ID: 987657141

View in Genome Browser
Species Human (GRCh38)
Location 5:20821681-20821703
Sequence AGTTATTTGCAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 2, 1: 12, 2: 206, 3: 213, 4: 315}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987657134_987657141 25 Left 987657134 5:20821633-20821655 CCACCAAAGCCCAGTAATAGGCC 0: 13
1: 161
2: 162
3: 88
4: 160
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315
987657138_987657141 4 Left 987657138 5:20821654-20821676 CCAAGACCTGTCTCTCAAAAAGA No data
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315
987657139_987657141 -2 Left 987657139 5:20821660-20821682 CCTGTCTCTCAAAAAGAGAGTAG No data
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315
987657135_987657141 22 Left 987657135 5:20821636-20821658 CCAAAGCCCAGTAATAGGCCAAG 0: 17
1: 191
2: 171
3: 92
4: 154
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315
987657136_987657141 16 Left 987657136 5:20821642-20821664 CCCAGTAATAGGCCAAGACCTGT No data
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315
987657137_987657141 15 Left 987657137 5:20821643-20821665 CCAGTAATAGGCCAAGACCTGTC No data
Right 987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG 0: 2
1: 12
2: 206
3: 213
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987657141 Original CRISPR AGTTATTTGCAAAAGATGGC AGG Intergenic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903430886 1:23298765-23298787 ACTTGTTTGGAAAAGATTGCAGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905155158 1:35971570-35971592 AGTTACTTTCAAAGGATGGGAGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
906987447 1:50699511-50699533 AGAGATTTGCAAAAAATGGTTGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
907883827 1:58575846-58575868 AGTTACTTGCAAACGATCCCGGG + Exonic
907987753 1:59549235-59549257 AGTTTCTTGCCAAAGCTGGCTGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910141286 1:84029987-84030009 AGTTATTTGTGAAGGATGGCAGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG + Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG + Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912253149 1:108031728-108031750 AGTGATTTGCAAGAGAATGCTGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
914946199 1:152068781-152068803 TGTTGTCTGCAAAAGATGTCAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917427339 1:174928663-174928685 ACAAATTTGCAAAAGATTGCAGG - Intronic
918399397 1:184148221-184148243 GTTTATTTGCAAAAGTTGGGTGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921160697 1:212470314-212470336 AGCTATGTGCAAAGGATTGCTGG + Intergenic
922630338 1:227101393-227101415 AAATATTTGCAATATATGGCAGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923942073 1:238839143-238839165 AGTTAATTGCAAAACATGCATGG - Intergenic
924057799 1:240141205-240141227 AGATCTTTGAAAAAGATGTCAGG + Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924352483 1:243130880-243130902 AATAATTTAGAAAAGATGGCTGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063567845 10:7187480-7187502 GTTTATTTGCAGAAAATGGCAGG - Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065043548 10:21723106-21723128 ATCTATTTTTAAAAGATGGCTGG - Intronic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067813869 10:49456056-49456078 AGTTAGTTGCAAAATAAGGATGG + Exonic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069258924 10:66369687-66369709 TGTCATTTGCAAATGTTGGCCGG + Intronic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070264684 10:74890946-74890968 GGTTATTTGCAAATGCTGGAAGG - Intronic
1070963808 10:80517252-80517274 AGTTATTTGCAAAATAGGCAAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073825171 10:107312620-107312642 AGTTGTTTGCAAAGCCTGGCAGG - Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1073988639 10:109238781-109238803 AGTCAGTTGCAAAAGACAGCAGG + Intergenic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1075501597 10:122980086-122980108 ACTTATTTTCGAAAGATTGCTGG + Exonic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1075767459 10:124905020-124905042 TGTTATTTCCAAATGATGGAAGG - Intergenic
1076543610 10:131229344-131229366 AGTTCTTTCCAACAGATGACAGG + Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081109456 11:39116721-39116743 ATATATTTGTAAAAGATGACTGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081168191 11:39832798-39832820 AATTATTAGTAAAATATGGCTGG + Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083081484 11:60098712-60098734 AATTATTGACAAAAGATGGCTGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083295218 11:61711598-61711620 GGTTATTTTGGAAAGATGGCTGG - Intronic
1083471474 11:62887192-62887214 AGTGCTATGCAAAAGAAGGCGGG + Intronic
1084655310 11:70511827-70511849 AATTATTTACAAAGGAAGGCAGG - Intronic
1085024870 11:73230492-73230514 AGTCATTTGCATAAAATGTCTGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086615993 11:88820572-88820594 AGCTATTTGCCCAAGATTGCAGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1087398037 11:97627401-97627423 AGTTCTTGGGAAAAGATGGATGG + Intergenic
1087625642 11:100592978-100593000 AGATATTTACAAATGATGTCTGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089913093 11:122123436-122123458 AGTTATTAGGAAAACATAGCAGG - Intergenic
1089996266 11:122910563-122910585 AGTTAATTGCAAGAGGTGGAGGG + Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091033730 11:132214478-132214500 AGTTATAGGCATAAAATGGCAGG - Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093783544 12:23166164-23166186 ATTTATTTACACAAGATGTCTGG + Intergenic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095599347 12:43997500-43997522 ATTTCTTTGCTAAAGATGACTGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096166528 12:49430075-49430097 AGAAATATGAAAAAGATGGCCGG - Intronic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097026561 12:56060368-56060390 TGTAATTTGAAAAAGATTGCAGG - Intergenic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098687093 12:73435388-73435410 AGTTATTTTGAAAAGATGAGTGG + Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099298085 12:80856083-80856105 CTTTTTTTGCAAAAAATGGCTGG - Intronic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099647552 12:85378738-85378760 AATTATATGGAAAAGCTGGCAGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100130199 12:91483183-91483205 TGTGATTTGCAAAAGATGAGAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101786974 12:107892853-107892875 ATTTATTTGAAAATCATGGCCGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1105604351 13:21914454-21914476 ACATATTTGAGAAAGATGGCAGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1106634204 13:31509590-31509612 TGTTATCTGCAAAAGATGCTTGG - Intergenic
1106883956 13:34162597-34162619 AGTCATTTGCCACAGAGGGCAGG + Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110267569 13:73555862-73555884 AGTTATTTTCAAAATATCCCTGG - Intergenic
1110313070 13:74073321-74073343 AGTTATTTGCCATAGATTGAGGG + Intronic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113191115 13:107747314-107747336 AGTTAGTTGTACAAGATGGCAGG - Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116631534 14:47341748-47341770 AGCTATTTGCAAAAGACAGAGGG + Intronic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117072861 14:52071630-52071652 AGATTTTTGCAAAAGATGTGGGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118385505 14:65252570-65252592 AGTTATTTGTGAATGATGGCAGG + Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120932725 14:89865474-89865496 CTTTATTTGAAAAGGATGGCTGG + Intronic
1125060370 15:35413597-35413619 AGATATTAGCAAAAGAAAGCTGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127546565 15:59998824-59998846 AGTTATTTGCAAAAGGGTGGTGG - Intergenic
1128029974 15:64471465-64471487 AGTAATGTGCTATAGATGGCTGG - Intronic
1128702378 15:69813848-69813870 TGTTATCTGCAAAATATGGGGGG + Intergenic
1129290450 15:74562919-74562941 AGTCATTTCCTAAAGATAGCAGG - Intronic
1131703461 15:94966508-94966530 AATTATTTTCAAAAGATGCTTGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1135109414 16:19679114-19679136 AGCTGTTAGCAAAAGAAGGCTGG + Intronic
1135476689 16:22782677-22782699 AGTGAAATGTAAAAGATGGCAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138833055 16:60399253-60399275 AGCTATGTGCAAAAAATAGCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139064677 16:63298148-63298170 AGATATTTGCATAATATTGCAGG + Intergenic
1140417504 16:74786619-74786641 AGGAATTTGAAAAAGATGGAGGG - Intergenic
1140825715 16:78704064-78704086 AGTGAATTGAAACAGATGGCTGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1143198239 17:5093474-5093496 AGTAATTTAGGAAAGATGGCTGG - Exonic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1146850931 17:36221013-36221035 AGTTATCTGAACTAGATGGCAGG - Intronic
1147868521 17:43570596-43570618 AGATATTTGCAAGGGATGGCTGG - Intronic
1148044007 17:44731302-44731324 AGTTACTTGTAAAAGAAGTCTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151203172 17:72483902-72483924 GTTTATTTACAAAAGGTGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153434799 18:5057927-5057949 ATTTATATCCACAAGATGGCAGG - Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154206453 18:12341231-12341253 ACTTAATTGCAAAAGAGGACTGG - Intronic
1154246508 18:12703810-12703832 AGTAGTATGCAAAAGATGGAGGG + Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154461018 18:14586252-14586274 TGTTATTTGCAAAGCATGGATGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155459879 18:26066744-26066766 AGATATTTGAAAAAGAAGGTAGG + Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158199316 18:54922528-54922550 AGTTACTAGGAAAAGATGACTGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159926521 18:74274713-74274735 AGTTATTTGAAGAATATAGCTGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164396910 19:27873667-27873689 AATTATTTACAAAAGATTGGTGG + Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931020021 2:58033731-58033753 ATTTATTTTTAAAAGAAGGCAGG + Intronic
931350748 2:61486115-61486137 AGTTTTTAGCAAAAGAAAGCAGG + Intronic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG + Intronic
933164356 2:79059516-79059538 AGTAATATGCAAAAGATCCCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933881856 2:86677635-86677657 AGTGATGAGCAAAAGAAGGCAGG - Intronic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
938894575 2:135737526-135737548 GGTTATATGCAAATGATGCCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939498651 2:142952918-142952940 ATTTATTTAAAAAAAATGGCAGG - Intronic
939539272 2:143473702-143473724 ATTTATTTCTAAAATATGGCTGG - Intronic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940216466 2:151308699-151308721 AGAGATGTGCAAAAGATGGTTGG + Intergenic
941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943484230 2:188458997-188459019 AGTCATTTGCAACAAATGGATGG - Intronic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945911446 2:215654616-215654638 TGCTGTTTGCAAAAGCTGGCTGG - Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947298835 2:228665515-228665537 AGTGATTTGAAAAGGAAGGCTGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
1170269812 20:14512900-14512922 TGTTATTTGCACATGATGTCAGG - Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1171335668 20:24383180-24383202 AGTCATTTGCTAAAGATGTCAGG - Intergenic
1172188024 20:33043570-33043592 AGTAATTGGCCCAAGATGGCAGG - Intronic
1172887843 20:38243461-38243483 TGCTGTTTGCAAAAAATGGCTGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176813484 21:13571588-13571610 TGTTATTTGCAAAGCATGGATGG - Intergenic
1176947651 21:15003190-15003212 AGTTATTTGAAAATTAAGGCAGG - Intronic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177335957 21:19728030-19728052 AGTTATTTGTAAAATATGTTTGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178265506 21:31138983-31139005 AGAAATGTGCAAAAGATGGAAGG - Intronic
1178551058 21:33539836-33539858 AGGTATTTCAAAAAGAAGGCAGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181076791 22:20383907-20383929 AGTTTTATGAAAAAGATGGAAGG - Intronic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1183824714 22:40376694-40376716 AGTAATTTGCTAAAGATTGGTGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949401632 3:3670607-3670629 AGTCATTTCCAGAAGATGCCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949728080 3:7073995-7074017 ATTTACTTGCAAAACATTGCTGG + Intronic
949905871 3:8858028-8858050 AGTTATCTGCAAATGACAGCAGG - Intronic
950160796 3:10759232-10759254 AGTTATGTGATAAAGATGGTGGG - Intergenic
950937302 3:16852287-16852309 AATTTTTTGTAAAATATGGCAGG + Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951047774 3:18060314-18060336 AGTGGTTTACAAAGGATGGCAGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG + Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951593331 3:24290324-24290346 CGTTGTTTGCAGAACATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953826720 3:46259271-46259293 AGGTATTTGCAAAAGCTTTCAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955677016 3:61459375-61459397 ACTTATGTGAAAATGATGGCTGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956718281 3:72097472-72097494 AGTTATTTTCAACAGGTGACAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957427405 3:80056033-80056055 ACTTATTTGGAAAATATGGATGG - Intergenic
957566180 3:81887068-81887090 AATTATTTGCTAAAGATCCCAGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG + Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964904622 3:161704680-161704702 AGTCATTTGCAAAACATAGGTGG + Intergenic
965122642 3:164582228-164582250 AGATATTTGAAAAAAAAGGCAGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
966823799 3:183946440-183946462 AGTAAATTGCAAAATGTGGCTGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970696052 4:18678353-18678375 AGTAATTTACAAGAGAAGGCAGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971770673 4:30892247-30892269 ATTTATTTTCAAAAGAATGCTGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972297616 4:37755180-37755202 TGTTATTTGTAAAAAATGGAAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973088318 4:46097899-46097921 AGTTCTTGGAAAAAGATGGCTGG - Intronic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
973231806 4:47847575-47847597 AGTTATTTTCAACAAATGCCAGG - Exonic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979249461 4:118549625-118549647 AATAATTTAGAAAAGATGGCTGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981260666 4:142714829-142714851 AAATATTTGCAAAAGATATCTGG + Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
981993205 4:150949087-150949109 ATTTATTTGGGAAAAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982783553 4:159516423-159516445 ATTTATTAGCAAAAGATTGGAGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983123898 4:163925194-163925216 AGTTATTTTCAAGAGAGGGAAGG + Intronic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983621973 4:169771583-169771605 ACTTATTTAAAAAATATGGCCGG - Intergenic
983814062 4:172100977-172100999 TGTTTTTAGCAAAAGCTGGCTGG - Intronic
983874092 4:172856070-172856092 AGCTGTTTTCAATAGATGGCTGG - Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984176443 4:176424363-176424385 AGTTATCTCAAAGAGATGGCAGG - Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988292920 5:29314065-29314087 GGTTATTTGCAAAATATCACAGG + Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989154907 5:38335308-38335330 AGTTATTATCAAAATATCGCTGG - Intronic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
990808404 5:59693674-59693696 AGTTATTTGCAAAAAAAGTTAGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992210899 5:74478575-74478597 TGTTATTTGCAAATGATGTATGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995079400 5:108030802-108030824 AGGTGTTTGAAAGAGATGGCAGG + Intronic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995430450 5:112069127-112069149 ATTTATTTTCAAAAAATGTCTGG + Intergenic
995500520 5:112800143-112800165 AGTTACTTGCAATAGATGCTGGG - Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996488667 5:124066629-124066651 ATTTATCTGCAAAAGGTAGCAGG + Intergenic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998675691 5:144405394-144405416 AGTAATTTGCCAAACATTGCAGG - Intronic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
1000128088 5:158267172-158267194 TATTATTTGCAACAGATAGCTGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001169088 5:169400920-169400942 AGTTATTGGCATAATATGGATGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001601207 5:172929889-172929911 AGTTCTTAGAAAAAGATGGCTGG + Intronic
1001838821 5:174855707-174855729 AGTTATTCACAGAAGATAGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1004065685 6:12241565-12241587 AGTTATTTGCAAAAAAAGTACGG + Intergenic
1004611268 6:17242300-17242322 AGCTATTTGCAAAAGAAAGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008658074 6:53636250-53636272 ATGTATTTGCCCAAGATGGCAGG + Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1008914148 6:56768772-56768794 AAATATTTGCAAATCATGGCTGG + Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009412125 6:63378101-63378123 AAGTATTTGCAAAGGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009840560 6:69068088-69068110 AGTAACTTACAACAGATGGCAGG + Intronic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1010899283 6:81406066-81406088 AGTCTTTTGAAAAATATGGCAGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011451171 6:87494017-87494039 TGTTATGTGCAAGAGATTGCTGG + Intronic
1012001905 6:93664421-93664443 AGATATTTGCAGAAGATAGTAGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014822388 6:126005684-126005706 AGTAATTTGCAACTGTTGGCAGG + Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG + Intergenic
1015856601 6:137631720-137631742 ATTTATTTGTAAAAGATAGATGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016275588 6:142348499-142348521 AGATATTTCCAAATGATGTCAGG - Intronic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018273751 6:162107922-162107944 ATTTATTTGCAAAAGAAAGGAGG + Intronic
1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG + Intergenic
1018567762 6:165173836-165173858 ACCTATTTGCAAATGATAGCAGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019426684 7:980997-981019 AGTTACTTTTAAAAGAGGGCTGG + Intergenic
1019682391 7:2358455-2358477 ATTTATTCTCAAAAGTTGGCTGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1023082746 7:36540619-36540641 AGCTATTTGCAAAATATTCCTGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025282758 7:57640031-57640053 TGTTATTTGCAAAACATTCCTGG - Intergenic
1025301959 7:57825386-57825408 TGTTATTTGCAAAACATTCCTGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028278056 7:88883144-88883166 TGAAATTTGCAAATGATGGCTGG - Intronic
1028330636 7:89586847-89586869 AGTTATTGGGAAATCATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029091574 7:98052280-98052302 ATTCATTTGCCAAAGGTGGCAGG - Intergenic
1029300232 7:99577019-99577041 ACTTATTTAAAAAATATGGCTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030479471 7:110084029-110084051 AGTTTTCTGCAAAGGATGCCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032662414 7:133999600-133999622 AAATATTTGCAATAGATGGAAGG + Intronic
1032846553 7:135756430-135756452 CCTTATTTGCTAAAGAAGGCAGG + Intergenic
1034864492 7:154629371-154629393 AGTTATCTGCATGAGATGTCAGG - Intronic
1035930993 8:3779743-3779765 AGTTATTTGAAAGAGATCCCAGG + Intronic
1036708690 8:11063609-11063631 ATGTATATGCAAAACATGGCTGG + Intronic
1037332551 8:17757821-17757843 AGTTATTTCCCAAAAGTGGCCGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038922999 8:32106288-32106310 AGTTATATGCACAAGCTGTCTGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045304382 8:100945736-100945758 ACCTATTTGAAAAAGATGGTAGG + Intronic
1045754119 8:105521871-105521893 AGTTATTTGAAAGATTTGGCTGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046189444 8:110772947-110772969 GGTTATTTGAAACAGATTGCGGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046804662 8:118466673-118466695 AGTAATTTGTAAAGGATGGTCGG - Intronic
1047422507 8:124718680-124718702 AGATATTTGCAGAAGGAGGCTGG - Intronic
1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG + Intergenic
1047782985 8:128124748-128124770 AGTTTCTTGCAAAAAATGACTGG + Intergenic
1048089970 8:131229186-131229208 AGTTATTTCCATAAACTGGCTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052128804 9:24814793-24814815 AGTTACTTGGAAAAGATGATTGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054556832 9:66665514-66665536 AGTTATTCACAGGAGATGGCAGG + Intergenic
1054702315 9:68425288-68425310 AATTGTTTTCAAAAGATGGCAGG + Intronic
1054863616 9:69977652-69977674 AGTATTTTGCCAAAGATAGCAGG - Intergenic
1055471506 9:76616246-76616268 AGGTATATGAAAAAGATGTCGGG - Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058704706 9:107628679-107628701 ATTTATTTGAAAAATTTGGCTGG - Intergenic
1058936638 9:109775577-109775599 ATTTATTTTCAAAAGATCCCAGG + Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1061790043 9:133054521-133054543 AGTGATTTGCCAAGGAAGGCGGG + Intronic
1061849986 9:133408908-133408930 TGTTACTTGCAAAAGGTGGCGGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186640979 X:11455171-11455193 GGTTATTTTCAAAAGAGGCCTGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187700201 X:21957580-21957602 CATTATTTGAAAAAGAAGGCCGG - Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191812550 X:65204766-65204788 AGTTATTTCCAAAATATGTGAGG - Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192789400 X:74366470-74366492 AGTTATTCAGAAAGGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195054511 X:101130470-101130492 TATTATTTACAAAAGATGTCAGG - Intronic
1195228465 X:102822239-102822261 AGTTATCTAGGAAAGATGGCAGG - Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1195990403 X:110676857-110676879 AGTTTTTAACAAAAGATAGCAGG - Intronic
1196062531 X:111426584-111426606 AGAAATTTGAACAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196488057 X:116237102-116237124 AATTATTTCCAAAATAGGGCCGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197293817 X:124692708-124692730 AGTTATTTGAAAATTCTGGCCGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199354574 X:146846913-146846935 AGATATTTAGAAAAGATGGAAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200914530 Y:8559837-8559859 AGCTATCAGCAAAAGATGGTTGG - Intergenic
1200962879 Y:9011220-9011242 GGGTGTCTGCAAAAGATGGCTGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202044081 Y:20719483-20719505 AATTATTGGTAAAATATGGCCGG - Intergenic
1202150227 Y:21837561-21837583 GGGTGTCTGCAAAAGATGGCTGG + Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202179643 Y:22128626-22128648 AGGTGTGAGCAAAAGATGGCTGG + Intergenic
1202211718 Y:22457768-22457790 AGGTGTGAGCAAAAGATGGCTGG - Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic