ID: 987642922

View in Genome Browser
Species Human (GRCh38)
Location 5:20634386-20634408
Sequence GGCCTCCAGAAGGCATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642922_987642931 27 Left 987642922 5:20634386-20634408 CCCATGCATGCCTTCTGGAGGCC No data
Right 987642931 5:20634436-20634458 TGCCTACACACACGAGCCACGGG No data
987642922_987642930 26 Left 987642922 5:20634386-20634408 CCCATGCATGCCTTCTGGAGGCC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642922_987642932 28 Left 987642922 5:20634386-20634408 CCCATGCATGCCTTCTGGAGGCC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642922 Original CRISPR GGCCTCCAGAAGGCATGCAT GGG (reversed) Intergenic
No off target data available for this crispr