ID: 987682177

View in Genome Browser
Species Human (GRCh38)
Location 5:21151221-21151243
Sequence ATGTCCTTCTTTATGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987682174_987682177 -2 Left 987682174 5:21151200-21151222 CCTGCATGTTTTGAAATTTTGAT No data
Right 987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG No data
987682173_987682177 4 Left 987682173 5:21151194-21151216 CCATTGCCTGCATGTTTTGAAAT No data
Right 987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987682177 Original CRISPR ATGTCCTTCTTTATGAGGGA TGG Intergenic
No off target data available for this crispr