ID: 987663096

View in Genome Browser
Species Human (GRCh38)
Location 5:20903355-20903377
Sequence CACCCGACACCCTCCCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987663095_987663096 10 Left 987663095 5:20903322-20903344 CCAGTTCTTGTAGGAACTAATAG No data
Right 987663096 5:20903355-20903377 CACCCGACACCCTCCCCTCAAGG No data
987663093_987663096 28 Left 987663093 5:20903304-20903326 CCAGTTTATTTTTAACAACCAGT No data
Right 987663096 5:20903355-20903377 CACCCGACACCCTCCCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987663096 Original CRISPR CACCCGACACCCTCCCCTCA AGG Intergenic
No off target data available for this crispr