ID: 987642932

View in Genome Browser
Species Human (GRCh38)
Location 5:20634437-20634459
Sequence GCCTACACACACGAGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642926_987642932 7 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642923_987642932 27 Left 987642923 5:20634387-20634409 CCATGCATGCCTTCTGGAGGCCA No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642927_987642932 -6 Left 987642927 5:20634420-20634442 CCACCCAGTCTGCTCATGCCTAC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642928_987642932 -9 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642922_987642932 28 Left 987642922 5:20634386-20634408 CCCATGCATGCCTTCTGGAGGCC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642929_987642932 -10 Left 987642929 5:20634424-20634446 CCAGTCTGCTCATGCCTACACAC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data
987642925_987642932 18 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642932 5:20634437-20634459 GCCTACACACACGAGCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642932 Original CRISPR GCCTACACACACGAGCCACG GGG Intergenic
No off target data available for this crispr