ID: 987683463

View in Genome Browser
Species Human (GRCh38)
Location 5:21166463-21166485
Sequence AAGAGTGCACAAATGGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987683463_987683467 17 Left 987683463 5:21166463-21166485 CCTAGGTCCATTTGTGCACTCTT No data
Right 987683467 5:21166503-21166525 AGCAAGGACACTGCTAAGTCAGG No data
987683463_987683465 1 Left 987683463 5:21166463-21166485 CCTAGGTCCATTTGTGCACTCTT No data
Right 987683465 5:21166487-21166509 TGTAAAATCCAATGTTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987683463 Original CRISPR AAGAGTGCACAAATGGACCT AGG (reversed) Intergenic
No off target data available for this crispr