ID: 987683832

View in Genome Browser
Species Human (GRCh38)
Location 5:21171179-21171201
Sequence ATATAGTTATTTAGGTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987683829_987683832 0 Left 987683829 5:21171156-21171178 CCATCAAATAAAGTCACACTGAA No data
Right 987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG No data
987683828_987683832 1 Left 987683828 5:21171155-21171177 CCCATCAAATAAAGTCACACTGA No data
Right 987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987683832 Original CRISPR ATATAGTTATTTAGGTCAAA GGG Intergenic
No off target data available for this crispr