ID: 987642923

View in Genome Browser
Species Human (GRCh38)
Location 5:20634387-20634409
Sequence TGGCCTCCAGAAGGCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642923_987642932 27 Left 987642923 5:20634387-20634409 CCATGCATGCCTTCTGGAGGCCA No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642923_987642930 25 Left 987642923 5:20634387-20634409 CCATGCATGCCTTCTGGAGGCCA No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642923_987642931 26 Left 987642923 5:20634387-20634409 CCATGCATGCCTTCTGGAGGCCA No data
Right 987642931 5:20634436-20634458 TGCCTACACACACGAGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642923 Original CRISPR TGGCCTCCAGAAGGCATGCA TGG (reversed) Intergenic
No off target data available for this crispr