ID: 987642936

View in Genome Browser
Species Human (GRCh38)
Location 5:20634443-20634465
Sequence ACACACGAGCCACGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987642925_987642936 24 Left 987642925 5:20634396-20634418 CCTTCTGGAGGCCAGTGGATTGC No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642926_987642936 13 Left 987642926 5:20634407-20634429 CCAGTGGATTGCTCCACCCAGTC No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642929_987642936 -4 Left 987642929 5:20634424-20634446 CCAGTCTGCTCATGCCTACACAC No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642927_987642936 0 Left 987642927 5:20634420-20634442 CCACCCAGTCTGCTCATGCCTAC No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data
987642928_987642936 -3 Left 987642928 5:20634423-20634445 CCCAGTCTGCTCATGCCTACACA No data
Right 987642936 5:20634443-20634465 ACACACGAGCCACGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987642936 Original CRISPR ACACACGAGCCACGGGGCTG GGG Intergenic
No off target data available for this crispr