ID: 987680210

View in Genome Browser
Species Human (GRCh38)
Location 5:21125751-21125773
Sequence TCTCATGAAGGGAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987680202_987680210 30 Left 987680202 5:21125698-21125720 CCATTTTCCACCAGATGTTCTTC No data
Right 987680210 5:21125751-21125773 TCTCATGAAGGGAGGGAGCTTGG No data
987680203_987680210 23 Left 987680203 5:21125705-21125727 CCACCAGATGTTCTTCTGTTTGC No data
Right 987680210 5:21125751-21125773 TCTCATGAAGGGAGGGAGCTTGG No data
987680204_987680210 20 Left 987680204 5:21125708-21125730 CCAGATGTTCTTCTGTTTGCATA No data
Right 987680210 5:21125751-21125773 TCTCATGAAGGGAGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987680210 Original CRISPR TCTCATGAAGGGAGGGAGCT TGG Intergenic
No off target data available for this crispr