ID: 987639461

View in Genome Browser
Species Human (GRCh38)
Location 5:20594210-20594232
Sequence CTAATACAGCACATATGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987639461_987639463 -5 Left 987639461 5:20594210-20594232 CCCATACATATGTGCTGTATTAG No data
Right 987639463 5:20594228-20594250 ATTAGAAATTCTGTTGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987639461 Original CRISPR CTAATACAGCACATATGTAT GGG (reversed) Intergenic
No off target data available for this crispr