ID: 987674204

View in Genome Browser
Species Human (GRCh38)
Location 5:21052732-21052754
Sequence GAATGAAAGAAGTGTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987674201_987674204 14 Left 987674201 5:21052695-21052717 CCCAGATTCAAGGTAAGGGAAGA No data
Right 987674204 5:21052732-21052754 GAATGAAAGAAGTGTCAGTGAGG No data
987674199_987674204 18 Left 987674199 5:21052691-21052713 CCAGCCCAGATTCAAGGTAAGGG No data
Right 987674204 5:21052732-21052754 GAATGAAAGAAGTGTCAGTGAGG No data
987674202_987674204 13 Left 987674202 5:21052696-21052718 CCAGATTCAAGGTAAGGGAAGAC No data
Right 987674204 5:21052732-21052754 GAATGAAAGAAGTGTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987674204 Original CRISPR GAATGAAAGAAGTGTCAGTG AGG Intergenic
No off target data available for this crispr