ID: 987642925

View in Genome Browser
Species Human (GRCh38)
Location 5:20634396-20634418
Sequence GCAATCCACTGGCCTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642925_987642934 22 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642934 5:20634441-20634463 ACACACACGAGCCACGGGGCTGG No data
987642925_987642932 18 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642925_987642936 24 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642925_987642930 16 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642925_987642935 23 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642925_987642931 17 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642931 5:20634436-20634458 TGCCTACACACACGAGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642925 Original CRISPR GCAATCCACTGGCCTCCAGA AGG (reversed) Intergenic
No off target data available for this crispr