848827 8:106669232-106669254 CCTAAAATGAATAAATTAAATGG - Intronic
1045851720 8:106707928-106707950 CATAATTTTAAAAAGTTAAATGG - Intronic
1046162346 8:110383653-110383675 CATTCAATAAAAAAATTAATTGG - Intergenic
1046170774 8:110502291-110502313 CAAAATATGAAAAAATTAGCCGG + Intergenic
1046191091 8:110794667-110794689 AAGTATAAGAAATAATTAAAAGG + Intergenic
1046245973 8:111563376-111563398 AATAATTTTAAAAAATTAAATGG + Intergenic
1046273701 8:111929060-111929082 CATTGAATCAAAAAATAAAAAGG + Intergenic
1046331132 8:112716539-112716561 CATTATGTGAAAAATGTCAATGG - Intronic
1046447340 8:114340117-114340139 CATTCTATGAGAAAACTATAGGG + Intergenic
1046458281 8:114498388-114498410 CCATATAAGAAACAATTAAAAGG + Intergenic
1046489109 8:114924409-114924431 CATAATATGAAACTATTAATAGG + Intergenic
1046535635 8:115505628-115505650 TGTTATTTGTAAAAATTAAAAGG - Intronic
1046688927 8:117260830-117260852 AATTAAATGAATAAATTAAGTGG + Intergenic
1046722991 8:117641779-117641801 CAGTTTATTAAAAAATTAAAAGG - Intergenic
1046751780 8:117934248-117934270 TATTAAATGAAAAAAAAAAATGG + Intronic
1046840990 8:118856944-118856966 AATTATGTGAAGAAAGTAAATGG - Intergenic
1046851819 8:118983158-118983180 CATTAGGAGAAAAAATCAAAAGG - Intergenic
1047310519 8:123687972-123687994 CATTATTTGAAAACATTGAAAGG + Intronic
1047686447 8:127309487-127309509 CATTAGATGAAAGAATGGAAAGG - Intergenic
1047866795 8:129033518-129033540 CTAGATATGAAGAAATTAAAGGG - Intergenic
1048092528 8:131256690-131256712 CATTAAATGAATAAAGTAATTGG + Intergenic
1048562110 8:135551229-135551251 CATTACATTAAAAAAATTAAAGG - Intronic
1048663258 8:136631732-136631754 CATGGTCTGAAAATATTAAACGG - Intergenic
1048834645 8:138506803-138506825 CATTAAATGTCAAAATTAGAAGG - Intergenic
1049722964 8:144129157-144129179 AACTATATATAAAAATTAAAAGG + Intergenic
1050142791 9:2533864-2533886 CAGACTATGATAAAATTAAAGGG + Intergenic
1050381070 9:5031305-5031327 CATTATATGAAACTACAAAATGG + Intronic
1050419531 9:5449046-5449068 CATTAAATGAAAATATCAGAGGG + Intergenic
1050431409 9:5565739-5565761 TATTATATAATAAATTTAAAAGG + Intronic
1050446704 9:5730478-5730500 CATTTTAGGTAAAAATTAAAGGG + Intronic
1050582165 9:7070505-7070527 CAGTATATAAAAAACTTAATTGG + Intronic
1050610230 9:7344567-7344589 CATTTTATGAAAGGATTCAAAGG + Intergenic
1050635799 9:7611170-7611192 CATTATATGAAAAGGTTACTTGG - Intergenic
1050684861 9:8156924-8156946 CATGAGATGAAAGAATTATAAGG - Intergenic
1050879170 9:10677634-10677656 CATCATATCTAAACATTAAAGGG - Intergenic
1051011666 9:12422779-12422801 CATTATATAAAAAGATCCAAAGG - Intergenic
1051167828 9:14284195-14284217 CATTATAATAAATAATTAATGGG + Intronic
1051207653 9:14705020-14705042 CATCAAATGAACAAAATAAAGGG + Intergenic
1051316882 9:15846461-15846483 CAGTATTTGAAAAAATAAAATGG + Intronic
1051672232 9:19522414-19522436 CATTTTTTGAAAAAATTTAAAGG + Intronic
1051814088 9:21084562-21084584 ATTTATATGTAAAAAATAAAAGG + Intergenic
1051940745 9:22502842-22502864 AAATAAATGAAAATATTAAAAGG - Intergenic
1052160461 9:25251610-25251632 AATTATATCAACAAATTAAATGG + Intergenic
1052293066 9:26866290-26866312 TATTATATGGAAGAAATAAATGG + Intronic
1052377784 9:27737194-27737216 AATTCTAAGAAAAAAGTAAAAGG - Intergenic
1052435076 9:28416840-28416862 CATTAGATTAAAAAATACAAAGG - Intronic
1052502619 9:29311733-29311755 TATTATCTGTAAAAATGAAAAGG - Intergenic
1052527046 9:29631323-29631345 AATTATATGAATGAATTGAAAGG - Intergenic
1052732784 9:32309339-32309361 CATTATATGGAAAACTCCAATGG - Intergenic
1053147504 9:35721789-35721811 CCTCATAGGAAAAAATGAAAGGG - Exonic
1054885655 9:70195486-70195508 CATGGTCTGAAAATATTAAATGG + Intronic
1054948625 9:70824415-70824437 AATAAAATAAAAAAATTAAAAGG - Intronic
1054954592 9:70894239-70894261 CATTATATGAACAAACAAAAAGG + Intronic
1055251837 9:74316908-74316930 GGTTATATCAAAAGATTAAAGGG + Intergenic
1055279683 9:74659925-74659947 TATTATATAAAAAATTAAAAAGG + Intronic
1055306997 9:74940322-74940344 AACTATAAGAAAAAATCAAATGG - Intergenic
1055375074 9:75640071-75640093 CATTATCTGATAAAAATAACAGG - Intergenic
1055409448 9:76013056-76013078 CATTATATCTAAAAATAAAGGGG - Intronic
1055538048 9:77269229-77269251 CACCATATAGAAAAATTAAATGG - Intronic
1055548020 9:77401805-77401827 CATGGTTTGAAAATATTAAATGG + Intronic
1056231739 9:84552855-84552877 ATCTATATAAAAAAATTAAATGG - Intergenic
1056288157 9:85112351-85112373 CCTCATATGAAAAAAATAAAAGG + Intergenic
1057270457 9:93647445-93647467 CATCATAAAAAAAAATTAAGAGG - Intronic
1057348177 9:94270566-94270588 ATATATATGAAAAAATTCAATGG - Intronic
1057449014 9:95139869-95139891 CATTCTGTGGAAAATTTAAAGGG + Intronic
1057588642 9:96352242-96352264 CATTAAATAATAAAAATAAATGG + Intronic
1057985324 9:99707618-99707640 CTTTATATGAAAAATTCCAAGGG - Intergenic
1058021037 9:100089008-100089030 CATGATCTGAAAACATTAAATGG + Intronic
1058026738 9:100148360-100148382 CATTTTATGCAAAAATTTTAAGG + Intronic
1058287545 9:103198298-103198320 CATTAGAAGAAAAATGTAAAAGG - Intergenic
1058559149 9:106205269-106205291 GAATATATTAAAAAATTTAAAGG - Intergenic
1058771215 9:108234210-108234232 CATTATATGAAAAAGATTATGGG + Intergenic
1059080819 9:111247690-111247712 CATGGTTTGAAAATATTAAATGG + Intergenic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059188321 9:112298011-112298033 CTTTGTATGAAGACATTAAAGGG + Intronic
1059370998 9:113835778-113835800 ATTTATTTTAAAAAATTAAAGGG + Intergenic
1059462326 9:114440966-114440988 CATTATAAGAAAAAGTTGCATGG + Intronic
1059493299 9:114687978-114688000 CACCATATACAAAAATTAAATGG - Intergenic
1059594576 9:115705415-115705437 CATTACATATAAAAATTAACTGG + Intergenic
1059610103 9:115883459-115883481 AGTTATATGAAGAAAGTAAAGGG + Intergenic
1059894580 9:118847492-118847514 CATGGTTTGAAAAAATAAAATGG + Intergenic
1059951969 9:119475417-119475439 CATTATATAAAATATTTGAAAGG + Intergenic
1059986896 9:119829130-119829152 CTTTAAATTAAGAAATTAAATGG + Intergenic
1060083160 9:120671902-120671924 CAATATATAAAAAGATTAAGTGG + Intronic
1060129800 9:121084945-121084967 TTTTATATGAAAACATTTAAAGG + Intronic
1203576709 Un_KI270745v1:14546-14568 CATTATTTTAAAAAATTGACAGG + Intergenic
1203577106 Un_KI270745v1:17968-17990 CATTATTTTAAAAAATTGACAGG + Intergenic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1186015930 X:5193468-5193490 CAGTTTATGAAAAATTAAAATGG - Intergenic
1186072703 X:5839547-5839569 CTTTGTATGATAAAACTAAATGG + Intergenic
1186149247 X:6656541-6656563 CAGTAAAACAAAAAATTAAAGGG + Intergenic
1186154894 X:6715187-6715209 CATTAAATGAAAAAATAATATGG - Intergenic
1186373174 X:8967602-8967624 CCTTATCTGAAAAATTTAGAAGG - Intergenic
1186560840 X:10611268-10611290 AAATGTATGAAAGAATTAAATGG + Intronic
1186903309 X:14082755-14082777 CATTATACTAAAAAAGAAAATGG - Intergenic
1186903703 X:14087804-14087826 AAATATTTGAAAATATTAAAGGG + Intergenic
1186968808 X:14817527-14817549 CATTAAAAGAGTAAATTAAAGGG + Intergenic
1187614124 X:20974619-20974641 CATGGTATGAAAATATTAAATGG - Intergenic
1187694110 X:21901105-21901127 AACTAAATGAAAAAATAAAATGG - Intergenic
1187849736 X:23579927-23579949 CATTATATGTTAAAATGACAAGG - Intergenic
1187856697 X:23643933-23643955 GAAAATATGAAAAAATAAAAAGG + Intergenic
1188021632 X:25165040-25165062 CATCAGCTGAAAAAGTTAAAAGG - Intergenic
1188117717 X:26265410-26265432 CATGGTCTGAAAATATTAAATGG + Intergenic
1188148765 X:26646901-26646923 CTGTATATGATAAAAATAAAGGG + Intergenic
1188213083 X:27446333-27446355 CATCATATGAACAAGTTATATGG - Intergenic
1188255500 X:27957488-27957510 CATTATATGAAAAGATGAGTAGG + Intergenic
1188390438 X:29612405-29612427 CATTTTATTAAAAAAAAAAAAGG + Intronic
1188499319 X:30808497-30808519 ATTAAAATGAAAAAATTAAATGG - Intergenic
1188730138 X:33635763-33635785 AATTCTATGAAGAAAGTAAATGG + Intergenic
1188938434 X:36206821-36206843 CAAAATATGAAAAAATAAAATGG + Intergenic
1189294091 X:39906699-39906721 CTTTTTAAAAAAAAATTAAATGG + Intergenic
1189422147 X:40865665-40865687 GAAAATATTAAAAAATTAAAGGG - Intergenic
1189515073 X:41705391-41705413 CAAAATATTAAAAAATTAACTGG + Intronic
1189609078 X:42712835-42712857 CAGCATATGAAAAACTCAAAGGG + Intergenic
1189858031 X:45243219-45243241 AATTAAATTAAAACATTAAAAGG - Intergenic
1189972089 X:46428282-46428304 CATTATAAGGAAAGGTTAAAAGG - Intergenic
1190125770 X:47704071-47704093 CAAAATATGAAAAAGATAAATGG - Intergenic
1190489944 X:50971720-50971742 CATGTTCTGAAAATATTAAATGG - Intergenic
1190639449 X:52468507-52468529 GCTTGTATGAAAAATTTAAATGG + Intergenic
1190761246 X:53439980-53440002 ACTTATATGAAAAAATTATTCGG - Intergenic
1190908697 X:54752384-54752406 CATTTTATGAAAAGTTTATAAGG + Intronic
1191060538 X:56291001-56291023 CATTGTATCACAGAATTAAAAGG + Intergenic
1191120852 X:56902927-56902949 CATTTTATGAAAAATTTAGGAGG - Intergenic
1191123446 X:56929206-56929228 CCTTATGTTAACAAATTAAAAGG + Intergenic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1191753577 X:64569952-64569974 AATTTTGTGAAAAAATTCAATGG + Intergenic
1192002406 X:67167950-67167972 AATTATTTGAAGAAATAAAAAGG - Intergenic
1192029727 X:67496359-67496381 CATCAGTTGAAAAAATTATAAGG - Intergenic
1192076637 X:68005255-68005277 AATTATGTGAAGAAAGTAAATGG + Intergenic
1192730493 X:73798473-73798495 CATTATATAGAAAAATTAGAGGG + Intergenic
1192957688 X:76090767-76090789 AATTCTGTGAAAAAATTCAATGG + Intergenic
1193017073 X:76746794-76746816 CATTATACGAAAAAAGATAATGG + Intergenic
1193261570 X:79412811-79412833 CACTACATGAAAAAGTGAAAAGG + Intergenic
1193263884 X:79444428-79444450 CATTATATCAACAAAATGAAGGG - Intergenic
1193296435 X:79838183-79838205 GAGTCTATGAAAAAATTAAGAGG - Intergenic
1193302707 X:79910029-79910051 AATTATATGAATCACTTAAAAGG - Intergenic
1193365461 X:80626807-80626829 CACTGTCTGAAAATATTAAATGG + Intergenic
1193466598 X:81854963-81854985 GGGTAAATGAAAAAATTAAAAGG + Intergenic
1193617376 X:83706116-83706138 CATCATTTGAAAGAATTAAAAGG - Intergenic
1193807479 X:86012331-86012353 CATTATCTGAGGAATTTAAAAGG + Intronic
1193862915 X:86693347-86693369 CAGTATATGTAAAGATTGAAGGG - Intronic
1193998890 X:88401709-88401731 CATTTTATGATAAAATGATAGGG + Intergenic
1194170970 X:90581192-90581214 CATTAAATAAATAAAATAAATGG - Intergenic
1194249213 X:91552707-91552729 CAGTCTATCAAAAAATAAAATGG + Intergenic
1194531120 X:95050561-95050583 ATTTATATGAAACCATTAAAGGG + Intergenic
1194566156 X:95491438-95491460 CATAAAGTGAAAAAAGTAAATGG + Intergenic
1194791363 X:98154953-98154975 CATTATATGAAAAAGATACTTGG - Intergenic
1194872627 X:99152184-99152206 CAATAAAAGAAAAAAATAAAGGG + Intergenic
1194889923 X:99365373-99365395 AATTATTTGAAAAAAGTAAGGGG + Intergenic
1195054978 X:101135703-101135725 CATAATATACAAAAATCAAATGG - Intronic
1195197041 X:102508756-102508778 CATTATATTAAGAACCTAAAAGG - Intergenic
1195207634 X:102618879-102618901 AATTATATGAAATACTCAAAAGG - Intergenic
1195369879 X:104163152-104163174 AATCACATGAAAAAATTATAAGG + Intergenic
1195494922 X:105519983-105520005 AATTATCTAAAAACATTAAATGG + Intronic
1196372023 X:114989899-114989921 CATTATATGAAAAAGACACATGG + Intergenic
1196400356 X:115309915-115309937 AATTGTAGGAAAAAAATAAATGG - Intergenic
1196771262 X:119296463-119296485 CACCATATGAAAAAACAAAAGGG - Intergenic
1197007423 X:121518696-121518718 CATGAAAGCAAAAAATTAAATGG + Intergenic
1197041857 X:121946483-121946505 CATTGTGTCAAAAAATAAAAAGG + Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197125127 X:122936074-122936096 CTTAATAAGAAAAAAATAAATGG + Intergenic
1197255459 X:124258227-124258249 CATCATCTGAAGAAATTAACAGG - Intronic
1197341335 X:125269949-125269971 CATTATATAATAATAATAAAAGG - Intergenic
1197419249 X:126217644-126217666 CCTTATTTAAAAAAAATAAAAGG + Intergenic
1197542473 X:127782290-127782312 TATTTTTTGAAAATATTAAATGG - Intergenic
1197589943 X:128396168-128396190 CCTTATATGAAAAATTTAGGAGG + Intergenic
1197902269 X:131386942-131386964 CATTATTTGTAGTAATTAAAAGG - Intronic
1198025279 X:132699541-132699563 TCTTATATGAGAAAATGAAATGG - Intronic
1198564488 X:137890302-137890324 CATAATAGGTAAAATTTAAAGGG - Intergenic
1198820462 X:140642234-140642256 TATTTTTTGAAAAATTTAAATGG - Intergenic
1198866866 X:141132254-141132276 AAATATTTTAAAAAATTAAAGGG + Intergenic
1198879884 X:141268578-141268600 AATTATATGCAAAATTTAGAAGG + Intergenic
1199053830 X:143269172-143269194 TATTATATGCTAAAACTAAAAGG - Intergenic
1199231179 X:145437584-145437606 CAATATATGATAAAATTGAAGGG + Intergenic
1199275515 X:145937682-145937704 CATTACAAGAAAATATTGAATGG - Intergenic
1199433309 X:147785212-147785234 AATTAATTGAAGAAATTAAATGG + Intergenic
1199892343 X:152098721-152098743 CGTTTATTGAAAAAATTAAATGG + Intergenic
1199935523 X:152569773-152569795 CATTTTCTGAAAGATTTAAAAGG + Intergenic
1200306797 X:155033707-155033729 CATTATGTGTAACCATTAAATGG - Intronic
1200517205 Y:4158938-4158960 CATTAAATAAATAAAATAAATGG - Intergenic
1200520322 Y:4203218-4203240 TATTATAAAAAAAAAGTAAAAGG + Intergenic
1200568169 Y:4793938-4793960 CAGTCTATCAAAAAATAAAATGG + Intergenic
1200978489 Y:9239122-9239144 AATTATTTGAATAATTTAAAAGG - Intergenic
1201170419 Y:11256284-11256306 TATTAAATGATAAAATTAATTGG + Intergenic
1201384857 Y:13428710-13428732 CATTCTGTGAAAAAATAACATGG + Intronic
1201548731 Y:15196221-15196243 CATTAAATGAAAAAATTATATGG - Intergenic
1201886046 Y:18882578-18882600 AATTTTTTTAAAAAATTAAAAGG - Intergenic
1202329902 Y:23738082-23738104 CATAATATTAAAAATTTAAGAGG + Intergenic
1202540868 Y:25931972-25931994 CATAATATTAAAAATTTAAGAGG - Intergenic
1202599950 Y:26583248-26583270 CATCATATACAAAAATTAACTGG - Intergenic