ID: 987642926

View in Genome Browser
Species Human (GRCh38)
Location 5:20634407-20634429
Sequence GACTGGGTGGAGCAATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642926_987642931 6 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642931 5:20634436-20634458 TGCCTACACACACGAGCCACGGG No data
987642926_987642935 12 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642926_987642934 11 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642934 5:20634441-20634463 ACACACACGAGCCACGGGGCTGG No data
987642926_987642936 13 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642926_987642932 7 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642926_987642930 5 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642926 Original CRISPR GACTGGGTGGAGCAATCCAC TGG (reversed) Intergenic
No off target data available for this crispr