ID: 987651074

View in Genome Browser
Species Human (GRCh38)
Location 5:20740707-20740729
Sequence GACTCACGGTTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987651069_987651074 16 Left 987651069 5:20740668-20740690 CCTGAAACTGGGCAATTTACAAA 0: 72
1: 1383
2: 3255
3: 10785
4: 15479
Right 987651074 5:20740707-20740729 GACTCACGGTTCCACGTGGCTGG 0: 11
1: 635
2: 4748
3: 7908
4: 8118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987651074 Original CRISPR GACTCACGGTTCCACGTGGC TGG Intergenic
Too many off-targets to display for this crispr