ID: 987642935

View in Genome Browser
Species Human (GRCh38)
Location 5:20634442-20634464
Sequence CACACACGAGCCACGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642925_987642935 23 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642927_987642935 -1 Left 987642927 5:20634420-20634442 CCACCCAGTCTGCTCATGCCTAC No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642926_987642935 12 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642928_987642935 -4 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data
987642929_987642935 -5 Left 987642929 5:20634424-20634446 CCAGTCTGCTCATGCCTACACAC No data
Right 987642935 5:20634442-20634464 CACACACGAGCCACGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642935 Original CRISPR CACACACGAGCCACGGGGCT GGG Intergenic
No off target data available for this crispr