ID: 987642930

View in Genome Browser
Species Human (GRCh38)
Location 5:20634435-20634457
Sequence ATGCCTACACACACGAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642922_987642930 26 Left 987642922 5:20634386-20634408 CCCATGCATGCCTTCTGGAGGCC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642927_987642930 -8 Left 987642927 5:20634420-20634442 CCACCCAGTCTGCTCATGCCTAC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642925_987642930 16 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642923_987642930 25 Left 987642923 5:20634387-20634409 CCATGCATGCCTTCTGGAGGCCA No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data
987642926_987642930 5 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642930 Original CRISPR ATGCCTACACACACGAGCCA CGG Intergenic
No off target data available for this crispr