ID: 987682177 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:21151221-21151243 |
| Sequence | ATGTCCTTCTTTATGAGGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987682174_987682177 | -2 | Left | 987682174 | 5:21151200-21151222 | CCTGCATGTTTTGAAATTTTGAT | No data | ||
| Right | 987682177 | 5:21151221-21151243 | ATGTCCTTCTTTATGAGGGATGG | No data | ||||
| 987682173_987682177 | 4 | Left | 987682173 | 5:21151194-21151216 | CCATTGCCTGCATGTTTTGAAAT | No data | ||
| Right | 987682177 | 5:21151221-21151243 | ATGTCCTTCTTTATGAGGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987682177 | Original CRISPR | ATGTCCTTCTTTATGAGGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||