ID: 987669246

View in Genome Browser
Species Human (GRCh38)
Location 5:20985994-20986016
Sequence AACAGACAAAAGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987669246_987669248 -1 Left 987669246 5:20985994-20986016 CCAAATTTGGCCTTTTGTCTGTT No data
Right 987669248 5:20986016-20986038 TTTTGTTAATAAACTTTTATTGG No data
987669246_987669250 24 Left 987669246 5:20985994-20986016 CCAAATTTGGCCTTTTGTCTGTT No data
Right 987669250 5:20986041-20986063 GACAATAAACTTTTTATAGATGG No data
987669246_987669249 2 Left 987669246 5:20985994-20986016 CCAAATTTGGCCTTTTGTCTGTT No data
Right 987669249 5:20986019-20986041 TGTTAATAAACTTTTATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987669246 Original CRISPR AACAGACAAAAGGCCAAATT TGG (reversed) Intergenic
No off target data available for this crispr