ID: 987675025

View in Genome Browser
Species Human (GRCh38)
Location 5:21063399-21063421
Sequence TTTTAGCCATAGCCGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987675025_987675032 13 Left 987675025 5:21063399-21063421 CCCAGCTCCGGCTATGGCTAAAA No data
Right 987675032 5:21063435-21063457 AGCTCAGGCCATTGCTTCAGAGG 0: 229
1: 567
2: 911
3: 1254
4: 1342
987675025_987675030 -2 Left 987675025 5:21063399-21063421 CCCAGCTCCGGCTATGGCTAAAA No data
Right 987675030 5:21063420-21063442 AAGGGACCAAAGTACAGCTCAGG No data
987675025_987675033 14 Left 987675025 5:21063399-21063421 CCCAGCTCCGGCTATGGCTAAAA No data
Right 987675033 5:21063436-21063458 GCTCAGGCCATTGCTTCAGAGGG 0: 228
1: 554
2: 874
3: 1224
4: 1332
987675025_987675035 27 Left 987675025 5:21063399-21063421 CCCAGCTCCGGCTATGGCTAAAA No data
Right 987675035 5:21063449-21063471 CTTCAGAGGGTACAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987675025 Original CRISPR TTTTAGCCATAGCCGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr