ID: 987657137

View in Genome Browser
Species Human (GRCh38)
Location 5:20821643-20821665
Sequence GACAGGTCTTGGCCTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987657137_987657140 11 Left 987657137 5:20821643-20821665 CCAGTAATAGGCCAAGACCTGTC No data
Right 987657140 5:20821677-20821699 GAGTAGTTATTTGCAAAAGATGG 0: 2
1: 16
2: 197
3: 218
4: 371
987657137_987657142 16 Left 987657137 5:20821643-20821665 CCAGTAATAGGCCAAGACCTGTC No data
Right 987657142 5:20821682-20821704 GTTATTTGCAAAAGATGGCAGGG No data
987657137_987657141 15 Left 987657137 5:20821643-20821665 CCAGTAATAGGCCAAGACCTGTC No data
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987657137 Original CRISPR GACAGGTCTTGGCCTATTAC TGG (reversed) Intergenic
No off target data available for this crispr