ID: 987675350

View in Genome Browser
Species Human (GRCh38)
Location 5:21066177-21066199
Sequence TTGTAAAAGCAGGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987675350_987675358 30 Left 987675350 5:21066177-21066199 CCCTCTTCCTCCTGCTTTTACAA No data
Right 987675358 5:21066230-21066252 CCATGATTGGAAGCTTCCTGAGG 0: 363
1: 1274
2: 7740
3: 9794
4: 7194
987675350_987675356 17 Left 987675350 5:21066177-21066199 CCCTCTTCCTCCTGCTTTTACAA No data
Right 987675356 5:21066217-21066239 ATTTTGTCTTTTGCCATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987675350 Original CRISPR TTGTAAAAGCAGGAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr