ID: 987645777

View in Genome Browser
Species Human (GRCh38)
Location 5:20671244-20671266
Sequence AGGGAGAGTGAAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987645766_987645777 27 Left 987645766 5:20671194-20671216 CCCATTCCCCAGCAGCCATGTGG No data
Right 987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG No data
987645770_987645777 20 Left 987645770 5:20671201-20671223 CCCAGCAGCCATGTGGTACAAAC No data
Right 987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG No data
987645771_987645777 19 Left 987645771 5:20671202-20671224 CCAGCAGCCATGTGGTACAAACA No data
Right 987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG No data
987645768_987645777 26 Left 987645768 5:20671195-20671217 CCATTCCCCAGCAGCCATGTGGT No data
Right 987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG No data
987645769_987645777 21 Left 987645769 5:20671200-20671222 CCCCAGCAGCCATGTGGTACAAA No data
Right 987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG No data
987645772_987645777 12 Left 987645772 5:20671209-20671231 CCATGTGGTACAAACAGAATCTG No data
Right 987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987645777 Original CRISPR AGGGAGAGTGAAGTGACTGT GGG Intergenic
No off target data available for this crispr