ID: 987642928

View in Genome Browser
Species Human (GRCh38)
Location 5:20634423-20634445
Sequence TGTGTAGGCATGAGCAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642928_987642935 -4 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642928_987642931 -10 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642931 5:20634436-20634458 TGCCTACACACACGAGCCACGGG No data
987642928_987642934 -5 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642934 5:20634441-20634463 ACACACACGAGCCACGGGGCTGG No data
987642928_987642936 -3 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642928_987642932 -9 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642928 Original CRISPR TGTGTAGGCATGAGCAGACT GGG (reversed) Intergenic
No off target data available for this crispr